Abstract
Food intake patterns are regulated by signals from the gustatory neural circuit, a complex neural network that begins at the tongue and continues to homeostatic and hedonic brain regions involved in eating behavior. The goal of the current study was to investigate the short-term effects of continuous access to a high fat diet (HFD) versus limited access to dietary fat on the gustatory neural circuit. Male Sprague-Dawley rats were fed a chow diet, a HFD (55% kcal from fat), or provided limited, daily (2h/day) or limited, intermittent (2h/day, 3 times/week) access to vegetable shortening for 2 weeks. Real time PCR was used to determine mRNA expression of markers of fat sensing/signaling (e.g. CD36) on the circumvallate papillae, markers of homeostatic eating in the mediobasal hypothalamus (MBH) and markers of hedonic eating in the nucleus accumbens (NAc). Continuous HFD increased mRNA levels of lingual CD36 and serotonin signaling, altered markers of homeostatic and hedonic eating. Limited, intermittent access to dietary fat selectively altered the expression of genes associated with the regulation of dopamine signaling. Overall, these data suggest that short-term, continuous access to HFD leads to altered fat taste and decreased expression of markers of homeostatic and hedonic eating. Limited, intermittent access, or binge-like, consumption of dietary fat led to an overall increase in markers of hedonic eating, without altering expression of lingual fat sensors or homeostatic eating. These data suggest that there are differential effects of meal patterns on gustatory neurocircuitry which may regulate the overconsumption of fat and lead to obesity.
Keywords: dietary fat, CD36, meal pattern, homeostatic, hedonic, lingual fat sensing
1. Introduction:
The overconsumption of highly palatable, high fat foods has been linked to an increase in the prevalence of obesity and multiple studies propose that the timing or pattern in which these energy dense meals are consumed may contribute to weight gain and increase metabolic risks [1–3]. Eating patterns (e.g. how much, how often, macronutrient composition) are regulated by signals from the gustatory neural circuit, a complex neural network that begins at the tongue and continues to homeostatic and hedonic brain regions involved in feeding and reward. Taste is an important modulator of fat intake and fat preference and initiates a cascade of neural events that leads to changes in food intake [4–8]. Recent studies have demonstrated that expression levels of lingual fat sensors are related to obesity in clinical populations and animal models [7–12]. Therefore, patterns of fat intake may affect the expression of lingual fat sensors, which in turn, may alter downstream neural targets and play a role in the preference for and consumption of dietary fat.
CD36 is a lingual fat sensor that regulates fat intake, is expressed primarily on the circumvallate papillae (CV) of the tongue and is considered the fat taste receptor [9, 13–19]. Studies investigating the role of lingual CD36 on fat intake and preference in models that differ in their susceptibility to develop obesity suggest that lingual CD36 mRNA expression is increased by short-term fat intake in obesity-prone rats, but that taste preference thresholds for linoleic acid are not altered, suggesting desensitization of the taste signal [13, 15, 18]. In another study, chronic consumption of a high fat diet (HFD) reduced CD36 mRNA expression levels compared to chow fed rats [20]. Overall, these studies suggest that dietary fat consumption leads to a dysregulation of fat sensing from the tongue and suggests that this dysregulation may alter the gustatory neural circuitry.
Lingual fat signaling via CD36 involves the regulation of serotonin (5-HT) in taste receptor cells and activation of gustatory afferent nerves [9]. Gustatory afferent nerves project to neural regions associated with eating behaviors, which are regulated by both homeostatic and hedonic mechanisms [21–23]. Studies suggest that a binge-like pattern of eating and obesity are consequences of overconsuming high fat, highly palatable foods and are due to a shift from homeostatic eating to hedonic, reward-driven eating [24, 25]. The goal of the current study was to investigate the short-term effects of multiple fat intake patterns on the expression of lingual markers of fat sensing and neural markers of homeostatic and hedonic eating.
2. Materials & Methods:
2.1. Animals:
Male Sprague-Dawley rats (8-10 weeks old) (Harlan/Envigo, Indianapolis, IN) were housed on a 12/12 h light/dark (on at 0700) cycle with food and water available ad libitum. Rats were randomly assigned to meal pattern condition. All procedures were approved by the LSU Health Sciences Center Institutional Animal Care and Use Committees.
