Fenretinide, Tocilizumab & Reparixin Provide Multifaceted Disruption of Oral Squamous Cell Carcinoma Stem Cell Properties: Implications for Tertiary Chemoprevention.

Abstract

Locoregional recurrence of oral squamous cell carcinoma (OSCC) dramatically reduces patient survival. Further, as many OSCC recurrences are inoperable, radiation or chemotherapy with or without biologic adjuncts are the remaining treatment options. While the tumors may initially respond, radiation and chemotherapy-resistant cancer stem cells (CSCs) can readily repopulate OSCC tumors. Currently, following the initial OSCC treatment, patients are closely monitored until a recurrence or a second primary is detected. Identification of agents with complementary mechanisms to suppress CSC tumorigenic functions could change this passive approach. The goals of this study were two-fold: 1) develop and validate CSC-enriched (CSCE) OSCC cell lines, 2) identify chemopreventive agents that obstruct multiple CSCE protumorigenic pathways. CSCE cultures, which were created by paclitaxel treatment followed by 3 tumorsphere passes, demonstrated CSC characteristics including increased expression of stem cell and inflammatory genes, increased ALDH activity, enhanced in vitro/in vivo proliferation and invasion. Three chemopreventives, fenretinide, tocilizumab and reparixin, were selected due to their distinct and complementary CSC-disruptive mechanisms. The CSCE selection process modulated the cells’ intermediate filaments resulting in an epithelial-predominant (enhanced cytokeratin, proliferation, IL-6 release) and a mesenchymal-predominant (upregulated vimentin, invasion, IL-8 release) lines. Our results confirm that 4HPR binds with appreciably higher affinity than Wnt at the Frizzled binding site and significantly inhibits CSC-enabling Wnt-β-catenin downstream signaling. Notably, combination fenretinide-tocilizumab-reparixin treatment significantly suppressed IL-6 and IL-8 release, stem cell gene expression, and invasion in these diverse CSCE populations. These promising multi-agent in-vitro data provide the basis for our upcoming in-vivo CSCE tertiary chemoprevention studies.

Introduction

Oropharyngeal cancer, which is a worldwide health problem associated with significant morbidity and mortality, will affect over 53,000 Americans in 2019 [https://www.cancer.org/cancer/oral-cavity-and-oropharyngeal-cancer/about/key-statistics.html ]. Despite treatment advances e.g. fluorescence-guided surgery and intraoperative radiation, five- year survival rates have only modestly improved for human papillomavirus negative oral squamous cell carcinomas (OSCC) and still hover around 50% [1]. Following initial therapy, OSCC patients are managed by close clinical follow up often supplemented with imaging (CT, PET or MRI) studies. Despite image-enhanced monitoring and knowledge of the risk factors for recurrence (close margins, immunosuppression, high histologic grade, deep tumor extension), over a third of patients develop recurrent, life-threatening, inoperable OSCC tumors [2, 3]. In accordance with its relentless and infiltrative nature, the majority of OSCC deaths are attributable to massive locoregional recurrences that arise from malignant transformation of dysplastic surface epithelium approximating the tumor resection site [2,3].

Treatment choices for recurrent, inoperable OSCCs are limited and include palliative radiation or chemotherapy with or without biologic adjuncts [4,5]. As OSCC tumors are primarily comprised of treatment-responsive transient amplifying cells and post-mitotic differentiated cells, tumors initially regress but eventually recur [6,7]. Cancer stem cells (CSCs), which comprise only a small percentage of total cells in OSCC tumors, play a prominent role in post-chemotherapy OSCC recurrences [6,7 ]. Notably, CSCs’ high levels of Phase III/drug egress enzymes endow CSCs with chemotherapeutic resistance [7]. Furthermore, due to their growth state reciprocity that facilitates transition to transient amplifying cells, CSCs readily repopulate treated OSCC tumors [6,7]. CSCs’ plasticity, which enables the epithelial-myoepithelial transition from an adherent, proliferative epithelial cell to a mobile, invasive myoepithelial phenotype, further facilitates tumorigenesis and metastases [8]. Clinical evidence shows OSCC progression coincides with a concurrent rise in CSCs, which implicates a contributory role for CSCs in OSCC carcinogenesis [9]. Collectively, these data demonstrate that suppression of CSCs’ tumorigenic properties is essential for effective, sustained duration of OSCC tertiary chemoprevention [3,4,9].

Currently, following initial management of the primary OSCC tumor, additional treatment is suspended until tumor recurrence or a second primary OSCC is detected [10]. Provided the deleterious effects of standard systemic chemotherapy, this delayed treatment approach is logical. In contrast, controlled release local delivery, which can provide therapeutic chemopreventive levels at the site without drug-related systemic toxicities, would enable a proactive tertiary chemoprevention approach [11]. Provided OSCC tumors’ extensive redundant signaling pathways and ability to modulate their microenvironment e.g. angiogenesis, local immune suppression, identification of multimodal agents with complementary mechanisms of action is a critical first step [12–14]. We have identified a group of three agents i.e. the vitamin A derivative, fenretinide (https://pubchem.ncbi.nlm.nih.gov/compound/5288209), the humanized monoclonal antibody to the IL-6 receptor, tocilizumab, and the CXCR1/CXCR2 inhibitor, reparixin (https://pubchem.ncbi.nlm.nih.gov/compound/reparixin), that function in a coordinated fashion to suppress key CSC tumorigenic mechanisms. The rationale for selection of these agents is as follows. Our labs have demonstrated fenretinide binds with exceptionally high affinity to and induces downstream chemopreventive effects on tyrosine kinases integral for sustained proliferation, migration and invasion [12, 15]. These additional chemopreventive mechanisms supplement fenretinide’s well-recognized growth regulation via induction of apoptosis and differentiation [12, 16]. The pro-inflammatory, pro-angiogenic cytokine, IL-6, facilitates tumorigenesis within the tumor microenvironment via influx of reactive species generating inflammatory cells and induction of angiogenesis [17]. Clinically, high IL-6 sera levels correspond to an overall poor prognosis in OSCC patients [18]. In addition, OSCC cells generate very high levels of IL-6, and via their concurrent release of sIL-6R, tumor cells can function as both IL-6 effectors and targets [12, 19]. Additionally, we have shown that a locally delivered fenretinide-tocilizumab combination treatment provided additive in vivo chemopreventive efficacy in an OSCC xenograft model [12].

