Skip to main content
The Journal of Biological Chemistry logoLink to The Journal of Biological Chemistry
. 2019 Oct 28;294(49):18698–18713. doi: 10.1074/jbc.RA119.010176

The transcription factor ETS1 promotes apoptosis resistance of senescent cholangiocytes by epigenetically up-regulating the apoptosis suppressor BCL2L1

Steven P O'Hara 1,1,2, Patrick L Splinter 1,1, Christy E Trussoni 1, Maria Eugenia Guicciardi 1, Noah P Splinter 1, Mohammed S Al Suraih 1, Navine Nasser-Ghodsi 1, Deborah Stollenwerk 1, Gregory J Gores 1, Nicholas F LaRusso 1
PMCID: PMC6901313  PMID: 31659122

Abstract

Primary sclerosing cholangitis (PSC) is an idiopathic, progressive cholangiopathy. Cholangiocyte senescence is important in PSC pathogenesis, and we have previously reported that senescence is regulated by the transcription factor ETS proto-oncogene 1 (ETS1) and associated with overexpression of BCL2 like 1 (BCL2L1 or BCL-xL), an anti-apoptotic BCL2-family member. Here, we further explored the mechanisms regulating BCL-xL-mediated, apoptosis resistance in senescent cholangiocytes and uncovered that ETS1 and the histone acetyltransferase E1A-binding protein P300 (EP300 or p300) both promote BCL-xL transcription. Using immunofluorescence, we found that BCL-xL protein expression is increased both in cholangiocytes of livers from individuals with PSC and a mouse model of PSC. Using an in vitro model of lipopolysaccharide-induced senescence in normal human cholangiocytes (NHCs), we found increased BCL-xL mRNA and protein levels, and ChIP-PCRs indicated increased occupancy of ETS1, p300, and histone 3 Lys-27 acetylation (H3K27Ac) at the BCL-xL promoter. Using co-immunoprecipitation and proximity ligation assays, we further demonstrate that ETS1 and p300 physically interact in senescent but not control NHCs. Additionally, mutagenesis of predicted ETS1-binding sites within the BCL-xL promoter blocked luciferase reporter activity, and CRISPR/Cas9-mediated genetic deletion of ETS1 reduced senescence-associated BCL-xL expression. In senescent NHCs, TRAIL-mediated apoptosis was reduced ∼70%, and ETS1 deletion or RNAi-mediated BCL-xL suppression increased apoptosis. Overall, our results suggest that ETS1 and p300 promote senescent cholangiocyte resistance to apoptosis by modifying chromatin and inducing BCL-xL expression. These findings reveal ETS1 as a central regulator of both cholangiocyte senescence and the associated apoptosis-resistant phenotype.

Keywords: apoptosis, senescence, transcription factor, chromatin modification, gene expression, epigenetics, BCL2 like 1 (BCL2L1), cholangiocyte, primary sclerosing cholangitis (PSC)

Introduction

Bile ducts are lined by epithelial cells, termed cholangiocytes, that transport and modify primary bile as it transits from the liver to the small intestine. Primary sclerosing cholangitis (PSC)3 is an idiopathic, progressive fibro-inflammatory disease whereby inflammation and fibrotic stricturing ultimately destroy these intra- and/or extrahepatic bile ducts (1, 2). Approximately 25,000 adolescents and adults in the United States suffer from PSC and the median liver transplant-free survival remains at ∼12 years (2, 3). Currently, no effective pharmacotherapy exists to slow progression of the disease. Therefore, a better understanding of PSC pathogenesis and effective, targeted pharmacologic treatment are critically needed. Our recent studies have implicated cholangiocyte senescence as an etiologic feature of PSC and a potential therapeutic target.

The senescent cell fate is characterized by permanent withdrawal from the cell cycle in phase G1 or G2 (4, 5). This cellular phenotype is increasingly recognized as an important pathological feature in a variety of conditions including aging, type 2 diabetes, atherosclerosis, osteoarthritis, idiopathic pulmonary fibrosis, and chronic obstructive pulmonary disease (610). The inciting events triggering withdrawal from the cell cycle include strong mitogenic or oncogenic signals, and telomeric and/or nontelomeric DNA damage (9, 1113). We previously demonstrated that PSC liver tissue exhibits increased numbers of senescent cholangiocytes, characterized by increased histone marks of DNA damage (γH2AX) and elevated expression of the inhibitor of cyclin-dependent kinases, CDKN2A (p16INK4a) (14). Moreover, these cells expressed markers of the senescence-associated secretory phenotype (SASP) (14), a potentially pathologic state of proinflammatory cytokine, chemokine, and growth factor hypersecretion (15). In previous work, we demonstrated that lipopolysaccharide (LPS) promotes TLR4-dependent activation of the small GTPase, NRAS (16, 17), and persistent LPS treatment of cultured cholangiocytes induces NRAS-dependent expression of p16INK4a and senescence in cultured cholangiocytes (14). Our data also support that the interaction of a RAS responsive transcription factor, ETS1, with the promoter elements of p16INK4a is required for p16INK4a expression and the senescent cholangiocyte cell fate in both LPS-induced and NRAS overexpression culture models (18). The relevance of these in vitro observations was supported by in vivo data showing that phospho-ETS1 protein expression was increased in cholangiocytes of both human PSC liver samples and in the ABC subfamily B member 4 genetic knockout (Abcb4−/−; also known as multidrug-resistant 2 (Mdr2−/−) mouse, an animal model of PSC (18). Although these data enhanced our understanding of the molecular mechanisms of cholangiocyte senescence, they did not address other phenotypic features of senescent cholangiocytes.