2.2. Diet conditions:
Animals were randomly divided into four groups. The Chow group (n=14) received ad libitum access to standard lab chow. The Continuous group (n=9) received ad libitum access to pelleted high fat diet (HFD, 56% kcal from fat, Research Diets, , New Brunswick, NJ, USA, Table 1) [26]. The Daily group (n=8) received ad libitum access to standard laboratory chow and limited daily access to vegetable shortening (Crisco, J.M. Smucker Co., Orrville, OH, USA) for 2 hours. The Intermittent group (n=8) received ad libitum access to standard laboratory chow and limited intermittent access to vegetable shortening for 2 hours, 3 days/week. Diet conditions were maintained for 2 weeks. Rats were sacrificed in the fed state prior to each group’s scheduled access to vegetable shortening (Daily, 24 hours after last access, Intermittent, 48 hours after last access). Food intake and body weight were measured throughout the study. At sacrifice, the CV was excised from the tongue by first removing and cleaning the tongue. The epithelial layer of the tongue encompassing the CV was excised using a sterile scalpel blade, as previously described [18]. The brain was harvested and tissues were stored at −80C
Table 1:
composition of High Fat Diet.
| High Fat Diet (56%) | % Wt. | g/100Kcal | %Kcal |
|---|---|---|---|
| Crisco | 26.56 | 5.56 | 50.00 |
| Corn oil | 3.19 | 0.67 | 6.00 |
| Sucrose | 0.00 | 0.00 | - |
| Starch | 23.91 | 5.00 | 20.00 |
| Vitamin-Free Casein | 28.68 | 6.00 | 24.00 |
| Vitamin mix | 1.05 | 0.22 | - |
| Mineral mix | 4.21 | 0.88 | - |
| Choline | 0.24 | 0.05 | - |
| DL-methionine | 0.14 | 0.03 | - |
| Alphacell Non-Nutritive | 11.95 | 2.50 | - |
| Total (g) | 99.91 | 20.90 | 100.00 |
2.3. RNA Isolation and quantitative real time polymerase chain reaction:
Bilateral 2mm diameter brain punches, approximately 2mm thick, were taken from the mediobasal hypothalamus (MBH: ventromedial hypothalamus, arcuate nucleus) and the nucleus accumbens (NAc). Coordinates for punches were based on the Rat Brain Atlas [27]. RNA was isolated from brain punches and CV using Tri-Reagent (Molecular Research Ctr, Cincinnati, OH USA) and RNeasy Microkit procedures (Qiagen, Valencia, CA USA), as previously described [15, 28, 29]. Reverse transcription (RT) was conducted using the High-Capacity cDNA Reverse Transcriptase Kit (Applied Biosystems, Foster City, CA, USA) and 1.5μg of RNA from each sample. For Real-time PCR, SYBR Green 2x Master Mix (Applied Biosystems) and cDNA (10ng) were added to a 96 well plate. The quantity of mRNA expression was based on a standard curve using pooled cDNA from the appropriate tissue of all experimental samples and normalized to cyclophilin levels (CFX96 Real Time System, Bio Rad). Primer sequences are shown in Table 2.
Table 2:
Primers for Real Time PCR
| Gene target | Forward | Reverse |
|---|---|---|
| Cyclophilin | CCCACCGTGTTCTTCGACAT | CTGTCTTTGGAACTTTGTCTGCAA |
| CD36 | GAGGTCCTTACACATACAGAGTTCGTT | ACAGACAGTGAAGGCTCAAAGATG |
| Serotonin 1A receptor (5HT-1A) | CCGCACGCTTCCGAATCC | TGTCCGTTCAGGCTCTTCTTG |
| Serotonin transporter (SERT) | CCACCTTCCCATACATTGT | CTGTCTCCAAGAGTTTCTGC |
| Tryptophan hydroxylase 1 (TPH1) | GCTGAACAAACTCTACCCAAC | TTCCCGATAGCCACAGTATT |
| Tryptophan hydroxylase 2 (TPH2) | GGGTTACTTTCCTCCATCGGA | AAGCAGGTTGTCTTCGGGTC |
| Neuropeptide Y (NPY) | TGAACATCTTTGTCCCCAGAGA | AATCAGTGTCTCAGGGCTGGAT |
| Agouti-related protein AgRP) | GCAGAAGGCAGAAGCTTTGGC | CCCAAGCAGGACTCGTGCAG |
| Pro-opiomelanocor tin (POMC) | TGAACATCTTTGTCCCCAGAGA | TGCAGAGGCAAACAAGATTGG |
| Mu opioid receptor (MOR) | CAACTTGTCCCACGTTGATG | TAATGGCTGTGACCATGGAA |
| Dopamine receptor 1 (D1) | AAATCCGGCGCATCTCAGC | CGCATTCGACGGGGTTCC |
| Dopamine receptor 2 (D2) | AAGCGCCGAGTTACTGTCAT | GGCAATGATACACTCATTCTGGT |
| Monoamine oxidase B (MOAB) | CAGTGGAAGCAGAGGAGAG | TGCTGCCATACCTGAGATG |
| Dopamine transporter (DAT) | TTGGGCCTCAATGACACCTTT | AGCAGAACAATGACCAGCACCA |
| Kappa opioid receptor (KOR) | TTGGCTACTGGCATCATCTG | ACACTCTTCAAGCGCAGGAT |
2.4. Statistical Analyses:
Data were analyzed by a one-way ANOVA. Bonferroni post-hoc tests were used to determine differences between the chow control group and the experimental groups and between the Continuous and Intermittent groups. A significance level of p<.05 was used for all tests.
