Skip to main content
Data in Brief logoLink to Data in Brief
. 2019 Nov 19;28:104838. doi: 10.1016/j.dib.2019.104838

Data of whole genome sequencing of five garden asparagus (Asparagus officinalis) individuals with the MinION nanopore sequencer

Daisuke Tsugama a,b,, Kaien Fujino b
PMCID: PMC6889792  PMID: 31832531

Abstract

Garden asparagus (Asparagus officinalis) is a perennial, dioecious crop. Genomic DNA samples were prepared from five A. officinalis individuals that differ in sex and phenotypes, and sequenced with the MinION nanopore sequencer. The obtained data were 1.5–5 Gb/sample, and the average read length was larger than 1.4 kb for all the samples. The resulting reads were mapped to the existing A. officinalis genome sequence. The existing A. officinalis transcript sequences were mapped to the MinION-derived reads. On the basis of these mapping results, flanking sequences of five partial gene fragments that previously had not been mapped to any region of the existing genome were determined by genomic PCR followed by Sanger sequencing. These sequences enabled to estimate the genomic positions of those five partial gene fragments. The MinION-derived data and the flanking sequences of the five gene fragments were deposited in the NCBI (National Center for Biotechnology Information) SRA (Sequence Read Archive) database and the NCBI Nucleotide database, respectively.

Keywords: Asparagus officinalis, Gene cloning, Nanopore sequencing, Whole genome sequencing


Specifications Table

Subject Plant Science
Specific subject area Genomics of garden asparagus (Asparagus officinalis)
Type of data Tables
How data were acquired Whole genomes of Asparagus officinalis cultivars were sequenced with the MinION nanopore sequencer (type R9.4.1, Oxford Nanopore Technologies Ltd., UK (ONT)). Some of the A. officinalis gene fragments that had not been mapped to any region of the existing A. officinalis genome sequence were cloned by genomic PCR and confirmed by Sanger sequencing.
Data format Raw
Analyzed
Parameters for data collection Female and male individuals of two A. officinalis cultivars, ‘Gold Schatz’ and ‘New Jersey 264’ (NJ264), and a supermale individual of ‘Mary Washington 500W’ were used for this study. They have been maintained in an open field in Hokkaido University for 10 years or longer. Genomic DNA for the sequencing was prepared from floral buds of those plants.
Description of data collection The genomic DNA was sheared, end-repaired, and used for library construction. The MinION sequencing was run with the MinKNOW software (ONT). The resulting FAST5 files were converted to FASTQ files with the Albacore basecaller (version 2.1.3, ONT). The resulting read sequences were compared with the existing A. officinalis transcript sequences and the supermale genome sequence [[1], [2], [3], [4]] with the MegaBLAST aligner [5]. On the basis of this result, flanking sequences of five gene fragments whose genomic positions were unknown were determined by genomic PCR followed by Sanger sequencing.
Data source location Hokkaido University
Sapporo-shi, Hokkaido, Japan
North latitude 43°07′ and east longitude 141°34′
Data accessibility Repository name: NCBI (National Center for Biotechnology Information) SRA (Sequence Read Archive) and Nucleotide databases
Data identification number: SRR9643835-SRR9643839 (SRA); MN311180-MN311184 (Nucleotide)
Direct URL to data:
https://www.ncbi.nlm.nih.gov/sra (SRA)
https://www.ncbi.nlm.nih.gov/nuccore (Nucleotide)
Value of the Data
  • These data add to the existing data of the Asparagus officinalis (garden asparagus) genome sequence, and facilitate cloning of genes and developing DNA markers of various A. officinalis cultivars

  • A. officinalis researchers and breeders will benefit from these data

  • These data can be used to modify incomplete parts of the existing A. officinalis genome data

1. Data

Samples and data regarding the MinION sequencing are summarized in Table 1. Raw data obtained from the MinION sequencing were deposited as FASTQ format in the NCBI SRA database (accession numbers: SRR9643835-SRR9643839, Table 1 “Data accessibility”). In a previous study, ∼2% of the A. officinalis gene fragments, which had been obtained from de novo assembly of RNA sequencing-derived reads [1,2], were not mapped to the existing A. officinalis genome sequence [4]. With the help of the MinION-derived data, flanking sequences of five of such gene fragments were cloned, and their genomic positions were estimated (Table 2). These sequences were deposited in the NCBI Nucleotide database (accession numbers: MN311180-MN311184, Table 1 “Data accessibility”).