The final agent, reparixin, was selected for its abilities to interfere with IL-8 signaling [20]. The inflammatory cytokine IL-8 promotes angiogenesis and tumor cell proliferation, while also enabling EMT [20, 21]. Furthermore, as OSCC cells respond to and produce IL-8, the potential for an intracrine growth loop within the tumor microenvironment is feasible [22]. Clinically, high levels of IL-8 at the OSCC tumor invasive front is associated with poor prognosis [23]. IL-8 enhances OSCC cancer stem cell proliferation and survival via increased expression of its cognate receptors CXCR1 and CXCR2 [20]. IL-8-CXCR1/2 binding activates tyrosine kinase (PI3K-Akt, PI3K-Src, JAK2 or MAPK) mediated signaling cascades that facilitate expression of a bank of tumor promoting genes [24]. An international Phase II clinical trial to assess the effects of combination reparixin + paclitaxel on disease free survival in patients with metastatic triple negative breast cancer is ongoing [25-https://clinicaltrials.gov/ct2/show/NCT02370238 ; https://www.centerwatch.com/clinical-trials/listings/70211/metastatic-breast-cancer-double-blind-study-paclitaxel-combination/. ]. In this trial, reparixin was specifically selected to disrupt the breast cancer stem cells [25].

The goals of the study were twofold. First to develop and validate a CSC-enriched OSCC cellular model. Secondly, to assess the effects of these three bioactive agents, singularly and in combination, on key CSC tumorigenic activities. Our data reveal that while single agents interfere with CSC essential activities e.g. gratuitous growth factor signaling, the triple agent combination conveys the greatest chemopreventive impact as demonstrated by significant reductions in IL-6 and IL-8 release, stem cell associated gene expression, and invasion of a synthetic basement membrane. Consistent with its ability to associate with high affinity to signal transduction binding sites, fenretinide significantly suppressed Wnt-3 β-catenin signaling.

Materials & Methods

Cell culture, validation and stem cell enrichment.

OSCC tumor tissues were obtained in accordance with Ohio State University Institutional Review Board approval. JSCC-1, JSCC-2, and JSCC-3 cells, which were isolated from OSCCs of tonsil, tongue and floor of mouth, respectively, were cultured in Advanced DMEM supplemented with 1X Glutamax and 5% heat-inactivated FBS (GIBCO; Life Technologies; “complete” medium). All OSCC tumors from which the JSCC cell lines were derived represented primary resections that had not been exposed to chemotherapy. Furthermore, none of the OSCC tumors used to generate the OSCC cell lines showed the histologic features consistent with oncogenic human papillomavirus DNA (see Supplemental Figure 1). The highly tumorigenic CAL27 ATTC CRL-2095 human tongue OSCC cell line (2095sc), which has been well characterized by our lab [12, 15], was also evaluated and used for some in vivo explant studies. An immortalized, nontumorigenic cell line derived from E6/E7 transduced normal human oral keratinocytes [ScienCell, Carlsbad, CA HOK#2610 (EPI)] was also used for selected experiments. Sera was omitted (“base” medium) during experiments to assess endogenous or growth factor related effects. The most recent cell lines authentication was performed via short tandem repeats profiling analyses at the Genetic Resources Core Facility (Johns Hopkins University, Baltimore, MD) in December 2018. Mycoplasma status was not assessed. SEL cell cultures were used between PDL4 to PDL8 while non-selected cell lines were passed approximately five times. Clinical parameters of the primary OSCC tumors, such as the TNM classification, perineural and vascular invasion and immunohistochemical (IHC) characterizations have been previously reported [15].

Two recognized properties of CSC i.e. chemotherapeutic resistance and anchorage independent growth were employed to obtain cancer stem cell enriched (CSCE) populations. Preliminary dosing studies to optimize paclitaxel treatment [(2, 5, and 10 nM, paclitaxel dissolved in DMSO, final [DMSO] >0.01%)] on cell proliferation (hemocytometer counting) and viability (trypan blue exclusion) revealed that 5 nM paclitaxel (fresh drug added q 24h x 72h) dramatically reduced cell numbers yet retained a small cell subset of viable cells (See Supplemental Figure 2). This protocol i.e. fresh 5 nM paclitaxel, q24h x 3 days was then used for the initial selection step. Paclitaxel-selected cells were then grown to confluence in complete drug-free medium and then transferred to Ultra low-attachment culture flasks (Corning, Fisher Scientific, Pittsburgh PA) with complete medium. After two days in the low attachment flasks, cells were centrifuged, resuspended, and returned to Ultra low attachment flasks x 3 to generate tertiary tumorspheres. Increases in recognized stem cell markers (RT-PCR analyses) and functional assays (ALDH activity) were used to confirm a CSCE phenotype. CSCE cultures are designated by SEL following cell line e.g. JSCC2 SEL, 2095scSEL.

Chemopreventive treatment doses [4-HPR (Cedarburg Pharmaceuticals, Grafton, WI, generous donation), tocilizumab (Ohio State University James Cancer Hospital Pharmacy), reparixin (Sigma Chemical Company, St. Louis, MO)] were derived from our previous studies [12, 15 ], literature values [26], and our combined viability & proliferation studies.

Determination of ALDH Functional Activity

Twenty-four hours prior to ALDH1 assay [ALDH Activity Colorimetric Assay (Abcam, Cambridge, MA)], cells were treated in the following experimental groups: 1) 5 μM fenretinide, 2) 1 μg/ml tocilizumab, 3) 10 μM reparixin, 4) fenretinide+ tocilizumab, 5) fenretinide+ reparixin, 6) tocilzumab + reparixin, 7) fenretinide+tocilizumab+ reparixin, 8) DMSO control (<0.01%). Combinations employed the same drug levels as single treatment. Functional ALDH activity was determined in cell lysates at 450 nm using FLUOstar Omega (BMG Labtech, Germany) and analyzed according to manufacturer’s protocol in mU/mL. An NADH standard curve (r>0.995) was conducted with every assay and the samples’ activities (reported as nM NAD(P))H/mg protein) were within the linear range of the standard curve.