Senescence is frequently associated with resistance to apoptosis, which may account for the persistence of senescent cells in tissues and associated deleterious consequences (1921). The BCL2 protein family plays a central role in mitochondrial-dependent apoptosis (22). This family includes the mitochondrial pore forming effector proteins, BAK and BAX, as well as pro-apoptotic activators and anti-apoptotic mediators, the balance of which determines cell survival or death (22, 23). We recently demonstrated in vitro that the anti-apoptotic protein, BCL2L1 (BCL-xL), is up-regulated in senescent cholangiocytes, and pharmacological inhibition of BCL-xL with the small molecule inhibitor, A1331852, selectively kills cultured senescent cholangiocytes. Moreover, pharmacological inhibition of BCL-xL in the Mdr2−/− mouse diminished the number of senescent cholangiocytes and decreased liver fibrosis (24). Although ETS1 has been implicated in promoting the expression of prosurvival proteins and resistance to apoptosis (25, 26), whether ETS1 promotes apoptosis resistance of senescent cells in general, and of senescent cholangiocytes in particular is unclear and is the focus of our work here. Our collective data suggest that ETS1 not only promotes cholangiocyte senescence via the up-regulation of p16INK4a, but also drives the expression of BCL-xL via the recruitment of the chromatin remodeling histone acetyltransferase, p300. These novel results provide mechanistic insight into senescent cholangiocyte apoptosis resistance, and suggest a potential pathophysiological role in the development and progression of PSC and perhaps other diseases. Moreover, pharmacologic targeting of this pathway may provide a new therapeutic strategy for PSC and other conditions where apoptosis-resistant senescent cells likely contribute to disease progression.

Results

Cholangiocytes from PSC patient and Mdr2−/− mouse liver tissue exhibit increased BCL-xL expression

We previously published that BCL-xL inhibition in the Mdr2−/− mouse model of PSC-depleted senescent cholangiocyte number and improved fibrosis. To extend this observation, we assessed BCL-xL protein expression by immunofluorescent confocal microscopy and confirmed that cholangiocytes from nondiseased human liver (normal control) express very little BCL-xL protein, whereas cholangiocytes from PSC patient liver tissue expressed increased BCL-xL (Fig. 1A). Quantitation of fluorescent intensity was performed and confirmed increased BCL-xL expression (∼5-fold) in PSC cholangiocytes compared with normal control cholangiocytes (Fig. 1B). Given that Mdr2−/− mice exhibit increased senescent cholangiocytes (14) and that BCL-xL inhibition improves fibrosis (24), we next assessed cholangiocyte BCL-xL expression in wildtype (WT) C57bl6 and Mdr2−/− mouse liver tissue. As with human specimens, BCL-xL was minimally expressed in cholangiocytes from WT mice, whereas expression was increased ∼3-fold in Mdr2−/− mice (Fig. 1, C and D). Thus, these in vivo data confirm and extend our previous work by demonstrating up-regulated expression of the prosurvival protein, BCL-xL, in cholangiocytes in samples of liver from PSC patients and the Mdr2−/− mouse.

Figure 1.

Figure 1.

In vivo BCL-xL immunofluorescence staining shows increase protein expression of BCL-xL in PSC patient samples. A, representative confocal images for DAPI (blue), CK19 (red), and BCL-xL (green) in cholangiocytes of normal control and PSC human liver samples (dashed lines indicate outline of bile duct). Cholangiocyte BCL-xL protein is increased in PSC cholangiocytes compared with normal patient control samples. B, semiquantitative analysis of fluorescence intensity demonstrated increased BCL-xL (∼6-fold) in PSC cholangiocytes. Fluorescence intensity was measured in no fewer than four bile ducts from three normal human control tissue samples and three PSC patient samples; *, p < 0.05. C, representative confocal images for DAPI (blue), CK19 (red), and BCL-xL (green) in cholangiocytes of WT FVBN and the Mdr2−/− mouse model of PSC (dashed lines indicate outline of bile duct). Again, cholangiocyte BCL-xL protein expression is increased in Mdr2−/− mouse livers compared with WT (FVBN) control. D, semiquantitative analysis of fluorescence intensity demonstrates increased BCL-xL (∼3-fold) in Mdr2−/− cholangiocytes compared with FVBN control cholangiocytes. Fluorescence intensity (arbitrary units) was normalized to FVBN control and is presented as mean fold-change ± S.D. Fluorescence intensity was measured in no fewer than four bile ducts from three FVBN control and three Mdr2−/− mice; *, p < 0.05.