3. Results:
Body weight was assessed weekly. Weight gain differed between groups (F=3.1, p<.05) and rats in the Intermittent group gained the least amount of weight (Figure 1A). Average daily kilocalories in the Daily and Intermittent groups were calculated from chow and vegetable shortening. Average daily food intake differed across groups (F = 13.9, p<.001; Figure 1B). Rats fed HFD or given access to vegetable shortening consumed more kilocalories than Chow controls. Assessment of patterns of consumption of vegetable shortening indicated that the Intermittent group escalated their intake of Crisco beginning on day 5, which was considered a “binge” (p<.05; Figure 1C).
Figure 1:

The short-term effect of four feeding paradigms was assessed A. Rats given limited, intermittent access to a high fat meal gained the least amount of weight. B. Average daily kilocalorie intake was higher in all groups receiving high levels of dietary fat, compared to chow fed rats. C. Escalation of vegetable shortening intake in rats given limited, intermittent access suggested binge-eating. Data is shown as mean ± SEM, *p<.05 vs. chow fed.
Markers of fat sensing and taste signaling on Type II and Type III receptor cells in the CV were assessed for each feeding paradigm (Figure 2A). Gene expression of the fat sensor, CD36, differed across feeding paradigms (F = 12.6, p<.0001) and consumption of dietary fat in the Continuous and Daily groups increased CD36 mRNA expression. 5-HT-1A mRNA levels did not differ across groups (p=.14). Expression levels of serotonin transporter mRNA (SERT, F = 17.1, p<.001), tryptophan hydroxylase 1 mRNA (TPH1, F = 4.3, p<.05) and tryptophan hydroxylase 2 mRNA (TPH2, F = 10.7, p<.0001), differed across groups and were elevated in the Continuous HFD group. Expression levels of CD36, SERT and TPH2 mRNA were higher in the Continuous group compared to the Intermittent group.
Figure 2:

Markers of fat sensing, homeostatic eating and hedonic eating were assessed. A. In the circumvallate papillae, continuous access to HFD increased expression of CD36, SERT, TPH1, and TPH2 mRNA. B. In the mediobasal hypothalamus (MBH), continuous access to HFD decreased prepro-NPY mRNA and increased MOR mRNA expression. C. In the nucleus accumbens (NAc), limited, intermittent access to vegetable shortening increased D1R, D2R, MAOB mRNA levels and decreased DAT and KOR mRNA. Data is shown as mean ± SEM, *p<.05 vs. chow fed, +p<.05, Continuous vs. Intermittent.
Markers of homeostatic eating were measured in the MBH. Hypothalamic expression levels of prepro-neuropeptide Y (NPY) mRNA (F = 2.9, p<.05) and mu opioid receptor (MOR) mRNA (F = 9.2, p<.001) were significantly altered by food intake pattern (Figure 2B). Continuous consumption of HFD reduced hypothalamic prepro-NPY mRNA expression compared to chow fed controls and increased MOR mRNA expression compared to Chow and Intermittent groups. Expression levels of agouti-related peptide (AgRP, p=.11) and pro-opiomelanocortin (POMC) mRNA (p=.82) were not altered. Markers of hedonic eating were measured in the NAc. Feeding pattern significantly altered dopamine regulators, dopamine receptor 1 (D1R; F = 6.2, p<.01), dopamine receptor 2 (D2R; F = 6.5, p<. 1), dopamine transporter (DAT; F = 10.3, p<.001), monoamine oxidase B (MAOB; F = 6.0, p<.01) and kappa opioid receptor, (KOR; F = 8.6, p<.001) mRNA expression (Figure 2C). Expression of DAT mRNA levels were higher in continuous HFD fed rats compared to chow fed and intermittent fed rats. MAOB mRNA levels were higher in the Continuous group, compared to chow controls. Expression of D1R and D2R mRNA were higher in the Intermittent group compared to the Chow and Continuous groups and MAOB expression was higher in the Intermittent group compared to the chow fed controls. KOR mRNA levels were decreased in the Intermittent group, compared to the chow and continuous fed rats. MOR mRNA expression in the NAc was not significantly different across feeding paradigms (p=.22).