RNA isolation and RT-PCR Analyses.

Total RNA was isolated from cultured OSCC cells using the mirVana miRNA isolation Kit (Thermo Fisher Scientific, MA). RNA concentrations were measured via Nanodrop ND-1000 (Nanodrop, Wilmington, DE). Integrity of total RNA was evaluated using capillary electrophoresis (Bioanalyzer 2100, Agilent Technologies, Santa Clara, CA.) and quantified using a Nanodrop 1000 (Nanodrop, Wilmington, DE). The total RNA was reverse-transcribed to cDNA using a High-Capacity cDNA Reverse Transcription Kits (AB Applied Biosystems, Foster City, CA). An ABI 7500 RealTime PCR System (Applied Biosystems) was used for amplification and detection of the Quantitative Reverse Transcriptase PCR (qRT-PCR) products. Data were normalized using the endogenous GAPDH control. NCBI database sequence information (https://www.ncbi.nlm.nih.gov/tools/primer-blast/ ) was used to design the intron-spanning primers.

Comparison of proliferative potential of parent and CSCE cell xenografts.

Male BALB/c mice (n=10, Ohio State IACUC-approved) were obtained from Ohio State’s Shared Resources Target Validation Murine facility (https://cancer.osu.edu/research-and-education/shared-resources/target-validation). To control for any inter-animal tumor growth discrepancies, every mouse received injections of 1x10⁶ log growth 2095sc cells (control, left flank) and 1x10⁶ 2095scSEL (right flank) cells suspended in 100 μl Matrigel (Corning, Tewksbury, MA). Measurements were obtained daily (length x width) and mice were euthanized 14 days post OSCC cell implantation.

OSCC tumors and CSCE tumors were stained with hematoxylin and eosin and the IHC proliferation marker Ki-67 (Cell Signaling (Danvers, MA. 1:400 dilution, Cat#9027; Clone#D2H10). All histopathologic analyses were conducted by an investigator blinded to the experimental groups. H&E histologic sections were used to assess two dimensional tumor sizes (tumor center, KR887 stage micrometer) and the highest mitotic index (#mitoses/400x field). Images were captured via an Olympus BX50 microscope (Olympus) and Moticam 10/10.0 MP digital camera (Motic, Richmond, British Columbia). Ki-67 stained slides were scanned by Aperio Digital Pathology Slide Scanner (Leica, Buffalo Grove, IL.). Ki-67 IHC staining intensity was quantitative analyzed using Image-Pro Premier software (Media Cybernetics, Rockville, MD). The investigator outlined the tumor representative areas to exclude areas of necrosis and peripheral murine stroma.

Molecular Modeling of fenretinide-Frizzled Interactions

Wnt binding to the CRT domain of the transmembrane protein Frizzled initiates both canonical (β-catenin) and non-canonical “alternative” (YAP-TAZ) Wnt signaling, [27]. The Frizzled protein structure was obtained from the Protein databank 4F0A [The Protein Data Bank: http://www.rcsb.org/pdb/home/home.do, 28]. The missing loop was modeled using MOE (Molecular Operating Environment) [29]. The structure was optimized with Yasara using the default minimization algorithm [30]. All ligands were constructed in Spartan10 [31] and minimized using MMFF [32]. The optimized protein structure and ligands were docked using AutoDock Vina [33] using an exhaustiveness of 500. All calculations were repeated three times to ensure a thorough exploration of the binding site. Previous studies have shown that flexible amino acid side chains provide for optimal results therefore the side chains for amino acids: 71, 72, 74, 75, 77, 78, 121, 122, 125, 127-130, were made flexible to ensure a more realistic binding mode for all calculations. While the calculations were conducted using the Frizzled 8 protein, the high structural homology among all of the Frizzled proteins implies these structure-functional modeling data would be applicable to other Frizzled receptors [34].

Calculated binding free energies were used to determine a binding affinity (Ka) and dissociation constant (Kd) to compare to experimental data. ΔG = RT ln(Ka) or kA =e^-(DG/TR) and Kd = 1/Ka. During binding, the Wnt protein undergoes modification at Ser-187 by addition of a palmitoleic (PAM) acid [35]. The hydrophobic tail of the PAM lipid residue then binds to a specific groove in the Frizzled-CRT domain [35]. Frizzled’s lipid binding site was tested with palmitoleic acid (PAM), fenretinide and 4-oxo-fenretinide. Since PAM is very flexible it did not bind in the same orientation as the crystal structure. The binding analyses were repeated with a rigid PAM molecule in the crystal conformation. Binding energies were also evaluated using a segment of Wnt-PAM employing both rigid and flexible PAM structures.

TCF/LEF-Luciferase Assay to determine fenretinide’s effects on Wnt β-catenin signal transduction

Fenretinide’s effects on Wnt β-catenin signal transduction were evaluated by a TCF/LEF luciferase reporter assay (Qiagen, Germantown, MD). Cells were transfected (Lipofectamine, 3000 (Invitrogen/Fisher Scientific, Waltham, MA) with both the LEF/TCF luciferase reporter that contained concatemers of the wild type TCF/LEF binding sites plus the constitutively expressed internal control CMV-renilla luciferase (Qiagen). Base medium cultured cells were challenged with human recombinant Wnt3 (100ng/ml, Abcam, Cambridge, MA) 24 hours after transfection. Experimental groups consisted of: 1) 4-HPR (5uM) + Wnt3, 4-HPR 5uM (no Wnt3), DMSO vehicle control (<0.01%) along with positive and negative controls. fenretinide was added to the cells one hour prior to challenge with Wnt3 to enable fenretinide-FZD interactions. Luciferase activity was measured after 24 hours using the dual-luciferase reporter assay (Promega, Madison, WI.).

Immunoassays to determine OSCC cells release of Wnt-3, Il-6 and Il-8 in base medium.