LPS treatment increases BCL-xL expression in cultured human cholangiocytes

The anti-apoptotic Bcl-2 proteins may be up-regulated in senescent cells and prevent senescent cell death (20). In an effort to assess the expression of potential pro- and anti-apoptotic mediators in senescent cholangiocytes, we utilized our culture model of LPS-induced cholangiocyte senescence (14). Quantitative PCR (qPCR) demonstrated a selective increase in BCL-xL mRNA (∼8-fold), in senescent versus nonsenescent controls (Fig. 2A); other anti-apoptotic BCL2 family members were not affected. We further found that the pro-apoptotic effector, BAK1, increased ∼2-fold in senescent cholangiocytes, whereas the proapoptotic activator, Noxa, decreased (Fig. 2A). Western blotting analyses confirmed the selective up-regulation of BCL-xL and BAK1, as well as the decreased expression of BAX and NOXA in senescent cholangiocytes (Fig. 2B). To confirm the induction of cholangiocyte senescence in our culture model, we performed qPCR and Western blotting on senescence-associated gene products. qPCR confirmed that both CDKN2A (p16) and CDKN1A (p21) were up-regulated in our culture system, whereas Western blotting confirmed the up-regulation of CDKN2A, CDKN1A as well as the senescence-associated DNA damage histone mark, γH2A.X (Fig. 2C). The proliferation-associated gene product, proliferating cell nuclear antigen (PCNA) also decreased (Fig. 2C). Furthermore, and as demonstrated by us previously (18), ETS1 is up-regulated in senescent cholangiocytes (Fig. 2C), whereas pharmacologic inhibition of Ras/MAPK prevents ETS1 up-regulation and also diminishes BCL-xL mRNA and protein up-regulation in our senescent cholangiocyte culture model (Fig. S1). Collectively, these data suggest that the mitochondrial apoptotic pathway in senescent cholangiocytes is primed for mitochondrial cell death via up-regulation of the pro-apoptotic effector protein, BAK1, and support that the increased expression of the anti-apoptotic mediator, BCL-xL, may be essential to sequester BAK1 and confer the apoptosis-resistant phenotype of senescent cholangiocytes.

Figure 2.

Figure 2.

Persistent LPS treatment of cholangiocytes increases anti-apoptotic BCL-xL expression and pro-apoptotic BAK1 expression. A, mRNA expression was assessed by qPCR in cholangiocytes cultured in the absence (control nonsenescent (Ctrl)) and or presence of LPS for 10 days (LPS-IS). LPS-IS cholangiocytes exhibited increased mRNA expression versus Ctrl of the anti-apoptotic gene, BCL-xL (∼8-fold), and the pro-apoptotic gene, BAK1 (∼4-fold). In contrast, LPS-IS cholangiocytes exhibited decreased mRNA expression the pro-apoptotic BAX1 (∼2-fold) and NOXA (∼4-fold) versus Ctrl. B, immunoblots for anti- and pro-apoptotic proteins in Ctrl versus LPS-IS cholangiocytes. LPS-IS cholangiocytes exhibited increased expression of the anti-apoptotic protein BCL-xL (∼5.8-fold) and BAK1 (∼2.1-fold) versus Ctrl. LPS-IS cholangiocytes exhibited decreased expression versus Ctrls in the pro-apoptotic proteins BAX (∼2.2-fold) and NOXA (∼4.5-fold). C, qPCR and immunoblots blot for senescence-associated markers. LPS-IS cholangiocytes exhibited increased mRNA expression of the senescence-associated genes CDKN2A (p16; ∼9-fold) and CDKN1A (p21; ∼11-fold) versus Ctrl cholangiocytes. Finally, immunoblot analysis indicates a significant increase in CDKN2A (∼3.9-fold), CDKN1A (∼3.4-fold), p-γH2A.X (∼2.4-fold), and ETS1 (∼3.2-fold) protein, whereas cell proliferation protein, PCNA, was decreased (∼3.1-fold) in LPS-IS versus Ctrl cholangiocytes. ACTB was performed as a loading control. (*, p < 0.05; n = 3 for both qPCR and Western blotting quantitation).

BCL-xL up-regulation correlates with the induction of cholangiocyte senescence and ETS1 expression

We previously demonstrated that the Ras-responsive transcription factor, ETS1, promoted CDKN21 (p16) expression and cholangiocyte senescence following LPS treatment (18). We therefore asked whether the expression of BCL-xL dynamically correlated with the induction of cholangiocyte senescence and ETS1 expression in our experimentally-induced senescent cholangiocytes. Western blotting demonstrated that BCL-xL up-regulation occurred following 6 days of repeated LPS treatment, which correlates with ETS1 up-regulation and the induction of senescence as demonstrated with the induction of CDKN2A and CDKN1A (Fig. 3A). To directly assess whether the up-regulated expression of BCL-xL correlated with apoptosis resistance and senescence, we utilized our cell culture model of induced senescence and assessed apoptosis by measuring activation of caspase-3/7 and senescence by β-galactosidase positivity. Although untreated normal human cholangiocytes (NHCs) exhibited minimal apoptosis, we found that exposure to LPS induced cultured NHC apoptosis at days 1–4, but decreased on days 6–10 (Fig. 3B). Moreover, and as demonstrated previously (14), β-gal activity increased at 6 days post-repeated LPS treatment, and persisted through 10 days post-repeated LPS treatment (Fig. 3C). To confirm the apoptotic-resistant phenotype we treated nonsenescent or induced senescent NHC with TRAIL. Although TRAIL treatment activates the extrinsic (death receptor-mediated) apoptotic pathway, activation of effector caspases (such as caspase-3/7) in liver epithelia (i.e. hepatocytes and cholangiocytes) requires the engagement of the mitochondrial apoptotic pathway (27, 28). We found TRAIL-induced apoptosis in nonsenescent control NHC, but not in senescent NHC and that the induction of apoptosis in nonsenescent NHC was prevented by the caspase inhibitor Z-VAD-fmk (Fig. 3, D and E). Senescence detection remained elevated in LPS-IS cholangiocytes in both the presence and absence of TRAIL and the presence and absence of Z-VAD-FMK (Fig. 3F). Together, these data continue to support an essential role of ETS1 in cholangiocyte senescence and demonstrate further that BCL-xL up-regulation correlates with the expression of ETS1, senescence induction, and the apoptosis-resistance phenotype.

