‘22‐S‐Hydroxycholesterol protects against ethanol‐induced liver injury by blocking the auto/paracrine activation of MCP‐1 mediated by LXRα’
by Tae‐Young Na, Young‐Hyun Han, Na‐LeeKa, Han‐Su Park, Yun Pyo Kang, Sung Won Kwon, Byung‐Hoon Lee and Mi‐Ock Lee, J Pathol 2015; 235: 710–720. DOI: 10.1002/path.4494
The above article, published online on 5 January 2015 in Wiley Online Library (http://wileyonlinelibrary.com), contained errors in the description of some of the primers in Tables S1 and S2, the latter resulting in the generation of incorrect data, presented in Figure 3D. The authors wish to correct the scientific record by providing the correct primer sequences, and new data for Figure 3D, shown below. The authors apologize for any inconvenience caused. The editors are grateful to a researcher who raised their concerns with us.
In Table S1 these sequences were used for RNA interference:
siLXRα Sense 5′‐gagacaucucggagguacatt‐3′; Antisense 5′‐uguaccuccgagaugucuctt‐3′
siLXRβ Sense 5′‐cgagcuuugccgugucugutt‐3′; Antisense 5′‐acagacacggcaaagcucgtt‐3′
In Table S2 these sequences were used for the mouse MCP‐1 promoter:
Sense 5′‐caagaggtaccgcaaactagg‐3′; Antisense 5′‐ ctctgtatagtcctggctgtc ‐3′
The corrected Figure 3D is:
Figure 1.
