Skip to main content
Bioscience Reports logoLink to Bioscience Reports
. 2019 Dec 6;39(12):BSR20191773. doi: 10.1042/BSR20191773

MicroRNA-15a modulates lens epithelial cells apoptosis and proliferation through targeting B-cell lymphoma-2 and E2F transcription factor 3 in age-related cataracts

Qiao Li 1,2, HaiTao Pan 1,3, QingHuai Liu 1,✉
PMCID: PMC6900469  PMID: 31737898

Abstract

Age-related cataract remains a serious problem in the aged over the world. MicroRNAs are abnormally expressed in various diseases including age-related cataract. MicroRNA-15a (MicroRNA-15a) has been involved in various diseases and plays crucial roles in many cellular processes. However, the mechanism of microRNA-15a in the genesis of cataract remains barely known. We therefore aimed to investigate the role of microRNA-15a in the cataract. Herein, human lens epithelial B3 cells, HLE-B3 cells were treated with 200 μmol/l H2O2 for 24 h. H2O2 was utilized in our study to induce HLE-B3 cells injury. We observed that cell apoptosis was induced by the treatment of H2O2 and meanwhile, cell proliferation was repressed by 200 μmol/l H2O2. Then, it was found that microRNA-15a was significantly increased with the H2O2 exposure in vitro. Importantly, B-cell lymphoma-2 (BCL2) and E2F transcription factor 3 (E2F3) exert crucial roles in cell apoptosis and cell proliferation. We found that BCL2 and E2F3 were greatly reduced by 200 μmol/l H2O2 in human lens epithelial cells. In addition, microRNA-15a overexpression induced cell apoptosis and repressed cell proliferation through suppressing BCL2 and E2F3. Subsequently, BCL2 and E2F3 were predicted as a direct target of microRNA-15a. The direct correlation between microRNA-15a and BCL2/E2F3 was confirmed by dual luciferase reporter assay. In conclusion, we demonstrated that microRNA-15a triggered apoptosis and repressed the proliferation of HLE-B3 cells by modulating BCL2 and E2F3.

Keywords: age-related cataract, BCL2, E2F3, miR-15a

Introduction

Cataract has a high incidence all over the world and it can contribute to the blinding eye disease [1–3]. Numerous factors can lead to the development of cataract. But age and ocular tissue degeneration are the most common inducements. Age-related cataract can affect 46% of the 180 million visually disabled people [4,5]. Hence, identifying the effective biomarkers of cataract can reduce cataract incidence and blinding rates.

As well established, lens epithelial cell apoptosis is an early event in cataract progression [6]. Damages, such as oxidative stress to the epithelial cells can contribute a lot to age-related cataract [7]. Lens epithelial cell apoptosis induced by oxidative stress is a common cellular basis in cataract [8].

MicroRNAs are a small non-protein coding RNAs with 20–25 nucleotides, which can regulate gene expression post-transcriptionally [9]. MicroRNAs regulate mRNA degradation or translation through combining with their targeting mRNAs [10]. So far, microRNAs are involved in a variety of cell processes including proliferation, migration and apoptosis [11–13]. It has been reported that in many studies abnormal expression of miRNAs is closely associated with the pathogenesis of many age-related diseases, including cataract progression [14–16]. For example, miR-34a can promote mitochondrial dysfunction-triggered apoptosis in human lens epithelial cells via targeting Notch2 [17]. miR-26a and -26b inhibit lens fibrosis and cataract through regulating Jagged-1/Notch signaling pathway [18]. In addition, let-7b induces lens epithelial cell apoptosis by targeting Lgr4 [19].

In our current study, we focused on the biological role of microRNA-15a in age-related cataract. We aimed to in vestigate the biological role of microRNA-15a in age-related cataract and the mechanisms of action. Therefore, we demonstrated that microRNA-15a modulated age-related cataract progression through targeting B-cell lymphoma-2 (BCL2) and E2F transcription factor 3 (E2F3) in vitro.

Materials and methods

Cell culture

Human lens epithelial B3 (HLE-B3) cells were purchased from American Type Culture Collection (ATCC; Rockville, MD, U.S.A.). Cells were cultured in minimum essential medium (MEM; Gibco, Carlsbad, CA, U.S.A.) added with 10% fetal bovine serum (FBS; Gibco, Carlsbad, CA, U.S.A.) in a humidified chamber with 5% CO2.