Table 1.

Summary of the MinION sequencing.

Cultivar, sex Notes NCBI BioSample IDa NCBI SRA IDa The number of reads The number of bases
New Jersey 264, female Cladodes have anthocyanins SAMN12214960 SRR9643836 1363568 2032856420
New Jersey 264, male Cladodes have anthocyanins SAMN12214961 SRR9643835 1736516 3190967035
Gold Schatz, female Cladodes have no anthocyanins; homeotic mutant [6] SAMN12214958 SRR9643838 1411539 2464957402
Gold Schatz, male Cladodes have no anthocyanins SAMN12214959 SRR9643837 2296838 5536952756
Mary Washington 500W, supermale Cladodes have anthocyanins SAMN12214962 SRR9643839 669742 1525107676
a

These are components of the NCBI BioProject PRJNA552649.

Table 2.

Genes whose positions in the genome were estimated with the help of the MinION data.

Gene namea NCBI Nucleotide ID Corresponding position in the genomeb Closest homolog in Arabidopsis
Aspof_comp39872 _c1_seq1 MN311180 Chromosome 2, 3191600-3194220 AT2G39350.1 (ABC-2 type transporter family protein)
Aspof_comp56646 _c4_seq1 MN311181 Chromosome 1, 132224408-132225250 AT4G24660.2 (Homeobox protein 22)
Aspof_comp57098 _c0_seq1 MN311182 Chromosome 9, 62811727-62814775 AT3G48800.1 (Sterile alpha motif (SAM) domain-containing protein)
Aspof_comp57295 _c1_seq1 MN311183 Chromosome 5, 14627566-14628935 AT3G51550.1 (Malectin/receptor-like protein kinase family protein)
Aspof_comp59943 _c2_seq1 MN311184 Chromosome 3, 973061-973883 AT5G15210.1 (Homeobox protein 30)
a

These are names of the transcripts (i.e., contigs) generated by de novo assembly of RNA sequencing-derived reads [1,2].

b

The positions correspond to the regions with sequential undetermined (‘N’) bases in the existing A. officinalis genome sequence.

2. Experimental design, materials, and methods

A. officinalis plants including five individuals used in this study have been maintained for 10 years or longer in an open field in Hokkaido University. Genomic DNA was prepared from their floral buds with the DNeasy Plant Mini kit (Qiagen, Germany). DNA shearing, end-repair, dA-tailing and adapter ligation for library construction for the MinION sequencing as well as library loading into the MinION flow cell (R9.4.1, ONT) were performed with Ligation Sequencing Kit 1D (ONT), g-TUBE (Covaris, USA), NEBNext Ultra II End Repair/dA-Tailing Module (New England Biolabs, USA (NEB)), Blunt/TA Ligase Master Mix (NEB) and Library Loading Bead Kit (ONT), according to ONT's instructions for 1D Lambda Control Experiment. The sequencing run was performed with the MinKNOW software with the live basecalling option disabled. For each library (i.e., sample), a new flow cell was used, and the run time was 48 hours. The resulting FAST5 files in the “pass” folders, which correspond to sequences with high quality scores, were converted to FASTQ files with the Albacore basecaller (version 2.1.3, ONT). The resulting FASTQ files were concatenated according to samples, and deposited in the NCBI SRA (Sequence Read Archive) database (accession numbers are presented in Table 1).

The reads derived from the MinION sequencing were mapped to the existing A. officinalis genome sequence, which derived from a supermale individual (NCBI RefSeq accession: GCF_001876935.1) [3], with the MegaBLAST aligner in the BLAST + suite [5] with default parameters. The putative A. officinalis transcript sequences that were derived from RNA sequencing [1,2] and that were not mapped to the above-mentioned genome sequence [4] (‘orphan genes’) were mapped to the MinION-derived reads with MegaBLAST with default parameters. Flanking sequences and genomic positions of five randomly chosen orphan genes were estimated with those MegaBLAST results. These orphan genes and their flanking sequences were amplified by PCR using the male NJ264 plant-derived genomic DNA as the template and the primer pairs listed in Table 3. Sequences of the resulting PCR products were determined by Sanger sequencing [7], and deposited in the NCBI Nucleotide database (accession numbers are presented in Table 2).

Table 3.

Primers used to clone the genomic regions of A. officinalis gene fragments that had not been mapped to the existing A. officinalis genome sequence.