4. Discussion:
The overconsumption of palatable high fat foods has been linked to an increase in the prevalence of obesity. Studies suggest that the meal timing or the pattern in which energy dense meals are consumed may contribute to weight gain and metabolic risks [1–3]. Food intake patterns (e.g. how much, how often, macronutrient composition) are regulated by signals from the gustatory neural circuit, a complex neural network that begins at the tongue and continues to homeostatic and hedonic brain regions involved in feeding and reward. Studies suggest that binge eating and obesity are consequences of overconsuming high fat, highly palatable foods and are due to a shift from homeostatic to hedonic, reward-driven eating [24, 25]. The goal of the current study was to investigate the short-term effects of fat intake patterns on the expression of lingual markers of fat sensing and neural markers of homeostatic and hedonic eating.
In the current study, the short duration of the four feeding paradigms allowed for changes in gene expression without significant increases in body weight in the Continuous group and was based on previous research from our laboratory investigating the time course of HFD-induced changes in lingual CD36 mRNA expression [18]. As expected, short-term increases in the consumption of dietary fat did not induce excessive weight gain in the current study. Similar to previous reports, rats given intermittent access to vegetable shortening gained the least amount of weight [30] which may be due, in part, to the timing of the end of the study compared to the last high fat meal. Average kilocalorie intake was higher in all high fat fed groups. Approximately half of the average daily intake of rats in the Intermittent group was derived from vegetable shortening. This data, in combination with intake from each high fat meal (Figure 1C), supports an escalation of fat intake in the Intermittent group, mimicking a binge-eating paradigm {Avena, 2009; Corwin, 2011; Corwin, 2006}.
Taste signaling is a complex process which involves multiple taste receptor cells, activation of afferent nerves and neural signaling between multiple brain regions. To investigate the effects of food intake patterns on gustatory signaling, markers of fat sensing/signaling were assessed in the CV. Besnard and colleagues [9] propose a working model for fat signaling in taste bud cells. Dietary fat is detected by the proposed fat taste receptor, CD36, on Type II taste receptor cells, which initiates a cascade of intracellular events culminating in the release of 5-HT from Type III taste receptor cells and activation of the gustatory afferent nerve. Serotonin released from Type III cells also bind to 5-HT-1A receptors on Type II taste receptor cells, which inhibit Type II cells. This coordination of receptors and neurotransmitters is proposed to prevent overstimulation of taste receptor cells and desensitization of the taste signal [9, 31–33]. Obesity is associated with a decreased sensitivity to fatty foods, therefore, altered signaling between taste receptor cells and afferent nerves may mediate this response. In the current study, the short-term effects of feeding patterns on mRNA expression of CD36, 5-HT-1A, SERT, and the 5-HT precursors, TPH1 and TPH2, were assessed in the CV. Continuous HFD intake increased expression of CD36, SERT, TPH1 and TPH2. These data indicate a significant role for the pattern of fat consumption and the importance of frequency of fat intake (i.e. time since last high fat meal) on lingual expression of fat sensing regulators. Additionally, these data suggest that continuous consumption of HFD may disrupt the coordination between Type II and Type III taste receptors cells and interfere with the ability of the taste receptor cells to inhibit overstimulation and desensitization of the taste signal. Our previous study in obesity-prone rats reported that continuous consumption of HFD increased lingual CD36 expression and failed to decrease the preference threshold for linoleic acid, supporting the idea of dysregulation of the taste signal [15]. More studies are needed to determine functional changes in fat taste sensitivity following short-term HFD intake and in the absence of obesity.
The hypothalamus is a key region for the regulation of homeostatic eating [24, 34] and together with the cortico-limbic system and the hindbrain act, as the core processor in the control of appetite [25, 35]. Under normal conditions, a dynamic equilibrium exists between orexigenic peptides that stimulate feeding behavior (e.g. NPY, AgRP), and anorexigenic peptides that suppress food intake (e.g. POMC) [34, 36–39]. In the current study, Continuous HFD down-regulated the expression of the orexigenic hypothalamic neuropeptide, NPY, in the MBH (Figure 2B). These data support previous findings that chronic HFD consumption decreases prepro-NPY, AgRP and POMC gene expression in the arcuate nucleus [40]. Furthermore, Continuous HFD consumption increased MOR mRNA expression in the MBH supporting previous studies [41,42]. Altered expression of NPY and MOR in the MBH following Continuous HFD is a mechanism by which the brain modulates continuous exposure to dietary fat since short-term Daily or Intermittent access to dietary fat was not sufficient to alter expression of these markers. Our data suggest that amount and frequency of fat intake plays an important role on the activation of homeostatic brain regions.