Figure 3.

Figure 3.

Anti-apoptotic BCL-xL protein expression increases in a time-dependent manner in response to persistent exposure to LPS for 10 days. A, immunoblots for BCL-xL shows low protein expression for the first 4 days of LPS treatment. At day 6, BCL-xL protein increases and remains elevated at day 10. Phosphorylated ETS1 is undetectable until day 6 and remains elevated at day 10. Total ETS1 is initially detected at day 1 of LPS treatment, decreases at days 2 and 4, and increases again at days 6–10. The senescence markers CDKN2A (p16) and CDKN1A (p21) exhibit increased expression from days 4 to 10. ACTB immunoblot was performed as a loading control. B, caspase-3/7 Apo One assay was used to assess apoptosis in response to the absence (nonsenescent (Ctrl)) or presence of persistent LPS exposure over 10 days (LPS-induced senescent cholangiocytes (LPS-IS)). Apoptosis was significantly increased in LPS-IS versus Ctrl cholangiocytes at days 1 and 2 (1.4- and 1.5-fold, respectively) and peaked at 4 day (∼2.1-fold) prior to decreasing to Ctrl levels (n = 3; *, p < 0.05). C, SA-β-gal staining assay was used to assess senescence in LPS-IS versus Ctrl cholangiocytes and is shown as a percentage of cells staining positive for SA-β-gal. Senescence increased in LPS-IS versus Ctrl cholangiocytes after 6 days (∼21.6 versus ∼5.1%) and remained increased thereafter (day 10; ∼37.5 versus ∼4.8%; n = 3; p < 0.05). D and E, LPS-IS and Ctrl cholangiocytes were treated with TRAIL and/or the pan-Caspase inhibitor, Z-VAD-FMK, for 24 h and assayed for apoptosis using the caspase-3/7 or annexin V (Celigo) assays. Z-VAD-FMK treatment alone had no effect on apoptosis in both Ctrl and LPS-IS cholangiocytes; however, TRAIL treatment increased apoptosis in Ctrl cholangiocytes compared with non-TRAIL-treated Ctrl cholangiocytes in both assays (∼5- and ∼8.5-fold; n = 4). LPS-IS cholangiocytes treated with TRAIL exhibited a ∼4.7-fold (caspase-3/7) and ∼5-fold (annexin V) decrease in apoptosis compared with TRAIL-treated Ctrl cholangiocytes (n = 4; *, p < 0.05). F, senescence was measured using the fluorescent β-gal assay and was normalized to 1 μg of protein. Senescence detection remained elevated in LPS-IS cholangiocytes in both the presence and absence of TRAIL and the presence and absence of Z-VAD-FMK (n = 3; p < 0.05).

BCL-xL interacts with the cell death effectors BAK and BAX in senescent cholangiocytes

Anti-apoptotic Bcl-2 proteins (e.g. BCL-xL) either inhibit the pro-apoptotic effectors (BAK and BAX) via direct binding of their activated form or by sequestering “activator” BH3-only proteins (e.g. BIM, NOXA) and preventing their activation of BAK and BAX (22). We therefore assessed whether the anti-apoptotic protein BCL-xL directly interacted with apoptotic effectors or activators in senescent cholangiocytes. We immunoprecipitated BCL-xL from control and senescent cholangiocytes and performed immunoblotting for apoptosis activators and effectors. We found that BCL-xL formed an immunoprecipitable complex with BAK and BAX, but not BIM or NOXA (Fig. 4A). It is proposed that BCL-xL interacts with activated BAK and/or BAX, blocks oligomerization of these proapoptotic molecules, and thus prevents apoptosis (29). Therefore, we next immunoprecipitated activated BAK and BAX and immunoblotted for BCL-xL. We detected BCL-xL only in senescent cholangiocytes further supporting that active BAK and BAX interact with BCL-xL in senescent cholangiocytes (Fig. 4B). Finally, to determine whether the antiapoptotic protein BCL-xL interacts with BAX and BAK in human PSC liver tissue, we performed proximity ligation assays on formalin-fixed paraffin-embedded tissue. This fluorescence-based approach suggests increased BAK and BAX interaction with BCL-xL in PSC cholangiocytes (Fig. 4, C and D). Together, these in vitro results support that up-regulated BCL-xL directly interacts with active BAK and BAX in senescent cholangiocytes and that this interaction is a likely mechanism for the apoptosis-resistant phenotype of senescent cholangiocytes. Furthermore, the data supports that this process occurs in cholangiocytes from PSC liver tissue.