Cell transfection

MicroRNA-15a mimics or their parental negative controls (RiboBio, Nanjing, China) were transfected into the cells using Lipofectamine 2000 reagent (Invitrogen, Carlsbad, CA, U.S.A.).

Cell counting kit-8 assay

Cells were seeded in a 96-well plate for a whole night. Then, 10 μl Cell Counting Kit-8 (CCK-8) reagents (Dojindo Molecular Technologies, Tokyo, Japan) were added to the cells and the cells were incubated for 4 h. A microplate reader (Bio-Tek, Winooski, VT, U.S.A.) was utilized to test the absorbance at 450 nm.

5-ethynyl-2′-deoxyuridine assay

To detect the function of microRNA-15a on cell proliferation, 5-ethynyl-2′-deoxyuridine (EdU) proliferation assay (RiboBio, Nanjing, China) was conducted. After transfection for 48 h, cells were incubated with 50 μM EdU. An Apollo and DAPI staining were employed to detect the EdU-positive cells.

Apoptosis detection

Cell apoptosis was assessed using an Annexin V-FITC/PI apoptosis detection kit. Briefly, 1  ×  104 cells were grown in six-well plates per well. Afterward, cells were digested using trypsin without EDTA, harvested and washed three times using PBS diluted in 500 μl Annexin binding buffer. For each sample, 5 μl Annexin-V-FITC and 5 μl propidium iodide were added to cell suspension and then the cells were incubated for 15 min in the dark. Cell apoptosis was evaluated by quantifying the Annexin V-FITC-positive cells. Subsequently, flow cytometry data were plotted and analyzed using the fluorescence-activated cell sorting (FACS-Vantage) system and Cell Ouest software (Becton-Dickinson, San Jose, CA, U.S.A.).

Caspase-3 activity assay

Caspase-3 activity was detected using a caspase-3 assay kit (Abcam, Cambridge, U.K.). Cells were lysed in 50 μl chilled cell lysis buffer. A total of 50 μl cell lysis buffer containing 100 μg protein was added, 50 μl of 2× reaction buffer, 0.5 μl of 10 mmol/l dl-dithiothreitol (DTT) and 5 μl caspase-3 catalytic substrate DEVD-pNA substrate were used. After incubation, the absorbance in each well was tested at 405 nm using a microplate ELISA reader.

Western blot analysis

Cell extracts were prepared using RIPA buffer containing protein inhibitor cocktail (Roche, Penzberg, Germany). Samples were separated on sodium dodecyl sulfate/polyacrylamide gel electrophoresis (SDS/PAGE) and electroblotted on to PVDF membranes. Then, the membranes were blocked using 5% skim milk in TBS-T buffer at room temperature for 1 h. The membrane was incubated with rabbit monoclonal antibody against human BCL2 and E2F3 (Abcam, Cambridge, U.K.) followed by horseradish peroxidase (HRP)-labeled goat anti-rabbit IgG (Southern Biotech, AL, U.S.A.). The protein bands were exposed with the ECL chemiluminescence kit (Pierce, Rockford, IL, U.S.A.).

Quantitative real-time PCR

The RNAiso Plus (TaKaRaBio Technology, Dalian, China) was used to extract RNA. RNA reverse transcription was carried out using Prime Script™ RT Master Mix and qPCR was performed using SYBR Premix ExTaq II (TaKaRa Bio Technology, Dalian, China). Primers for Quantitative real-time PCR (qRT-PCR) were displayed in Table 1. Applied Biosystems 7900 Real-Time PCR System (Applied Biosystems, Foster City, CA, U.S.A.) was used.

Table 1. Primers for real-time PCR.