To investigate altered markers of hedonic eating, the expression of genes involved in dopamine regulation within the NAc were assessed [43–46]. In the NAc, postsynaptic D1R detect the release of dopamine, while D2R are located pre-and post-synaptically and regulate the firing pattern of dopamine neurons and control the timing and amount of dopamine released [45, 47–49]. Activation of MOR leads to increased release of dopamine and activation of KOR inhibits dopamine release [50–52]. MAOB and DAT are involved in the termination of dopaminergic neurotransmission [53]. Previous studies indicate that long-term access to HFD decreases D1R and increases D2R mRNA expression [54, 55], while chronic, intermittent access to vegetable shortening, which elicits binge-like eating, decreases D2R mRNA expression. In the current study, short-term Continuous HFD increased DAT and MAOB mRNA expression, suggesting an increase in negative regulators of dopamine (Figure 2C). Daily access to a high fat meal decreased DAT and KOR mRNA levels suggesting decreased inhibition of dopamine signaling. Limited, intermittent access to a high fat meal altered the majority of markers of dopamine signaling measured and led to an overexpression of D1R, D2R, and MAOB mRNA and a decrease in KOR mRNA levels. Though MOR mRNA levels did not statistically differ across feeding patterns, MOR mRNA levels were almost 2-fold higher in the Intermittent group compared to Chow fed controls, suggesting that intermittent consumption of dietary fat activates the hedonic brain. These data suggest that feeding pattern has a significant effect on markers of hedonic eating and a pattern of eating escalates high fat intake, alters multiple hedonic markers involved in the coordination of eating for pleasure.
The goal of the current study was to examine the role of fat intake patterns on markers of fat sensing and homeostatic and hedonic eating. Studies suggest that binge eating and obesity are consequences of overconsuming high fat, highly palatable foods and are due to a shift from homeostatic to hedonic, reward-driven eating. Few studies have investigated the effects of lingual CD36 on fat sensing, however, numerous studies have demonstrated the important role of gastrointestinal tract fat sensing, via CD36 and other peripheral signals, on the consumption of dietary fat and the subsequent suppression of further intake [18, 56–60]. Though peripheral fat sensing and satiety mechanisms were not investigated in the current study, their potential impact on the overconsumption of palatable foods and their effects on hedonic and homeostatic circuitry should be explored further. Data from the current study suggest differential regulation of gustatory neural circuitry across feeding patterns. Unlike patterns which limit access to dietary fat, continuous consumption of high levels of dietary fat alters the expression of markers of lingual fat sensing and homeostatic eating in the MBH, suggesting a disruption of fat sensing, which may lead to obesity following chronic intake. Limited, intermittent access to dietary fat mimics a binge-eating paradigm and leads to the escalation of fat intake. It is hypothesized that intermittently restricting access to highly palatable foods results in increased stimulation of the reward system when high fat foods are ingested, which drives overeating and susceptibility to developing obesity [61–63]. This feeding paradigm did not alter markers of lingual fat sensing or homeostatic eating, but had a significant impact on markers of hedonic eating, supporting the idea that intermittently providing access to high fat foods activates reward systems, without leading to desensitization of lingual fat sensing, which may heighten the rewarding response. Interestingly, limited, daily access to a high fat meal appears to have the least impact on markers of lingual fat sensing, homeostatic and hedonic eating. Taken together these data suggest that fat intake patterns have the potential to have a profound effect on the development of obesity by differentially altering gustatory neurocircuitry. Furthermore, strategies that control food intake patterns may be beneficial for weight loss and the prevention of obesity by regulating the relationship between markers of lingual fat sensing and hedonic eating.
Highlights.
Short-term, continuous or limited access to dietary fat increase average daily kilocaloric intake, without significantly increasing body weight.
Short-term, continuous access to HFD and limited, daily access to dietary fat increase lingual expression of the CD36, the proposed fat taste receptor.
Continuous, but not daily or intermittent access to a high fat meal alters markers of homeostatic eating in the mediobasal hypothalamus.
Limited, intermittent access to dietary fat selectively altered the expression of markers of hedonic eating.
Differential effects of meal patterns on gustatory neurocircuitry may regulate the overconsumption of fat and lead to obesity.
Acknowledgements:
This research was supported by LSU Health Sciences Center to SDP. This work was partially supported by the Pennington/Louisiana NORC Center Grant P30DK072476 and the COBRE center grant P30GM118430 from the National Institutes of Health.