Figure 4.

Figure 4.

Pro-apoptotic effector proteins BAK and BAX interact with BCL-xL in senescent cholangiocytes. A, immunoprecipitation of BCL-xL protein and subsequent immunoblotting for BAK and BAX demonstrates that BCL-xL forms an immunoprecipitatable complex with these apoptosis effector proteins in LPS-induced senescence (LPS-IS) but not Ctrl cholangiocytes. In contrast, BIM, BIK, and NOXA do not immunoprecipitate with BCL-xL in either Ctrl or LPS-IS cholangiocytes. B, immunoprecipitation of BAK or BAX, using antibodies that recognize only the activated forms of the molecule under nondenaturing conditions, and subsequent immunoblotting for BCL-xL suggests the interaction between these effector proteins and BCL-xL in LPS-IS, but not Ctrl cholangiocytes. C, proximity ligation assays on formalin-fixed paraffin-embedded human PSC tissue suggested increased BAK and BAX interaction with BCL-xL in PSC cholangiocytes (arrows, red fluorescence; dashed lines indicate outline of bile duct). PLA negative controls were performed in the presence of the Bak or Bax antibody and the absence of the Bcl-xL antibody. D, quantitation of fluorescent images confirms an increased percentage of PLA-fluorescent positive cells. (n = 3 PSC patient samples and a minimum of 2 ducts per patient; *, p < 0.05).

ETS1 and the histone acetyltransferase, EP300 (p300), occupy the BCL-xL proximal promoter during induced cholangiocyte senescence

The DNA elements upstream of the BCL-xL transcriptional start site were analyzed for potential ETS1-binding sites and also analyzed for potential epigenetic regulation (i.e. histone acetylation marks). To perform these in silico analyses, we used the Encyclopedia of DNA Elements (ENCODE) annotation data (30) through the UCSC Genome Browser (http://genome.ucsc.edu/)4 (31) and the Blast-like alignment tool (BLAT) (32). This search tool identified a number of putative Histone-3 Lysine 27 acetylation (H3K27ac) (permissive chromatin) marks (not shown) and three potential ETS1-binding sites throughout the proximal BCL-xL promoter region (Fig. 5A). Next, we performed ChIP-PCR (Fig. 5A) and quantitative (q)ChIP-PCR (Fig. 5B) on nonsenescent control NHCs and cells from our induced senescence model. The BCL-xL promoter PCR amplicon is increased in senescent cholangiocytes after 10 days of LPS treatment (Fig. 5, A and B), suggesting that this transcription factor occupies the BCL-xL proximal promoter upon the induction of senescence. We next performed ChIP-PCR for the histone acetyltransferase, p300 and H3K27ac marks. We found that the chromatin modifying enzyme, p300, and the associated histone modification mark, H3K27ac, were both increased at the BCL-xL promoter locus upon senescence induction (Fig. 5, A and B). We also performed qChIP-PCR for activated RNA Polymerase 2 (POLR2), using an antibody specific for phosphorylated serine 2 of the POLR2 C-terminal domain (p-Ser-2 POLR2). Again, we observed increased PCR amplification of the BCL-xL promoter following the induction of senescence supporting active transcription from this locus (Fig. 5, A and B). To confirm co-occupancy of ETS1 and p300 at the BCL-xL locus during cholangiocyte senescence, we performed sequential ChIP-PCR. Initially, an antibody against p-ETS1 was used for ChIP and PCR amplification was performed for the BCL-xL promoter locus; as previous, amplification was seen only in senescent cholangiocytes. Subsequent immunoprecipitation of the pETS1 chromatin immunoprecipitate was performed with an antibody against p300; again, amplification of the BCL-xL promoter locus occurred only in senescent cholangiocytes (Fig. 5C). The converse, i.e. initial ChIP with p300 followed by subsequent ChIP of the immunoprecipitate with pETS1, again revealed amplification of the BCL-xL locus only in senescent cholangiocytes. Together, these data support that ETS1 and p300 occupy the BCL-xL promoter locus, the permissive chromatin mark H3K27ac accumulates at this locus, and active transcription occurs at this region (p-Ser-2 POLR2) during cholangiocyte senescence.

Figure 5.

Figure 5.