Genes Forward (5′–3′) Reverse (5′–3′)
GAPDH AAGAAGGTGGTGAAGCAGGC GTCAAAGGTGGAGGAGTGGG
U6 CTCGCTTCGGCAGCACATA CAGTGCAGGGTCCGAGGTA
microRNA-15a CGCCTAGCAGCACATAATGG AGTGCAGGGTCCGAGGTAT
BCL2 CTGCACCTGACGCCCTTCACC CACATGACCCCACCGAACTCAAAGA
E2F3 CGGTCTGCTCACCAAGAAGT CCTCTTCTGCACCTTGAGCA

Luciferase activity assay

The wild-type (WT) or mutant (MUT) BCL2/E2F3 binding microRNA-15a was subcloned into pGL3 basic vector (Promega, Madison, WI, U.S.A.). microRNA-15a mimics (RiboBio, Guangzhou, China) were co-transfected with 10 μg pLUC-WT-BCL2/E2F3 or pLUC-MUT-BCL2/E2F3 into the cells.

Statistical analysis

Statistical data analysis was carried out using GraphPad Prism 6.0 (GraphPad Software, Inc., La Jolla, CA) statistical packages. Each experiment was performed in triplicate and data were presented as mean ± SD. Statistical analysis was performed using Student’s t test or one-way analysis of variance. Statistical significance was considered when P-value was less than 0.05.

Results

H2O2 induced apoptosis and repressed proliferation in human lens epithelial cells

First, as shown in Figure 1A,B, HLE-B3 cell apoptosis was increased by 200 μmol/l H2O2 for 24 h. In addition, we observed that HLE-B3 cell proliferation was significantly inhibited by 200 μmol/l H2O2 in vitro (Figure 1C,D). These findings indicated that H2O2 induced apoptosis and depressed proliferation in HLE-B3.

Figure 1. H2O2 induced apoptosis and inhibited proliferation in HLE-B3 cells.

Figure 1

(A,B) Flow cytometry analysis of the apoptosis induced by H2O2. Cells were treated with 200 μmol/l H2O2 for 24 h. Flow cytometry was performed to test cell apoptosis. (C,D) Analysis of the proliferation induced by H2O2. EDU assay was performed to test cell proliferation. Three independent experiments were carried out. Error bars stand for the mean ± SD of at least triplicate experiments. *P<0.05.

H2O2 up-regulated microRNA-15a and down-regulated BCL2, E2F3 in HLE-B3 cells

Then, a significant increase in microRNA-15a was observed in H2O2-treated HLE-B3 cells compared with the control group (Figure 2A). Additionally, BCL2 mRNA and protein expression was obviously decreased in HLE-B3 cells incubated with 200 μmol/l H2O2 (Figure 2B,C). In addition, E2F3 mRNA and protein expression was also greatly decreased by H2O2 in vitro (Figure 2D,E). These implied that microRNA-15a/BCL2/E2F3 was involved in cataract development.

Figure 2. Expression of microRNA-15a, BCL2 and E2F3 in HLE-B3 cells incubated with 200 μmol/l H2O2.

Figure 2

(A) MicroRNA-15a expression in HLE-B3 cells. Cells were indicated with 200 μmol/l H2O2 for 24 h. (B) BCL2 mRNA expression in HLE-B3 cells. (C) BCL2 protein expression in HLE-B3 cells. (D) E2F3 mRNA expression in HLE-B3 cells. (E) E2F3 protein expression in HLE-B3 cells. Three independent experiments were carried out. Error bars stand for the mean ± SD of at least triplicate experiments. *P<0.05.

MicroRNA-15a regulated human lens epithelial cell apoptosis and cell proliferation

Then, further investigation was conducted to explore the effect of microRNA-15a on apoptosis and proliferation. HLE-B3 cells were transfected with microRNA-15a mimics or mimic controls for 48 h. As shown in Figure 3A, microRNA-15a was significantly increased by microRNA-15a mimics in HLE-B3 cells. Subsequently, flow cytometry assay indicated that overexpression of microRNA-15a induced cell apoptosis (Figure 3B). In addition, caspase-3 activity assay showed that microRNA-15a mimic group significantly elevated caspase-3 activity (Figure 3C). Next, CCK-8 assay was carried out and it was found that cell viability was repressed by microRNA-15a mimics in Figure 3D. These further revealed that microRNA-15a regulated the proliferation and apoptosis of human lens epithelial cells.

Figure 3. MicroRNA-15a regulated human lens epithelial cell proliferation and apoptosis.