Footnotes
Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
References:
- [1].Aparicio A, Rodriguez-Rodriguez EE, Aranceta-Bartrina J, Gil Á, González-Gross M, Serra-Majem L, et al. Differences in meal patterns and timing with regard to central obesity in the ANIBES (‘Anthropometric data, macronutrients and micronutrients intake, practice of physical activity, socioeconomic data and lifestyles in Spain’) Study. Public Health Nutr. 2017,20:2364–73. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [2].Paoli A, Tinsley G, Bianco A, Moro T The Influence of Meal Frequency and Timing on Health in Humans: The Role of Fasting. Nutrients. 2019,11. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [3].Templeman I, Gonzalez JT, Thompson D, Betts JA The role of intermittent fasting and meal timing in weight management and metabolic health. Proc Nutr Soc. 2019:1–12. [DOI] [PubMed] [Google Scholar]
- [4].Cecil J, Dalton M, Finlayson G, Blundell J, Hetherington M, Palmer C Obesity and eating behaviour in children and adolescents: contribution of common gene polymorphisms. Int Rev Psychiatry. 2012,24:200–10. [DOI] [PubMed] [Google Scholar]
- [5].Gaillard D, Passilly-Degrace P, Besnard P Molecular mechanisms of fat preference and overeating. Ann N Y Acad Sci. 2008,1141:163–75. [DOI] [PubMed] [Google Scholar]
- [6].Gilbertson TA, Khan NA Cell signaling mechanisms of oro-gustatory detection of dietary fat: advances and challenges. Prog Lipid Res. 2014,53:82–92. [DOI] [PubMed] [Google Scholar]
- [7].Mattes RD Fat taste and lipid metabolism in humans. Physiol Behav. 2005,86:691–7. [DOI] [PubMed] [Google Scholar]
- [8].Ulven T, Christiansen E Dietary Fatty Acids and Their Potential for Controlling Metabolic Diseases Through Activation of FFA4/GPR120. Annu Rev Nutr. 2015,35:239–63. [DOI] [PubMed] [Google Scholar]
- [9].Besnard P, Passilly-Degrace P, Khan NA Taste of Fat: A Sixth Taste Modality? Physiol Rev. 2016,96:151–76. [DOI] [PubMed] [Google Scholar]
- [10].Pepino MY, Love-Gregory L, Klein S, Abumrad NA The fatty acid translocase gene CD36 and lingual lipase influence oral sensitivity to fat in obese subjects. J Lipid Res. 2012,53:561–6. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [11].Primeaux SD, Braymer HD, Bray GA CD36 mRNA in the gastrointestinal tract is differentially regulated by dietary fat intake in obesity-prone and obesity-resistant rats. Dig Dis Sci. 2013,58:363–70. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [12].Sundaresan S, Abumrad NA Dietary Lipids Inform the Gut and Brain about Meal Arrival via CD36-Mediated Signal Transduction. J Nutr. 2015,145:2195–200. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [13].Chen CS, Bench EM, Allerton TD, Schreiber AL, Arceneaux KP, Primeaux SD Preference for linoleic acid in obesity-prone and obesity-resistant rats is attenuated by the reduction of CD36 on the tongue. Am J Physiol Regul Integr Comp Physiol. 2013,305:R1346–55. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [14].Degrace-Passilly P, Besnard P CD36 and taste of fat. Curr.Opin.Clin Nutr.Metab Care 2012,15:107–11. [DOI] [PubMed] [Google Scholar]
- [15].Douglas Braymer H, Zachary H, Schreiber AL, Primeaux SD Lingual CD36 and nutritional status differentially regulate fat preference in obesity-prone and obesity-resistant rats. Physiol Behav. 2017,174:120–7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [16].Gaillard D, Laugerette F, Darcel N, El-Yassimi A, Passilly-Degrace P, Hichami A, et al. The gustatory pathway is involved in CD36-mediated orosensory perception of long-chain fatty acids in the mouse. FASEB J. 2008,22:1458–68. [DOI] [PubMed] [Google Scholar]
- [17].Laugerette F, Passilly-Degrace P, Patris B, Niot I, Febbraio M, Montmayeur JP, et al. CD36 involvement in orosensory detection of dietary lipids, spontaneous fat preference, and digestive secretions. J Clin Invest. 2005,115:3177–84. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [18].Primeaux SD, Braymer HD, Bray GA CD36 mRNA in the gastrointestinal tract is differentially regulated by dietary fat intake in obesity-prone and obesity-resistant rats. Dig Dis Sci. 2013,58:369–70. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [19].Sclafani A, Ackroff K, Abumrad NA CD36 gene deletion reduces fat preference and intake but not post-oral fat conditioning in mice. Am J Physiol Regulatory Integrative Comp Physiol. 2007,293:R1823–R32. [DOI] [PubMed] [Google Scholar]
- [20].Zhang XJ, Zhou LH, Ban X, Liu DX, Jiang W, Liu XM Decreased expression of CD36 in circumvallate taste buds of high-fat diet induced obese rats. Acta Histochem. 2011,113:663–7. [DOI] [PubMed] [Google Scholar]