Levels of Wnt-3 release were determined using a Wnt3a ELISA (R&D, Minneapolis, MN) with results reported as pg per 10⁶ cells. Chemopreventive effects on IL-6 and IL-8 release were evaluated by ELISAs (R&D Systems, Minneapolis, MN, pg/10⁶ cells).

Immunocytochemical staining to assess epithelial and mesenchymal intermediate filament expression and evaluate YAP-TAZ nuclear localization.

SCC2095sc, SCC2095sc SEL, JSCC2 and JSCC2 SEL cells were cultured on Lab-Tek chamber slides (Thermo Fisher Scientific, Waltham, MA) at a 1 x 10⁵/chamber in Advanced DMEM + 1x GlutaMax + 5% FBS media. Cells were fixed with 4% paraformaldehyde, permeabilized with 0.1% Tween (YAP/TAZ-0.1% Triton X-100), blocked, then incubated with vimentin (1:250, Abcam, Cambridge, MA, Cat# ab92547; Clone# EPR3776 ) , YAP/TAZ (1:100, Cell Signaling, Danvers, MA, Cat#8418; Clone# D24E4) and pancytokeratin MNF16 (1:25, Abcam, Cambridge, MA, Cat#ab756; Clone#MNF16) antibodies, followed by incubation with Alexa Fluor 488 conjugated secondary antibodies (1:1000, ThermoFisher Scientific, Waltham, MA, Cat#A11029). Nuclei were stained with 4’,6’-Diaminidino-2-phenylindole dihydrochloride (DAPI, VECTOR Laboratories, Burlingame, CA, Cat#H-1200 ). Fluorescence microscopy images were obtained by using an Olympus BX51 microscope (Olympus, Japan), Nikon DS-Fi1 digital camera (Nikon, Japan) and NIS-Elements software (Nikon Instruments Inc, Melville, NY).

Effects of chemopreventives on expression of key EMT-enabling proteins.

Initial studies employed hemocytometer cell counts with trypan blue exclusion to assess the effects of the chemopreventives (singularly and in combination, 5 μM 4-HPR, 10 μM reparixin, 1 μg/ml tocilizumab) on cell proliferation and viability over time. Chemopreventive doses were determined from our previous data or the literature [12, 15, 26].

The single and combined effects of fenretinide, tociluzumab, reparixin on YAP, TAZ and ZEB (all antibodies purchased from Cell Signaling, Danvers, MA), total and phosphorylated YAP and TAZ and total ZEB protein levels by image analyzed immunoblotting were conducted by methods in use in our lab [12, 15].

Assessment of ZEB and YAP siRNA on Directed Migration/Wound Healing.

Cell lines previously determined to undergo rapid directed migration (2095sc, JSCC1 and EPI) were transfected with siRNA (50 nM) of YAP, ZEB and the combination of YAP/ZEB in complete medium for 12 h for the scratch wound assays [siRNA sequences: YAP1:GGUCAGAGAUACUUCUUAAAUCACA; ZEB1: GUUFFAFAAUAAUCAAGCCAAUCTT].

Confluent cells were wounded with a pipette tip, washed with PBS and provided complete medium. Three images of every well (left, middle, right) were obtained daily (Apotome Fluorescence Microscope, Carl Zeiss, Dublin, CA), and AxioVision software (Carl Zeiss, Dublin, CA) until the wound was completely closed in the siRNA-free cultures. ImagePro software (Media Cybernetics, Inc., Rockville, MD) was used to quantitate wound closure.

Effects of the selected chemopreventives on cellular invasion of a synthetic basement membrane comprised of collagen type IV.

Fifty thousand 24-hour sera deprived cells/well were plated on type IV collagen-coated microporous polyester membrane (InnoCyte cell invasion kit, Calbiochem, San Diego, CA) with the following treatments: (5 μM 4-HPR (2095sc log and SEL cells), 10 μM 4-HPR (JSCC2 log and SEL cells), 2) 1 μg/ml tocilizumab, 3) 10 μM reparixin, 4) fenretinide+ tocilizumab, 5) fenretinide+ reparixin, 6) tocilzumab + reparixin, 7) fenretinide+tocilizumab+ reparixin, 8) DMSO control. Preliminary studies confirmed all cell line viabilities remained ≥96% and cell numbers remained comparable during all treatments. JSCC3 conditioned medium was used as the chemoattractant [15]. After 16 hours of invasion (37°C, 5% CO₂), cells were formalin fixed and stained with 0.1% v/v crystal violet solution. Images were captured by Nikon DS-Ri1 using NIS Elements (Nikon, Melville, NY), followed by target pixelation analyses by image segmentation [ImagePro software (Media Cybernetics, Inc., Rockville, MD)].

Statistical Analyses.

All statistical analyses used GraphPad Prism 6 software (GraphPad, La Jolla, CA). Data normality (Shapiro Wilks normality test) determined whether to employ parametric or nonparametric analyses. The Kruskal Wallis ANOVA followed by the Dunn’s Multiple Comparison post-hoc test were used to analyze the following studies: ALDH functional activity, TCF/LEF β-catenin signaling, siRNA wound migration, Wnt3a, IL-6 and IL-8 ELISAs, RT-PCR analyses and invasion. The OSCC xenograft data mitotic activity and Ki67 data were analyzed using an Unpaired t-test while the Ki-67 data were evaluated using a Mann Whitney U two-tailed test. “N numbers” for experiments were determined by conduction of sufficient repetitions to allow all cell lines to be evaluated for at least 3 separate experiments. The number of mice for the tumor implant analyses were based upon our previous in vivo studies [12]. As the researchers were directly involved in conduction of the experiments, they were not blinded to the experimental groups.

Results.

Cancer stem cell selection affected gene expression, enzyme function and in vivo growth capacity.

Cancer stem cell enrichment altered gene expression towards stem cell proteins (2095sc SEL) and protumorigenic proteins (2095sc SEL, JSCC2 SEL) (Figure 1.A.). Tumorsphere and CSCE cultures also demonstrated significantly higher activity of, and greater capacity to upregulate the NADPH generating enzyme, ALDH (Figure 1.B.) The CSCE phenotype was retained for at least 8 population doubling levels following CSC selection (See Supplemental Figure 3).