Figure 3

(A) MicroRNA-15a expression in HLE-B3 cells. Cells were transfected with microRNA-15a mimics for 48 h. (B) Flow cytometry analysis of the apoptosis in HLE-B3 cells. (C) Caspase-3 activity in HLE-B3 cells. (D) Cell viability measured by the CCK-8 assay in HLE-B3 cells. Three independent experiments were carried out. Error bars stand for the mean ± SD of at least triplicate experiments. *P<0.05.

MicroRNA-15a regulated BCL2 and E2F3 expression in human lens epithelial cells

After HLE-B3 cells were transfected with microRNA-15a mimics or mimic controls for 48 h, BCL2 and E2F3 mRNA expression and protein expression were detected. As compared with the mimic control group, BCL2 expression were significantly decreased in microRNA-15a mimics group (Figure 4A,B). In addition, E2F3 mRNA (Figure 4C) and protein (Figure 4D) levels were also significantly reduced compared with the control group. These data suggested that microRNA-15a regulated BCL2 and E2F3 expression in HLE-B3 cells.

Figure 4. BCL2 and E2F3 expressions were inhibited by overexpression of microRNA-15a in HLE-B3 cells.

Figure 4

(A) Quantitative RT-PCR data of BCL2 mRNA in HLE-B3 cells. (B) Western blot data of protein levels of BCL-2 in HLE-B3 cells. (C) E2F3 mRNA expression in HLE-B3 cells. (D) Protein levels of E2F3 in HLE-B3 cells. Three independent experiments were carried out. Error bars stand for the mean ± SD of at least triplicate experiments. *P<0.05.

BCL2 and E2F3 were the targets of microRNA-15a

To investigate the direct target gene of microRNA-15a, bioinformatics analysis (TargetScan, Starbase, miRanda and miRDB database) was performed. BCL2 and E2F3 were predicted as the direct targets of microRNA-15a. Binding regions between microRNA-15a and BCL2 was shown in Figure 5A and the Luciferase reporter plasmids of WT-BCL2 and MUT-BCL2 binding sites were displayed. Co-transfection of the luciferase reporter plasmid containing the WT with microRNA-15a mimics decreased the reporter activity in HLE-B3 cells (Figure 5B). In addition, the Luciferase reporter plasmids of WT E2F3 and mutant E2F3 binding sites were exhibited in Figure 5C. Consistently, co-transfection of the luciferase reporter plasmid containing the WT with microRNA-15a mimics also suppressed the reporter activity (Figure 5D). The results showed that BCL2 and E2F3 directly targeted microRNA-15a.

Figure 5. BCL2 and E2F3 were direct targets of microRNA-15a.

Figure 5

(A) The luciferase reporter constructs containing the WT-BCL2 or MUT-BCL2 sequence. (B) WT-BCL2 or MUT-BCL2 was co-transfected into HLE-B3 cells with microRNA-15a mimics or their corresponding negative controls. (C) The luciferase reporter constructs containing the wild-type (WT-E2F3) or mutant E2F3 (MUT-E2F3) sequence. (D) WT-E2F3 or MUT-E2F3 was co-transfected into HLE-B3 cells with microRNA-15a mimics or their corresponding negative controls. Three independent experiments were carried out. Error bars stand for the mean ± SD of at least triplicate experiments. *P<0.05.

Discussion

MicroRNAs are involved in various pathological processes including cell growth and apoptosis and they can also represent a potential target for the diagnosis, prevention and treatment of age-related cataracts [20–22]. In our study, we observed microRNA-15a was greatly up-regulated in HLE-B3 cells indicated with 200 μmol/l H2O2. Meanwhile, BCL2 and E2F3 was obviously down-regulated by 200 μmol/l H2O2 in HLE-B3 cells. Overexpression of microRNA-15a was able to inhibit cell proliferation and induce cell apoptosis by targeting BCL2 and E2F3. Moreover, the negative interaction between BCL2, E2F3 and microRNA-15a was proved in our study. A novel mechanism of microRNA-15a/BCL2/E2F3 axis in age-related cataracts was revealed in our present study.