- [21].Kaye WH, Fudge JL, Paulus M New insights into symptoms and neurocircuit function of anorexia nervosa. Nat Rev Neurosci. 2009,10:573–84. [DOI] [PubMed] [Google Scholar]
- [22].Rolls ET Brain mechanisms underlying flavour and appetite. Philos Trans R Soc Lond B Biol Sci. 2006,361:1123–36. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [23].Yarmolinsky DA, Zuker CS, Ryba NJ Common sense about taste: from mammals to insects. Cell. 2009,139:234–44. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [24].Berthoud HR Metabolic and hedonic drives in the neural control of appetite: who is the boss? Curr Opin Neurobiol. 2011,21:888–96. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [25].Berthoud HR, Münzberg H, Morrison CD Blaming the Brain for Obesity: Integration of Hedonic and Homeostatic Mechanisms. Gastroenterology. 2017,152:1728–38. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [26].Lin L, Chen J, York DA Chronic ICV enterostatin preferentially reduced fat intake and lowered body weight. Peptides. 1997,18:657–61. [DOI] [PubMed] [Google Scholar]
- [27].Paxinos G, Watson CR, Emson PC AChE-stained horizontal sections of the rat brain in stereotaxic coordinates. J Neurosci Methods. 1980,3:129–49. [DOI] [PubMed] [Google Scholar]
- [28].Primeaux SD QRFP in female rats: effects on high fat food intake and hypothalamic gene expression across the estrous cycle. 2011. p. 1270–5. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [29].Schreiber AL, Arceneaux KP, Malbrue RA, Mouton AJ, Chen CS, Bench EM, et al. The effects of high fat diet and estradiol on hypothalamic prepro-QRFP mRNA expression in female rats. Neuropeptides. 2016. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [30].Avena NM Binge eating: neurochemical insights from animal models. Eat Disord. 2009,17:89–92. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [31].Jaber L, Zhao FL, Kolli T, Herness S A physiologic role for serotonergic transmission in adult rat taste buds. PLoS One. 2014,9:e112152. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [32].Kaya N, Shen T, Lu S, Zhao F, Herness S A paracrine signaling role for serotonin in rat taste buds: expression and localization of serotonin receptor subtypes. Am J Physiol Regulatory Integrative Comp Physiol. 2004,286:R649–R58. [DOI] [PubMed] [Google Scholar]
- [33].Larson ED, Vandenbeuch A, Voigt A, Meyerhof W, Kinnamon SC, Finger TE The Role of 5-HT3 Receptors in Signaling from Taste Buds to Nerves. J Neurosci. 2015,35:15984–95. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [34].Leibowitz SF, Wortley KE Hypothalamic control of engery balance: different peptides, different functions. Peptides. 2004,25:473–504. [DOI] [PubMed] [Google Scholar]
- [35].Kelley AE, Schiltz CA, Landry CL Neural systems recruited by drug- and food-related cues: studies of gene activation in corticolimbic regions. Physiol Behav. 2005,86:11–4. [DOI] [PubMed] [Google Scholar]
- [36].Baskin DG, Hahn TM, Schwartz MW Leptin sensitive neurons in the hypothalamus. Horm Metab Res. 1999,31:345–50. [DOI] [PubMed] [Google Scholar]
- [37].Broberger C, Johansen J, Johansson C, Schalling M, Hokfelt T The neuropeptide Y/agouti gene-related protein (AGRP) brain circuitry in normal, anorectic, and monosodium glutamate-treated mice. Proc.Natl.Acad.Sci.U.S.A 1998,95:15043–8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [38].Kalra SP, Kalra PS Neuropeptide Y: a physiological orexigen modulated by the feedback action of ghrelin and leptin. Endocrine. 2003,22:49–56. [DOI] [PubMed] [Google Scholar]
- [39].Schwartz MW, Woods SC, Porte JD, Seeley RJ, Baskin DG Central nervous system control of food intake. Nature. 2000,404:661–71. [DOI] [PubMed] [Google Scholar]
- [40].Barson JR, Morganstern I, Leibowitz SF Neurobiology of consummatory behavior: mechanisms underlying overeating and drug use. ILAR J. 2012,53:35–58. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [41].Barnes MJ, Holmes G, Primeaux SD, York DA, Bray GA Increased expression of mu opioid receptors in animals susceptible to diet-induced obesity. Peptides. 2006,27:3292–8. [DOI] [PubMed] [Google Scholar]
- [42].Primeaux SD, Blackmon C, Barnes MJ, Braymer HD, Bray GA Central administration of the RFamide peptides, QRFP-26 and QRFP-43, increases high fat food intake in rats. Peptides. 2008,29:1994–2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [43].Baptista T Body weight gain induced by antipsychotic drugs: mechanisms and management. Acta Psychiatr Scand. 1999,100:3–16. [DOI] [PubMed] [Google Scholar]