Figure 1. Paclitaxel challenge followed by tumorsphere selection x 3 generated cancer stem cell enriched (CSCE) cultures as shown by: altered gene expression (A), enhanced ALDH function (B) and greater proliferative potential in vivo (C).

A. Our data show cancer stem cell enrichment altered gene expression towards stem cell proteins (2095sc SEL) and protumorigenic proteins (2095sc SEL, JSCC2 SEL) (Data expressed as fold change relative to levels of gene expression in control, parent cultures, n=3 for all groups). B. ALDH function significantly increased during conditions that increased stem cells including tumorsphere cell suspensions and following paclitaxel-tumorsphere selection (n=5 for all groups, p<0.05). Further, stem cell enriched SEL cultures possessed increased ALDH functional activity during log growth (B.), and also showed the capacity to rapidly increase function over time (approximately 2.6 fold greater at 72h assessment) in accordance with greater culture confluence (n=3 for all groups, p<0.05 48h control relative to 48h SEL, p<0.01 72h control relative to 72h SEL). High ALDH activity generates abundant reduced nicotinamide adenine dinucleotides [NAD(P)H], which in turn provide reducing equivalents essential for mitochondrial ATP synthesis, biosynthesis of lipids and deoxynucleotides, detoxification of aldehydes, cytoprotective enzymes e.g. glutathione peroxidase, and facilitate cell proliferation. C. 1, 2, 3, 4, 5, 6: 1x10⁶ log growth 2095sc cells (control) and 1x10⁶ stem cell enriched (CSCE) 2095sc cells were placed in 100 μl Matrigel and injected into the flanks of nude mice. Every mouse contained both a control culture and SEL culture injection. Measurements were obtained daily (length x width) and mice were euthanized 14 days post 2095sc +/−SEL injections. Nine of 10 and 8 of 10 mice formed OSCC xenografts from the SCE and control cells, respectively. 1 & 2. While SEL tumors were larger at harvest, these differences were not statistically significant upon tumor size measurement with microscopy. 2. & 3. Representative images depict isolated OSCC xenograft tumors. The tumor nests appear as dark blue islands contained within the connective tissue stroma (3=control tumor, 4= SEL tumor, 20X image scale). Investigator-blinded quantification of tumor cell mitotic figures revealed significantly higher mitotic activity in the SEL tumors (white arrows depict mitotic figures) (p = 0.0114, n=10 each group, unpaired t-test) 5. (control) & 6. (SEL). Monoclonal Ki67 IHC staining intensity (Cell Signaling, Danvers, MA, 1:400, Cat#9027; Clone#D2H10) was quantitatively analyzed using Image-Pro Premier software (Media Cybernetics, Rockville, MD). Ki-67 IHC staining also revealed significantly greater cell cycle activity in the SEL xenografts (5. & 6. 100 X image scale, p <0.0499). Insert lower right hand corner depicts a higher image scale (200x) of Ki-67 staining in the control and SEL tumors, respectively.

CSCE xenografts showed statistically significant greater mitotic activity (p=0.014, n=10 both groups) and higher proliferation as indicated by Ki-67 quantitative analyses (p=0.049) (Figure 1.C. panels 5 & 6). The tumors also showed qualitative intergroup differences. While the OSCC parental/control cells possessed a more differentiated phenotype that exhibited increased cytoplasm and keratin production, the 2095sc CSCE tumor nests revealed more nuclear pleomorphism and higher nuclear to cytoplasmic ratios (Figure 1.C. panels 3 & 4. 5 & 6). Sizes of the tumor xenografts are presented in Supplemental Table I.

Fenretinide perturbs Wnt signaling.

Molecular modeling data reveal that fenretinide binds with appreciably higher affinity (~158 fold) relative to the endogenous Wnt-PAM ligand at the Wnt-Frizzled binding site (Figure 2.A.). Fenretinide’s oxidized metabolite, 4-oxo-fenretinide, also binds with greater affinity than Wnt-PAM, albeit at reduced levels (~15 fold) (Figure 2.A.). Signaling assays to assess functional effects revealed fenretinide significantly suppressed β-catenin activation in the 2095scSEL (p<0.05) and JSCC2SEL (p<0.01) CSCE lines (Figure 2.B.). All cell lines released Wnt3a (Figure 2.C.). Further, all cell lines demonstrated constitutive YAP-TAZ nuclear translocation (Figure 2.D.), which persisted following chemopreventive treatment. YAP and TAZ protein levels were refractory to addition of Wnt3a and chemopreventives (Figure 2.E.) that were not affected by chemopreventives. Further, all lines released Wnt3a (Figure 2.E.).

Figure 2. 4HPR binds with high affinity to the cysteine-rich domain of the Wnt-transmembrane receptor Frizzled and inhibits β-catenin canonical but not the alternative YAP-TAZ “non-canonical” Wnt signaling.

Figure A. depicts the high affinity binding of 4HPR (approximately 158 fold > the endogenous ligand Wnt-PAM) and its oxidized metabolite 4-oxo-HPR at the Wnt3 Frizzled binding site. B. Treatment with 5 μM 4HPR significantly suppressed Wnt3-β-catenin signaling in the TOPFLASH LCF/TEF reporter assay in both the JSCC2 SEL and 2095sc SEL cell lines, p<0.01 and 0.05, respectively. In addition, Wnt3 stimulation significantly increased significantly TCF/LEF reporter activity in both the 2095sc SEL (p>0.001) and JSCC2 SEL (n=3 all groups, p<0.05) cultures. The 2095sc SEL cells demonstrated >2.5 fold greater Wnt3 responsiveness relative to the JSCC2 SEL cells. C. All OSCC cell lines released Wnt3 protein, albeit at modest levels. Relative to its control culture, the 2095sc SEL cell release significantly greater (p<0.05) levels of Wnt-3. OSCC Wnt3 release establishes the potential for intracrine Wnt- 3 signaling via β-catenin signaling (canonical) and YAP-TAZ (noncanonical) pathways. D. All cell lines showed constitutive YAP-TAZ signaling as demonstrated by intranuclear YAP- TAZ in sera-free medium (green fluorescence YAP-TAZ antibody 400x image scale, inset blue fluorescence DAPI nuclear stain). E. Single or combination chemopreventive treatment did not suppress levels of total YAP and TAZ proteins, nor did it reduce intranuclear YAP-TAZ localization (See Supplemental Figure 4).