Oxidants can trigger apoptosis and contribute to cataract development [23]. In our present research, we found that 200 μmol/l H2O2 induced apoptosis and inhibited cell proliferation of HLE-B3 significantly. miR-15 family are clustered on three separate chromosomes [24] and the miR-15 family can play a significant role in various cancers [25,26]. For instance, knockdown microRNA-15a promotes the development and induces the EMT process of NSCLC cells [27]. MicroRNA-15a inhibits endometrial cancer cell growth through Wnt/β-catenin signaling by repressing WNT3A [28]. Recently, microRNA-15a in age-related cataract patients is reported to be increased [29].

The BCL2 gene family and its related protein bcl-2 were the first apoptosis-related genes to be studied [30]. BCL2 family genes can play a regulatory role in apoptosis. For example, miR-34a can promote apoptosis of human lens epithelial cells through down-regulating BCL2 [31]. Using informatics analysis, we found that the famous anti-apoptotic gene BCL2 might act as a direct target of microRNA-15a.

The E2F transcription factor family contains eight members, which plays an important role in cellular proliferation, differentiation and apoptosis [32]. E2F1-3 transcription factors exert essential roles in cellular proliferation [33]. For example, miR-203a can suppress cell proliferation through targeting E2F3 in human gastric cancer [34]. MiR-217 inhibits pancreatic cancer cell proliferation via targeting E2F3 [35]. In addition, miR-34a can suppress proliferation and induce apoptosis of human lens epithelial cells through targeting E2F3 [36].

In summary, the results of our present study demonstrated that microRNA-15a was able to modulate lens epithelial cells apoptosis and proliferation through targeting BCL2 and E2F3 in age-related cataracts. Our observations can provide novel insights into the potential therapeutic applications for age-related cataracts treatment.

Data Availability Statement

All data are available upon request.

Abbreviations

BCL2

B-cell lymphoma-2

DAPI

4′,6-diamidino-2-phenylindole

DEVD-pNA

Caspase-3 substrate (chromogenic)

EdU

5-ethynyl-2′-deoxyuridine

E2F

encodes a family of transcription factors

E2F3

E2F transcription factor 3

HLE-B3

human lens epithelial B3

MUT

mutant

qPCR

quantitative polymerase chain reaction

RIPA

Radioimmunoprecipitation assay

TBS-T

tris-buffered saline (TBS) and Polysorbate 20

WNT3A

Wnt family member 3A

WT

wild-type

Author Contribution

Q.H.L. conceived and designed the study. Q.L. performed the experiments and collected the data. H.T.P. did the analysis. Q.L. wrote the manuscript. Q.H.L. revised the manuscript. All authors approved the final proof.

Competing Interests

The authors declare that there are no competing interests associated with the manuscript.

Funding

This work was supported by the Basic Research Programs of Science and Technology Commission Foundation of Jiangsu Province [grant number 895320].