- [44].Erlanson-Albertsson C How palatable food disrupts appetite regulation. Basic Clin Pharmacol Toxicol. 2005,97:61–73. [DOI] [PubMed] [Google Scholar]
- [45].Noble EP D2 dopamine receptor gene in psychiatric and neurologic disorders and its phenotypes. Am J Med Genet B Neuropsychiatr Genet. 2003,116B:103–25. [DOI] [PubMed] [Google Scholar]
- [46].Szczypka MS, Rainey MA, Palmiter RD Dopamine is required for hyperphagia in Lep(ob/ob) mice. Nat Genet. 2000,25:102–4. [DOI] [PubMed] [Google Scholar]
- [47].Baldo BA, Sadeghian K, Basso AM, Kelley AE Effects of selective dopamine D1 or D2 receptor blockade within nucleus accumbens subregions on ingestive behavior and associated motor activity. Behav Brain Res. 2002,137:165–77. [DOI] [PubMed] [Google Scholar]
- [48].Chen NN, Pan WH Regulatory effects of D2 receptors in the ventral tegmental area on the mesocorticolimbic dopaminergic pathway. J Neurochem. 2000,74:2576–82. [DOI] [PubMed] [Google Scholar]
- [49].Dodd T, Simon L, LeCapitaine NJ, Zabaleta J, Mussell J, Berner P, et al. Chronic binge alcohol administration accentuates expression of pro-fibrotic and inflammatory genes in the skeletal muscle of simian immunodeficiency virus-infected macaques. Alcohol Clin Exp Res. 2014,38:2697–706. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [50].Di Chiara G, Imperato A Opposite effects of mu and kappa opiate agonists on dopamine release in the nucleus accumbens and in the dorsal caudate of freely moving rats. J Pharmacol Exp Ther. 1988,244:1067–80. [PubMed] [Google Scholar]
- [51].Kalivas PW Neurotransmitter regulation of dopamine neurons in the ventral tegmental area. Brain Res Brain Res Rev. 1993,18:75–113. [DOI] [PubMed] [Google Scholar]
- [52].Maisonneuve IM, Archer S, Glick SD U50,488, a kappa opioid receptor agonist, attenuates cocaine-induced increases in extracellular dopamine in the nucleus accumbens of rats. Neurosci Lett. 1994,181:57–60. [DOI] [PubMed] [Google Scholar]
- [53].McHugh PC, Buckley DA The structure and function of the dopamine transporter and its role in CNS diseases. Vitam Horm. 2015,98:339–69. [DOI] [PubMed] [Google Scholar]
- [54].Alsiö J, Olszewski PK, Norbäck AH, Gunnarsson ZE, Levine AS, Pickering C, et al. Dopamine D1 receptor gene expression decreases in the nucleus accumbens upon long-term exposure to palatable food and differs depending on diet-induced obesity phenotype in rats. Neuroscience. 2010,171:779–87. [DOI] [PubMed] [Google Scholar]
- [55].Sharma S, Fulton S Diet-induced obesity promotes depressive-like behaviour that is associated with neural adaptations in brain reward circuitry. Int J Obes (Lond). 2013,37:382–9. [DOI] [PubMed] [Google Scholar]
- [56].Duca FA, Katebzadeh S, Covasa M Impaired GLP-1 signaling contributes to reduced sensitivity to duodenal nutrients in obesity-prone rats during high-fat feeding. Obesity (Silver Spring). 2015,23:2260–8. [DOI] [PubMed] [Google Scholar]
- [57].Duca FA, Swartz TD, Sakar Y, Covasa M Decreased intestinal nutrient response in diet-induced obese rats: role of gut peptides and nutrient receptors. Int J Obes (Lond). 2013,37:375–81. [DOI] [PubMed] [Google Scholar]
- [58].Liou AP, Lu X, Sei Y, Zhao X, Pechhold S, Carrero RJ, et al. The G-protein-coupled receptor GPR40 directly mediates long-chain fatty acid-induced secretion of cholecystokinin. Gastroenterology. 2011,140:903–12. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [59].Primeaux SD, Barnes MJ, Braymer HD, Bray GA Sensitivity to the satiating effects of Exendin 4 is decreased in obesity-prone Osborne-Mendel rats compared to obesity-resistant S5B/Pl rats. Int.J Obes 2010,34:1427–33. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [60].Sclafani A, Zukerman S, Ackroff K GPR40 and GPR120 fatty acid sensors are critical for postoral but not oral mediation of fat preferences in the mouse. Am J Physiol Regul Integr Comp Physiol. 2013,305:R1490–7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [61].Corwin RL, Wojnicki FH Binge eating in rats with limited access to vegetable shortening. Curr Protoc Neurosci. 2006,Chapter 9:Unit9.23B. [DOI] [PubMed] [Google Scholar]
- [62].Corwin RL, Avena NM, Boggiano MM Feeding and reward: perspectives from three rat models of binge eating. Physiol Behav. 2011,104:87–97. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [63].Wojnicki FH, Johnson DS, Corwin RL Access conditions affect binge-type shortening consumption in rats. Physiol Behav. 2008,95:649–57. [DOI] [PMC free article] [PubMed] [Google Scholar]