CSC selection affects intermediate filament expression.

Stem cell selection affected intermediate filament expression (Figure 3.A.). While the 2095sc SEL cultures demonstrated enhanced cytokeratin, the JSCC2 SEL cells showed cytokeratin reduction with a concurrent increase in vimentin (Figure 3.A.).

Figure 3. Cancer stem cell enrichment modified intermediate filament expression and highlighted cell line proliferation differences.

A. While parent OSCC cell lines co-expressed pancytokeratin and vimentin, stem cell enrichment affected intermediate filament expression in the two cell lines differently. While the 2095sc SEL cells showed increased pancytokeratin (MNF-116) and diminished vimentin, the JSCC2 SEL cells assumed a more mesenchymal phenotype characterized by negligible cytokeratin and higher vimentin expression (400x image scale for all photomicrographs). B. Cell proliferation (n=4 for all groups) mirrored these changes, as the epithelial-augmented phenotype of 2095sc SEL cells demonstrated increased proliferation relative to its parent control line whereas the more mesenchymal JSCC2 SEL cells showed reduced proliferation relative to their respective control cell lines. Furthermore, the effects of treatment on cell growth was contingent upon the agent and/or agent combinations and cell line. While single treatment tocilizumab enhanced cell proliferation, the 4HPR + tocilizumab combination uniformly provided growth suppression. Triple treatment of 4HPR, tocilizumab and reparixin (5 μM, 1μg/ml, 10 μM, respectively) also provided uniform growth suppression through 72 h (2095sc. 2095sc SEL, and JSCC2) and through 48h (JSCC2 SEL). By 72h the JSCC2 SEL cell number had returned to control levels. Significant suppression of proliferation [(fenretinide p<0.01), (fenretinide + tocilizumab p<0.01), (fenretinide + reparixin p<0.05), (fenretinide + tocilizumab + reparixin p<0.01)] was only detected in 2095sc SEL line at the 72h timepoint (Figure 3.B.). Cell viability remained ≥96% in all cultures, all treatments.

CSC selection modulates cell growth rate and responsiveness to chemopreventive growth suppression.

Proliferation studies revealed appreciable differences among the cell lines, with the growth rate of the 2095sc cells appreciably higher than the JSCC2 cells (Figure 3.B.). Furthermore, while stem cell enrichment increased proliferation rate in the 2095sc SEL cells, the JSCC2 SEL cells demonstrated a reduced proliferation rate relative to their parent cell line. Fenretinide was the single most effective proliferation-reducing agent across all cell lines (Figure 3.B.). While single agent tocilizumab showed no effect or a slight growth enhancement, fenretinide+tocilizumab and fenretinide+tocilizumab+reparixin combinations were highly effective in growth reduction. During all treatments, cell viabilities remained comparable to control cultures ≥96% (See Supplemental Table II).

Combination chemopreventive treatment significantly suppresses inflammatory cytokine release.

While all cell lines released IL-6 and IL-8, parent cell line and CSCE differences were apparent (Figure 4. A.). Triple chemopreventive agent treatment significantly suppressed IL-6 and IL-8 release in all lines (Figure 4.A.) and also significantly reduced expression of stem cell genes in the CSCE cultures (Figure 4. B.).

Figure 4. Chemopreventive treatment suppresses release of the protumorigenic cytokines IL-6 and IL-8 and reduces stem cell gene expression.

A. Il-6 facilitates OSCC cell growth and tumor associated angiogenesis while IL-8, the ultimate neutrophil chemoattractant and activator, also facilitates angiogenesis, migration and invasion. While the 2095sc cell lines released appreciably high levels of IL-6, the JSCC2 cells showed increased IL-8 release. Although stem cell enrichment increased 2095sc IL-6 production (over 10 fold higher than JSCC2 SEL), stem cell enrichment reduced JSCC2 SEL IL-8 release. While lower, JSCC2 SEL IL-8 levels remained approximately 2 fold higher than 2095sc SEL cell levels. Triple treatment with fenretinide (4H), tocilizumab (T) and reparixin (R) significantly suppressed IL-6 and IL-8 release in all control parent and SEL lines evaluated (n=6 for every group, *=p<0.05, comparisons are control relative to control + treatment, SEL relative to SEL + treatment). B. Combination treatment with fenretinide (4H), tocilizumab (T) and reparixin (R) (treatment levels of 5 μM, 1 μg/ml, 10 μM, respectively) significantly reduced expression (p<0.05, n=3) for these stem cell associated genes in both SEL cell lines: ALDH, ABCG2, SOX2, CD24. Single 5 μM 4HPR treatment also significantly (p<0.05) reduced levels of ALDH (both SEL lines) and CD24 (2095sc SEL line).

ZEB and YAP are both essential for OSCC directed migration.

Results of the siRNA ZEB and YAP studies revealed that ZEB and YAP are both necessary for directed migration in OSCC cell lines (See Figure 5.A., p<0.01 for both ZEB and YAP siRNA, n=5) (Figure 4.A.). The nontumorigenic immortalized oral keratinocytes transduced with HPV16 E6 and E7 proteins (Epi) only showed significant wound healing inhibition following siRNA treatment for YAP (p<0.01, n=5). Combination ZEB and YAP siRNA treatment significantly inhibited all cell lines’ wound healing (Figure 5.A.). Although siRNA treatment reduced cell numbers relative to control cultures, viability (trypan blue exclusion) remained >95% in all groups.

Figure 5. ZEB1 and YAP are integral for directed migration in OSCC cells lines and the selected chemopreventives reduce levels of these key EMT-enabling proteins in the 2095sc SEL line.