Phospho-ETS1 and p300 drive BCL-xL promoter-mediated transcription. A, the BCL-xL putative promoter region contains 3 potential ETS1 transcription factor-binding sites (−861, −314, and −167). Cholangiocytes were treated for 10 days in the presence or absence of LPS (LPS-IS and Ctrl, respectively). We performed IP with IgG control antibody (IgG ctrl) or with ChIP quality antibodies against p-ETS1, p300, H3K27ac, and p-POLR2 and PCR amplification of BCL-xL promoter loci. ChIP-PCR reveals minimal amplification of the BCL-xL promoter locus from all four immunoprecipitations in Ctrl cholangiocytes and increased amplification from LPS-IS cholangiocytes. B, qChIP-PCR using p-ETS1 confirms the increased amplification of the BCL-xL promoter (∼8-fold), p300 (∼4.5-fold), H3K27ac (∼4-fold), and p-POLR2L (∼4-fold) in LPS-IS versus Ctrl cholangiocytes (n = 3; *, p < 0.05). C, sequential ChIP-PCR was performed to detect simultaneous interaction of ETS1 and p300 with the BCL-xL locus. As previously shown, ChIP-PCR using a p-ETS1 antibody shows increased amplification of the BCL-xL promoter in LPS-IS versus Ctrl cholangiocytes. Subsequent p300 ChIP-PCR of the p-ETS1 IP product reveals amplification of the BCL-xL promotor locus in LPS-IS but not Ctrl cholangiocytes. The converse, p300 ChIP-PCR, with sequential pETS1ChIP-PCR for BCL-xL further supports the simultaneous occupancy of these proteins at the BCL-xL promoter locus in LPS-IS cholangiocytes. D, the BCL-xL proximal promoter locus was cloned upstream of a luciferase reporter (FL, 1009 bp). Site-directed mutagenesis was performed and BCL-xL promoter-driven luciferase constructs were generated to eliminate the distal (Δ1; −861 bp), mid (Δ2; −314 bp), and proximal (Δ3; −167 bp) predicted ETS1-binding sites. Combinations of these mutants (Δ1/2, Δ1/3, Δ2/3, and Δ1/2/3) were also generated. The FL construct in nonsenescent (Ctrl) cholangiocytes did not increase luciferase activity above the EV control. Persistent treatment with LPS (LPS-IS) induced luciferase activity (∼3-fold) in both full-length and the Δ3 construct (n = 8; *, p < 0.05 versus Ctrl FL). Luciferase activity was not induced in LPS-IS cholangiocytes transfected with the Δ1, Δ2, Δ1/2, Δ1/3, Δ2/3, and Δ1/2/3 constructs.

Predicted ETS1-binding sites promote reporter gene expression in senescent cholangiocytes

To further address the role of ETS1 in our induced cholangiocyte senescence model, we generated a BCL-xL promoter-driven luciferase reporter construct. Approximately 1000 bp (full-length, FL) of the BCL-xL proximal promoter were cloned into the luciferase reporter plasmid, pGL4.22 (BCL-xL-pGL4.22). Constructs with the individual ETS1 sites mutated by site-directed mutagenesis (Δ1 (−861), Δ2 (−341), and Δ3 (−167)) or combinations of these mutated predicted ETS1-binding sites (Δ1/2, Δ1/3, Δ2/3, and Δ1/2/3) were also generated. We found that the FL BCL-xL promoter induced luciferase expression upon the induction of cholangiocyte senescence compared with nonsenescent control cholangiocytes (Fig. 5D). Moreover, the individual mutations Δ1 and Δ2, or combinations with these mutations present (Δ1/2, Δ1/3, Δ2/3, and Δ1/2/3) significantly decreased induction of the BCL-xL promoter-induced luciferase in senescent cholangiocytes (Fig. 5D). Although these data do not specifically identify ETS1 as the driver of transcription, as all members of the ETS family interact with similar sequence motifs (33), the data identify ETS-binding sites within the BCL-xL promoter show that they are functional, and that they are required for efficient transcription of the luciferase reporter.

ETS1 and p300 physically interact in senescent cells and in PSC cholangiocytes

Having demonstrated that ETS1 and p300 co-occupy the BCL-xL promoter in senescent NHC, we next assessed whether ETS1 and p300 formed a complex and whether this complex was required for BCL-xL transcription. First, we immunoprecipitated p300 from nonsenescent control and senescent cholangiocytes and performed immunoblots for ETS1 and p300. We found that ETS1 formed an immunoprecipitatable complex with p300 only in senescent cholangiocytes, whereas the p300 immunoblot confirms efficient immunoprecipitation (Fig. 6A). ETS1 was also immunoprecipitated from nonsenescent control and senescent NHC cellular lysates and immunoblotting for p300 and p-ETS1 was performed on the immunoprecipitate. We again found that p300 and ETS1 formed an immunoprecipitatable complex, which was increased in senescent compared with nonsenescent control NHC; the pETS1 blot confirms efficient immunoprecipitation (Fig. 6B). Having previously demonstrated that senescent cholangiocytes are enriched in PSC patient bile ducts, we next assessed whether we could detect the physical interaction between ETS1 and p300 in bile ducts of PSC patients. Proximity ligation assays (PLA) were performed in tissue derived from either nondiseased human bile ducts (normal) or in PSC; DAPI was used to identify nuclei. PLA fluorescence was not detected in normal bile ducts, whereas PSC patient bile ducts exhibited increased PLA-associated fluorescence (Fig. 6C), suggesting that the proteins physically interact in diseased bile ducts. Together, these data suggest that ETS1 and p300 physically interact in senescent cholangiocytes and in PSC patient bile ducts, which are enriched in senescent cholangiocytes.

Figure 6.

Figure 6.