References

  • 1.Hirnschall N., Dexl A., Zandanell S., Motaabbed J.K., Grabner G. and Findl O. (2015) Reliability and reproducibility of the German version of the European Society of Cataract and Refractive Surgeons reading charts. J. Cataract Refract. Surg. 41, 1465–1469 10.1016/j.jcrs.2014.10.036 [DOI] [PubMed] [Google Scholar]
  • 2.Lee C.M. and Afshari N.A. (2017) The global state of cataract blindness. Curr. Opin. Ophthalmol. 28, 98–103 10.1097/ICU.0000000000000340 [DOI] [PubMed] [Google Scholar]
  • 3.Liu Y.C., Wilkins M., Kim T., Malyugin B. and Mehta J.S. (2017) Cataracts. Lancet 390, 600–612 10.1016/S0140-6736(17)30544-5 [DOI] [PubMed] [Google Scholar]
  • 4.Kempen J.H., Sugar E.A., Varma R. et al. (2014) Risk of cataract among subjects with acquired immune deficiency syndrome free of ocular opportunistic infections. Ophthalmology 121, 2317–2324 10.1016/j.ophtha.2014.06.014 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Cai M., Li J., Lin S. et al. (2015) Mitochondria-targeted antioxidant peptide SS31 protects cultured human lens epithelial cells against oxidative stress. Curr. Eye Res. 40, 822–829 10.3109/02713683.2014.959607 [DOI] [PubMed] [Google Scholar]
  • 6.Mathias R.T., White T.W. and Gong X. (2010) Lens gap junctions in growth, differentiation, and homeostasis. Physiol. Rev. 90, 179–206 10.1152/physrev.00034.2009 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Beebe D.C., Holekamp N.M. and Shui Y.B. (2010) Oxidative damage and the prevention of age-related cataracts. Ophthal. Res. 44, 155–165 10.1159/000316481 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Zhang Z.F., Zhang J., Hui Y.N. et al. (2011) Up-regulation of NDRG2 in senescent lens epithelial cells contributes to age-related cataract in human. PLoS ONE 6, e26102 10.1371/journal.pone.0026102 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Kim V.N. (2005) MicroRNA biogenesis: coordinated cropping and dicing. Nat. Rev. Mol. Cell Biol. 6, 376–385 10.1038/nrm1644 [DOI] [PubMed] [Google Scholar]
  • 10.Bartel D.P. (2004) MicroRNAs: genomics, biogenesis, mechanism, and function. Cell 116, 281–297 10.1016/S0092-8674(04)00045-5 [DOI] [PubMed] [Google Scholar]
  • 11.Bartel D.P. (2009) MicroRNAs: target recognition and regulatory functions. Cell 136, 215–233 10.1016/j.cell.2009.01.002 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Peters L. and Meister G. (2007) Argonaute proteins: mediators of RNA silencing. Mol. Cell 26, 611–623 10.1016/j.molcel.2007.05.001 [DOI] [PubMed] [Google Scholar]
  • 13.Chen K. and Rajewsky N. (2007) The evolution of gene regulation by transcription factors and microRNAs. Nat. Rev. Genet. 8, 93–103 10.1038/nrg1990 [DOI] [PubMed] [Google Scholar]
  • 14.Maegdefessel L. (2014) The emerging role of microRNAs in cardiovascular disease. J. Intern. Med. 276, 633–644 10.1111/joim.12298 [DOI] [PubMed] [Google Scholar]
  • 15.Kumar S., Vijayan M., Bhatti J.S. and Reddy P.H. (2017) MicroRNAs as peripheral biomarkers in aging and age-related diseases. Prog. Mol. Biol. Transl. Sci. 146, 47–94 10.1016/bs.pmbts.2016.12.013 [DOI] [PubMed] [Google Scholar]
  • 16.Dimmeler S. and Nicotera P. (2013) MicroRNAs in age-related diseases. EMBO Mol. Med. 5, 180–190 10.1002/emmm.201201986 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Fan F., Zhuang J., Zhou P., Liu X. and Luo Y. (2017) MicroRNA-34a promotes mitochondrial dysfunction-induced apoptosis in human lens epithelial cells by targeting Notch2. Oncotarget 8, 110209–110220 10.18632/oncotarget.22597 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Chen X., Xiao W., Chen W. et al. (2017) MicroRNA-26a and -26b inhibit lens fibrosis and cataract by negatively regulating Jagged-1/Notch signaling pathway. Cell Death Differ. 24, 1431–1442 10.1038/cdd.2016.152 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Dong Y., Zheng Y., Xiao J., Zhu C. and Zhao M. (2016) MicroRNA let-7b induces lens epithelial cell apoptosis by targeting leucine-rich repeat containing G protein-coupled receptor 4 (Lgr4) in age-related cataract. Exp. Eye Res. 147, 98–104 10.1016/j.exer.2016.04.018 [DOI] [PubMed] [Google Scholar]