A. Although siRNA appreciably reduced cell levels of YAP1and ZEB1 (see Supplemental Figure 5), siRNA reduction of YAP1 and a combination of siRA reduction of YAP1-ZEB1 significantly inhibited directed cell migration in all three highly mobile cell lines (n=5 every group, *=p<0.05, **=p<0.01). B. Individual and combined chemopreventive treatments with fenretinide, (4H, 5 μM) tocilibumab (T, 1 μg/ml) and reparixin (R, 10 μM) modestly reduced levels of ZEB1 and increased levels of the inactive p-YAP in the 2095sc SEL cells. Protein levels of the JSCC2 SEL line was relatively refractory to treatment.

Chemopreventive treatments reduced levels of ZEB and YAP proteins in the 2095sc SEL cells. Selective treatments also increased levels of the inactive phosphorylated-YAP in the 2095sc SEL cells (Figure 5.B.).

Despite inter-cell line variations, the selected chemopreventives significantly suppressed invasion.

Inter-cell line and CSCE differences were observed with regard to cell invasiveness (Figure 6.). While the JSCC2 SEL cells demonstrated enhanced invasion relative to the JSCC2 parental cells, the converse i.e. enhanced invasion by the parental cell line occurred in the 2095sc cells. Only the SEL cell lines showed significant invasion inhibition by single or dual treatments (fenretinide, fenretinide + tocilizumab, fenretinide+ reparixin). Triple treatment with fenretinide, tocilizumab and reparixin, significantly inhibited invasion across all cell lines including the CSCE cultures (Figure 6).

Figure 6. Combined treatment with 4HPR (4H), tocilizumab (T) and reparixin (R) significantly inhibits invasion of a synthetic basement membrane in all parent (control) and SEL cell lines.

Fifty thousand 24-hour sera deprived cells/well were plated on type IV collagen-coated microporous polyester membrane (InnoCyte cell invasion kit, Calbiochem, San Diego, CA) with the following treatments: (5 μM 4-HPR (2095sc log and SEL cells), 10 μM 4-HPR (JSCC2 log and SEL cells), 2) 1 μg/ml tocilizumab, 3) 10 μM reparixin, 4) 4HPR+ tocilizumab, 5) 4HPR+ reparixin, 6) tocilzumab + reparixin, 7) 4HPR+tocilizumab+ reparixin, 8) DMSO control. JSCC3 conditioned medium was used as the chemoattractant [16]. Previous studies confirmed cell viabilities remained >96% with comparable cell numbers after all treatments in all cell lines at 24h (See Supplemental Table II). After 18 hours of invasion (37°C, 5% CO₂), cells were formalin fixed and stained with 0.1% v/v crystal violet solution. Images were captured by Nikon DS-Ri1 using NIS Elements (Nikon, Melville, NY), followed by target pixelation analyses by image segmentation [ImagePro software (Media Cybernetics, Inc., Rockville, MD)]. Triple treatment with fenretinide (4H), tocilizumab (T) and reparixin (R) significantly inhibited invasion in all cell lines (n=3 for every group, *=p<0.05, **=p<0.01). Notably, invasion in both of the SEL cell lines was also significantly inhibited by fenretinide singularly and in combination with tocilizumab and reparixin. Other intriguing findings from this experiment were the variations in invasion capacities among the cell lines: JSCC2 SEL> JSCC2> 2095sc> 2095sc SEL. These data correspond with the enhanced mesenchymal/mobile phenotype in the JSCC2 cells following selection.

Discussion

Although targeted immune response upregulation studies e.g. T-cell immune checkpoint inhibitors are ongoing [36], their efficacy in OSCC management is not yet delineated [37]. Despite these new treatment options, prevention of OSCC recurrence via tertiary chemoprevention is the better option. In order to assess putative tertiary chemopreventives, OSCC CSC enrichment is essential. Our post-selection results showed appreciably higher levels of baseline and inducible ALDH activity, enhanced proliferation in vitro and in vivo (2095sc SEL cells), greater in vitro invasion (JSCC2 SEL cells), increased expression of Oct-4 and CD24, increased expression of the pro-inflammatory, pro-proliferative cytokines IL-6 and COX-2, and appreciably higher release of IL-6 or IL-8 protein were consistent with CSC enrichment. Our data’s standard errors indicated population heterogeneity within the SEL cultures. These findings mirror the in vivo situation where CSCs comprise a small but significant cell population of the OSCC tumor [6,7 ]. Importantly, there may be a synergistic, tumor-promoting relationship between non-CSC and CSC tumor cells [6,7]. Studies in human breast cancer cells showed IL-6 release by non-CSC cells activated an IL-6-JAK1-STAT3-Oct-4 cascade that facilitated conversion of non-CSCs to CSCs [38].

A key modulator of cancer stem cells is the Wnt-β catenin signaling pathway, which regulates CSC proliferation, survival and differentiation [39]. Wnt-Frizzled (FZD) interactions occur extracellularly at cysteine rich domains (CRDs) dominated by hydrophobic interactions [39], which represents an optimal environment for the very lipophilic fenretinide. Our modeling data show fenretinide binds with ~158 fold higher affinity relative to Wnt at the FZD8 CRD binding site. Furthermore, as the Wnt binding CRDs are highly conserved [39], fenretinide likely interferes with Wnt interactions with other FZD family members. Our data also confirm a downstream effect as fenretinide significantly inhibited the cannonical β-catenin signaling in CSCE cell lines. Wnt also signals through an alternative YAP-TAZ mediated pathway [40] All OSCC lines demonstrated nuclear YAP-TAZ in sera-free medium, consistent with constitutive activation of the FZD/ROR - Gα12/13 - Rho GTPases -Lats1/2 alternate Wnt signaling pathway [40]. As all OSCC cell lines released Wnt3a, an intracrine loop may be at least partially

attributable for the constitutive intranuclear YAP-TAZ. While the selected chemopreventives did not suppress nuclear translocation or total YAP-TAZ protein levels, they did mitigate a downstream event of the alternate Wnt pathway i.e. invasion [41]. Fenretinide’s capacity to suppress Wnt-β catenin signaling combined with its ability to bind with higher affinity than the corresponding natural ligands at tyrosine kinases associated with stemness and are often deregulated during carcinogenesis e.g. STAT3, FAK, c-Myc, c-Abl [12, 15, 42] substantiates an integral tertiary chemopreventive role for fenretinide.