Phospho-ETS1 and p300 proteins physically interact. A, cholangiocytes were treated for 10 days with LPS (LPS-IS) or no LPS (Ctrl) and lysates were IP with nonrelevant IgG control (IgG Ctrl) antibody or with p300 antibody and immunoblotted (IB) for p-ETS1 or p300. Phospho-ETS1 detection is increased only in persistent LPS-treated senescent cholangiocytes (LPS-IS). p300 IB demonstrates successful immunoprecipitation of this protein. B, IP was performed on lysates using a IgG Ctrl antibody or with p-ETS1 antibody and blotted for p300 and p-ETS1. p300 detection is increased in LPS-IS versus Ctrl cholangiocytes. C, PLA were performed in paraffin-embedded PSC tissue. Representative confocal images for DAPI (blue) and p-ETS1/p300 PLA (red) and Lamin A (green) in cholangiocytes of normal control and PSC human liver samples reveal increased fluorescent puncta in PSC cholangiocytes (ND, not detected). PLA negative controls were performed in the presence of the ETS1 antibody and the absence of the p300 antibody. Dashed lines indicate outline of bile duct. Quantitation reveals that ∼50% of the PSC cholangiocyte nuclei were positive for the PLA product. (n = 3 PSC patient samples and a minimum of 2 ducts per patient; *, p < 0.05).

ETS1 depletion prevents p300 occupancy at the BCL-xL promoter in senescent cholangiocytes

Given that ETS1 and p300 co-occupy the BCL-xL promoter and physically interact in senescent cells, we assessed whether ETS1 was required for p300 localization at the BCL-xL promoter locus. To assess this, ETS1-deficient cultured cholangiocytes were generated using CRISPR Cas9 technology. The BCL-xL locus was successfully amplified following ChIP with antibodies against ETS1, p300, and H3K27ac in senescent NHCs, but PCR amplification was diminished in the absence of ETS1 (ΔETS1) (Fig. 7, A and B). ChIP-PCR was also performed on nonsenescent and NHCs cultured in our in vitro senescence model, which were depleted of p300 (p300 shRNA). In these p300-depleted cells, ChIP-PCR revealed decreased amplification of the BCL-xL promoter following ChIP with p300 and H3K27ac antibodies, however, ChIP-PCR with the ETS1 antibody resulted in BCL-xL promoter amplification similar to senescent NHC, suggesting that ETS1 can bind to the BCL-xL promoter locus in the absence of p300 (Fig. 7, C and D). Similarly, treatment of cultured cholangiocytes with an inhibitor of p300 histone acetyltransferase activity (C646) diminished BCL-xL and acetylated H3K27 expression, and suppressed LPS-induced senescence (Fig. S2, A–C). Together, these data support that ETS1 is required for p300 occupancy and H3K27ac accumulation at the BCL-xL promoter locus.

Figure 7.

Figure 7.

Genomic deletion of ETS1 diminishes p300 and H3K27ac accumulation at the BCL-xL locus. Control cholangiocytes (NHC) or NHC cells genetically deleted of ETS1 (ΔETS1) were treated in the absence (non-senescent control (Ctrl)) or presence of LPS for 10 days (LPS-IS). A, we performed IP with IgG control antibody (IgG ctrl) or with ChIP quality antibodies against p-ETS1, p300, and H3K27ac. PCR for the BCL-xL promoter locus was then performed on the IP products. Phospho-ETS1, p300, and H3K27ac ChIP promoted increased BCL-xL amplification in LPS-IS NHC versus Ctrl NHC. PCR amplification of the BCL-xL locus was absent or diminished in LPS-IS ΔETS1 versus LPS-IS NHC. B, qCHIP-PCR for the BCL-xL promoter was also performed using p-ETS1, p300, and H3K27ac antibodies (n = 3). Phospho-ETS1 ChIP promoted increased BCL-xL promoter amplification (∼6.8-fold) in LPS-IS NHC versus Ctrl NHC. LPS-IS ΔETS1 exhibited a 4-fold reduction in BCL-xL promoter amplification compared with LPS-IS NHC. Similarly, qPCR for the BCL-xL promoter from p300 and H3K27AC ChIP products showed increased (∼5.5- and ∼6.8-fold, respectively) in LPS-IS NHC compared with Ctrl NHC, whereas LPS-IS ΔETS1 cells showed decreased (∼2.9- and ∼2.7-fold) amplification of the BCL-xL promoter locus versus LPS-IS NHC (n = 3; *, p < 0.05). C, semiquantitative ChIP-PCR for p-ETS1, p300, and H3K27ac was also performed in Ctrl and LPS-IS cells in both NHC or p300-depleted NHC (p300 shRNA). No difference was observed in BCL-xL promoter amplification following ETS1 ChIP in LPS-IS p300 shRNA cholangiocytes versus LPS-IS NHC. In contrast, BCL-xL promoter amplification was reduced in LPS-IS p300 shRNA versus LPS-IS NHC following p300 and H3K27ac ChIP. D, qCHIP-PCR for the BCL-xL promoter using p-ETS1, p300, and H3K27ac antibodies was also performed (n = 3). qCHIP-PCR of p-ETS1 shows no change (p value = 0.49) in BCL-xL promoter amplification between LPS-IS NHC versus LPS-IS p300 shRNA cells. Both p300 and H3K27ac qChIP-PCR revealed decreased BCL-xL promoter amplification (∼2.6- and ∼2.5-fold, respectively) in LPS-IS p300 shRNA compared with LPS-IS NHC (n = 3; *, p < 0.05).