Target gene Primer sequence (5' > 3′) Annealing sitea
Aspof_comp39872_c1_seq1 TCCCTCCAATTCACTCACCATTTGAACATC Chromosome 2, 3191383-3191412
Aspof_comp39872_c1_seq1 TTAGATTTAGATTGCATCATAACCACCTAC Chromosome 2, 3194827-3194798
Aspof_comp56646_c4_seq1 AGTGAGAACAAGTAGAGCAAACTGAGGCAG Chromosome 1, 132224305-132224334
Aspof_comp56646_c4_seq1 ACTGCATGCACATACATAGATGCAGTAGAG Chromosome 1, 132225392-132225363
Aspof_comp57098_c0_seq1 GAGATGACTTTGAGTTGCTACTTCGACATC Chromosome 9, 62810323-62810352
Aspof_comp57098_c0_seq1 TTTGGAGGTCAAGTACGACTTCTAAAAGCC Chromosome 9, 62815221-62815192
Aspof_comp57295_c1_seq1 TCTCGGCTGTCTCGACGAACTTCTTGAAGC Chromosome 5, 14626818-14626847
Aspof_comp57295_c1_seq1 AGAAACATGAGATCTTACATGGGACATGTG Chromosome 5, 14629427-14629397
Aspof_comp59943_c2_seq1 CACATACAACTTCAGTTTGAAGCCAAGATC Chromosome 3, 972084-972113
Aspof_comp59943_c2_seq1 CTGAGACAGTTACAACCGATTATCAGGATG Chromosome 3, 974605-974576
a

If X > Y in the pattern “X–Y” (i.e., in the second, fourth, sixth, eighth and tenth rows), corresponding primers anneal in the reverse orientation.

Acknowledgments

This study was supported by the JSPS (Japan Society for the Promotion of Science) KAKENHI grants (grant numbers: 16K14843 and 19K15827).

Conflict of Interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

References

  • 1.Harkess A., Mercati F., Shan H.Y., Sunseri F., Falavigna A., Leebens-Mack J. Sex-biased gene expression in dioecious garden asparagus (Asparagus officinalis) New Phytol. 2015;207:883–892. doi: 10.1111/nph.13389. [DOI] [PubMed] [Google Scholar]
  • 2.Harkess A., Mercati F., Shan H.Y., Sunseri F., Falavigna A., Leebens-Mack J. Dryad Digital Repository; 2015. Data from: Sex-Biased Gene Expression in Dioecious Garden asparagus (Asparagus Officinalis) [DOI] [PubMed] [Google Scholar]
  • 3.Harkess A., Zhou J., Xu C., Bowers J.E., Van der Hulst R., Ayyampalayam S., Mercati F., Riccardi P., McKain M.R., Kakrana A., Tang H., Ray J., Groenendijk J., Arikit S., Mathioni S.M., Nakano M., Shan H., Telgmann-Rauber A., Kanno A., Yue Z., Chen H., Li W., Chen Y., Xu X., Zhang Y., Luo S., Chen H., Gao J., Mao Z., Pires J.C., Luo M., Kudrna D., Wing R.A., Meyers B.C., Yi K., Kong H., Lavrijsen P., Sunseri F., Falavigna A., Ye Y., Leebens-Mack J.H., Chen G. The asparagus genome sheds light on the origin and evolution of a young Y chromosome. Nat. Commun. 2017;8:1279. doi: 10.1038/s41467-017-01064-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Ide M., Masuda K., Tsugama D., Fujino K. Death of female flower microsporocytes progresses independently of meiosis-like process and can be accelerated by specific transcripts in Asparagus officinalis. Sci. Rep. 2019;9:2703. doi: 10.1038/s41598-019-39125-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Camacho C., Coulouris G., Avagyan V., Ma N., Papadopoulos J., Bealer K., Madden T.L. BLAST+: architecture and applications. BMC Bioinf. 2009;10:421. doi: 10.1186/1471-2105-10-421. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Asada Y., Kasai N., Adachi Y., Kanno A., Ito N., Yun P.-Y., Masuda K. A vegetative line of asparagus (Asparagus officinalis) with a homeotic change in flower development is correlated with a functional deficiency in class-B MADSbox genes. J. Hortic. Sci. Biotechnol. 2006;81:874–882. [Google Scholar]
  • 7.Sanger F., Nicklen S., Coulson A.R. DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. U.S.A. 1977;74:5463–5467. doi: 10.1073/pnas.74.12.5463. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Data in Brief are provided here courtesy of Elsevier

RESOURCES