Cancer cell stemness, EMT entrance, and tumorigenecity are interrelated [6–8]. Subsequently, OSCC CSCs possess the inherent plasticity to transition between preferentially migratory or proliferative phenotypes that fulfill cooperative roles [7]. While “mesenchymal/migratory” cells establish new foci, the “epithelial/proliferative” cells populate the tumor [43]. The two CSCE cultures isolated in this study were at divergent ends of the EMT spectrum. The 2095sc SEL population, which expressed more cytokeratin, high proliferation indices, elevated IL-6 release with low vimentin and modest mobility, was more epithelial-like. In contrast, the JSCC2 SEL cells possessed increased vimentin, reduced cytokeratin, showed excellent invasion, produced high levels of IL-8, had lower IL-6 release and proliferation indices and were more mesenchymal-like. Notably, the three selected agents collectively suppressed protumorigenic properties in both of these diverse CSCE populations. Furthermore, due to their membrane-associated receptor blocking mechanism of action, tocilizumab and reparixin will likely demonstrate enhanced efficacy in vivo.

Despite the cell line differences in proliferation, the chemopreventives showed similar growth-suppressive responses. Fenretinide routinely suppressed cell proliferation across all cell lines. These data correspond to fenretinide’s inhibition of growth-promoting tyrosine kinases FAK, STAT3, c-Src, and its ability to induce apoptosis and differentiation [12, 15, 16]. Single agent tocilizumab did not impact cell growth. These data are not particularly worrisome as tocilizumab demonstrated excellent in vivo chemopreventive efficacy [12], and our strategy that is to employ multiple agents in patients. Importantly, agent combinations did not antagonize fenretinide’s growth suppressive effects.

Elevated IL-6 and IL-8 levels within the tumor microenvironment support proliferation, inflammation and angiogenesis [20, 21, 38, 44], and at the systemic level correlate with a less favorable prognosis in persons with OSCC [18, 23]. IL-6 facilitates OSCC tumorigenesis by EMT induction and promotes metastases via activation via the JAK-STAT3-SNAIL signaling cascade [45]. Our data confirm OSCC cells release appreciable levels of both IL-6 and IL-8. Blockade of the cognate receptors (IL-6R, sIL-6R via tocilizumab, CXCR1/CXCR2 via reparixin respectively) in vivo could therefore suppress both intracrine and paracrine loops in tumor cells and the tumorigenic stroma. Combined treatment with fenretinide, reparixin and tocilizumab significantly suppressed IL-6 and IL-8 release in all cell lines, findings that suggest a comparable reduction of angiogenesis, inflammation and proliferation in vivo.

Combination treatment with fenretinide, tocilizumab and reparixin also significantly reduced expression of key stem cell enabling genes i.e. ALDH, ABCG2, SOX2, CD24. These genes are associated with xenobiotic/drug detoxification (ALDH, ABCG2, SOX2), proliferation and survival (ALDH, SOX2) and invasiveness (SOX2, CD24) that are all essential to sustain the cancer stem cell phenotype. These results likely reflect reduced IL-6 (NF-IL6, STAT3-tocilizumab) and IL-8 (NF-KB-reparixin) mediated transcription factor activation in combination with fenretinide’s interference via active site binding with signaling kinases e.g. STAT3, c-Src [12, 15, 21, 24, 45]. Similarly, chemopreventive studies by Castro et al. demonstrated that sulforaphane suppressed expression of stem cell specific genes in triple negative breast cancer cells [46], The authors speculated sulforaphane inhibited CR1 complex formation with ALK4 and GRP78 [46].

Provided the key roles of YAP and ZEB in promoting stemness, suppression of E-cadherin and enhanced mobility [47], the migration inhibitory effects of siRNA on these proteins were not surprising. The chemopreventives, however, only modestly reduced ZEB, YAP and slightly increased inactive phosphorylated YAP in the 2095sc SEL cells. While the observed migration inhibitory effects that we have previously reported [15] don’t reflect reduction in ZEB/YAP protein, other mechanisms including fenretinide cytoskeletal disruptions [15] or inhibition of downstream ZEB/YAP interactions are likely attributable for our previously observed fenretinide-mediated migration inhibitory effects [15].

Basement membrane invasion is the ultimate step in malignant transformation of dysplastic surface epithelium [48]. Because invasion requires coordination of intricate processes that include cell mobility (myofilaments, actin cytoskeleton), cell-ECM interactions [12, 15], and invadopodia formation (actin core, proteases, regulatory components), there are multiple potential sites for chemopreventive intervention [48]. Our lab and numerous others have previously reported inhibition of cancer cell invasion by chemopreventives [15, 49–51]. While triple treatment provided the most extensive invasion suppression across all lines, our data show that fenretinide provided a large anti-invasion impact. Probable underlying mechanisms for these invasion-suppression data include: 1) fenretinide’s destabilization of actin filaments [16], 2) fenretinide’s perturbation of CSCE-ECM interactions via active site obstruction of STAT3, FAK and Src [12, 15] 3) tocilizumab’s suppression of IL-6 mediated STAT3 activation [44], and 4) reparixin’s inhibition of IL-8 initiated invasion [26].

These studies used micromolar chemopreventive levels, which would not be achievable at the target site by systemic drug administration e.g. high fenretinide systemic pill dosing was ineffective in OSCC secondary chemoprevention [52]. The pharmacologic advantage conveyed by local drug delivery, however, can provide therapeutically relevant micromolar target-tissue drug levels [53] without drug-related adverse systemic effects [54]. Another essential treatment consideration is the tumor-promoting effects e.g. growth and angiogenic factor release, immune suppression of the microenvironment [55]. Importantly, locally delivered fenretinide, tocilizumab and reparixin would also diminish stromal effects. Collectively, these data combined with the prospect of controlled release local delivery formulations, introduce a plausible OSCC tertiary chemoprevention strategy.