  • 20.Wang S., Guo C., Yu M. et al. (2018) Identification of H2O2 induced oxidative stress associated microRNAs in HLE-B3 cells and their clinical relevance to the progression of age-related nuclear cataract. BMC Ophthalmol. 18, 93 10.1186/s12886-018-0766-6 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Yu X., Zheng H., Chan M.T. and Wu W.K.K. (2017) MicroRNAs: new players in cataract. Am. J. Transl. Res. 9, 3896–3903 [PMC free article] [PubMed] [Google Scholar]
  • 22.Wu C., Liu Z., Ma L. et al. (2017) MiRNAs regulate oxidative stress related genes via binding to the 3′ UTR and TATA-box regions: a new hypothesis for cataract pathogenesis. BMC Ophthalmol. 17, 142 10.1186/s12886-017-0537-9 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Li W.C., Kuszak J.R., Dunn K. et al. (1995) Lens epithelial cell apoptosis appears to be a common cellular basis for non-congenital cataract development in humans and animals. J. Cell Biol. 130, 169–181 10.1083/jcb.130.1.169 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Porrello E.R., Johnson B.A., Aurora A.B. et al. (2011) MiR-15 family regulates postnatal mitotic arrest of cardiomyocytes. Circ. Res. 109, 670–679 10.1161/CIRCRESAHA.111.248880 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Aqeilan R.I., Calin G.A. and Croce C.M. (2010) miR-15a and miR-16-1 in cancer: discovery, function and future perspectives. Cell Death Differ. 17, 215–220 10.1038/cdd.2009.69 [DOI] [PubMed] [Google Scholar]
  • 26.Cimmino A., Calin G.A., Fabbri M. et al. (2005) miR-15 and miR-16 induce apoptosis by targeting BCL2. Proc. Natl. Acad. Sci. U.S.A. 102, 13944–13949 10.1073/pnas.0506654102 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.He J. (2017) Knocking down MiR-15a expression promotes the occurrence and development and induces the EMT of NSCLC cells in vitro. Saudi J. Biol. Sci. 24, 1859–1865 10.1016/j.sjbs.2017.11.028 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Wang Z.M., Wan X.H., Sang G.Y., Zhao J.D., Zhu Q.Y. and Wang D.M. (2017) miR-15a-5p suppresses endometrial cancer cell growth via Wnt/beta-catenin signaling pathway by inhibiting WNT3A. Eur. Rev. Med. Pharmacol. Sci. 21, 4810–4818 [PubMed] [Google Scholar]
  • 29.Li Y., Liu S., Zhang F., Jiang P., Wu X. and Liang Y. (2015) Expression of the microRNAs hsa-miR-15a and hsa-miR-16-1 in lens epithelial cells of patients with age-related cataract. Int. J. Clin. Exp. Med. 8, 2405–2410 [PMC free article] [PubMed] [Google Scholar]
  • 30.Thomadaki H. and Scorilas A. (2006) BCL2 family of apoptosis-related genes: functions and clinical implications in cancer. Crit. Rev. Clin. Lab. Sci. 43, 1–67 10.1080/10408360500295626 [DOI] [PubMed] [Google Scholar]
  • 31.Li Q.L., Zhang H.Y., Qin Y.J., Meng Q.L., Yao X.L. and Guo H.K. (2016) MicroRNA-34a promoting apoptosis of human lens epithelial cells through down-regulation of B-cell lymphoma-2 and silent information regulator. Int. J. Ophthalmol. 9, 1555–1560 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Maiti B., Li J., de Bruin A. et al. (2005) Cloning and characterization of mouse E2F8, a novel mammalian E2F family member capable of blocking cellular proliferation. J. Biol. Chem. 280, 18211–18220 10.1074/jbc.M501410200 [DOI] [PubMed] [Google Scholar]
  • 33.Wu L., Timmers C., Maiti B. et al. (2001) The E2F1-3 transcription factors are essential for cellular proliferation. Nature 414, 457–462 10.1038/35106593 [DOI] [PubMed] [Google Scholar]
  • 34.Yang H., Wang L., Tang X. and Bai W. (2017) miR-203a suppresses cell proliferation by targeting E2F transcription factor 3 in human gastric cancer. Oncol. Lett. 14, 7687–7690 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Yang J., Zhang H.F. and Qin C.F. (2017) MicroRNA-217 functions as a prognosis predictor and inhibits pancreatic cancer cell proliferation and invasion via targeting E2F3. Eur. Rev. Med. Pharmacol. Sci. 21, 4050–4057 [PubMed] [Google Scholar]
  • 36.Xiang W., Lin H., Wang Q. et al. (2016) miR34a suppresses proliferation and induces apoptosis of human lens epithelial cells by targeting E2F3. Mol. Med. Rep. 14, 5049–5056 10.3892/mmr.2016.5901 [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

All data are available upon request.


Articles from Bioscience Reports are provided here courtesy of Portland Press Ltd

RESOURCES