Depletion of NHC ETS1 prevents senescence-associated BCL-xL expression

To further demonstrate the functional role of ETS1 in cholangiocyte senescence-associated BCL-xL expression, we used ETS1-deficient cultured cholangiocytes. Western blotting demonstrated that ETS1-deficient cholangiocytes exhibited diminished BCL-xL expression and did not show up-regulated BCL-xL expression in our senescent cholangiocyte model, whereas Bcl2 and Mcl1 expression remained unchanged in both NHC- and ETS1-deficient cholangiocytes (Fig. 8, A and B). Quantitative PCR further demonstrated that BCL-xL, but not BCL2 or MCL1, is up-regulated in our senescent cholangiocyte model, but expression is diminished in cells lacking ETS1 (Fig. 8C). Next, we performed BCL-xL promoter luciferase assays in ΔETS1 cholangiocytes. The BCL-xL promoter did not induce luciferase expression in our LPS-induced senescence model in the ΔETS1 cholangiocytes. Moreover, reconstitution of ΔETS1 cholangiocytes with constructs encoding either ETS1 lacking the transactivation domain (ETS-ΔTrans) or a nonphosphorylateable mutant (ETS1-T38A) were resistant to induced senescence-associated BCL-xL promoter luciferase expression (Fig. 8D). In contrast, forced overexpression (OE) of ETS1 induced luciferase expression in NHC with or without LPS treatment, with more robust expression in the LPS-treated (i.e. senescent) NHC (Fig. 8D). These data continue to support that ETS1 is required for the induced expression of BCL-xL in our culture model of senescence.

Figure 8.

Figure 8.

Genomic deletion of ETS1 suppresses BCL-xL expression. A, control cholangiocytes (NHC) or NHC cells stably transfected with a CRISPR/Cas9 double nickase to ETS1 (ΔETS1) were treated in the absence or presence of LPS for 10 days (Ctrl and LPS-IS, respectively). Immunoblotting demonstrated an increase in both ETS1 and BCL-xL in LPS-IS NHC versus Ctrl NHC, but neither protein was detected in Ctrl and LPS-IS ΔETS1 cells. Conversely the prosurvival proteins, BCL2 and MCL1, were not changed. B, semiquantitative densitometry of BCL-xL immunoblots demonstrates an increase in BCL-xL detection in LPS-IS NHC versus Ctrl NHC and a decrease (∼6.5-fold) of BCL-xL in LPS-IS ΔETS1 compared LPS-IS NHC (n = 3). C, quantitative PCR shows increased BCL-xL mRNA in LPS-IS NHC versus Ctrl NHC, and decreased BCL-xL mRNA (∼5.7-fold) in LPS-IS ΔETS1 compared with LPS-IS NHC. BCL2 and MCL1 showed no change in ΔETS1 cells in any of the conditions (n = 3; *, p < 0.05). D, the pGL4.22 (EV) control or the full-length BCL-xL promoter-luciferase construct were transfected into ΔETS1 cells. No increase in luciferase detection over EV control was observed in Ctrl and LPS-IS ΔETS1 cells. Additionally, transfection and forced expression of the phospho-mutant ETS1 (T38A) and the transactivation domain mutant ETS1 (ΔTrans) into ΔETS1 cells showed no responsiveness in both Ctrl and LPS-IS cells (n = 6). Transfection and OE of WT ETS1 in ΔETS1 cells resulted in increased BCL-xL promoter-dependent luciferase detection in both Ctrl ETS1 OE (∼5.4-fold) and LPS-IS OE (∼11-fold) compared with LPS-IS ΔETS1 cells (n = 6; *, p < 0.05).

Deletion of NHC ETS1 prevents senescence-associated NHC apoptosis resistance whereas overexpression of ETS1 or BCL-xL rescues this phenotype

Having demonstrated that ETS1 is required for increased BCL-xL expression in senescent cholangiocytes, we next assessed whether ETS1 and BCL-xL are required for senescent cholangiocyte apoptosis resistance. First, we demonstrated, using ΔETS1 cholangiocytes in our in vitro NHC senescence model, that forced overexpression of ETS1 restored BCL-xL and p-ETS1 expression (Fig. 9A). Using our in vitro senescence model and the caspase-3/7 and annexin V positivity assays, we demonstrated that ΔETS1 cholangiocytes are more susceptible to apoptosis (ΔETS1 transfected with the empty vector (EV)) and that overexpression of ETS1 (ETS1 OE) rescues apoptosis resistance (Fig. 9, B and C). As demonstrated previously, ETS1-deficient cholangiocytes are resistant to induced senescence (18), whereas forced expression of ETS1 in ΔETS1 cholangiocytes promoted senescence as demonstrated by fluorescent β-gal detection and quantification (Fig. 9D). Next, we overexpressed BCL-xL in ΔETS1 cholangiocytes (Fig. 9E). Using our in vitro senescence model and apoptosis assays, we demonstrated that ΔETS1 cholangiocytes transfected with the EV were more susceptible to apoptosis, whereas forced expression of BCL-xL (BCL-xL OE) restores apoptosis resistance, but did not promote senescence (Fig. 9, F–H). Together, these data further support that ETS1 promotes the expression of BCL-xL and is required for cholangiocyte senescence, and that BCL-xL expression is sufficient to promote the apoptotic-resistant phenotype of senescent NHCs.

Figure 9.

Figure 9.

ETS1 and BCL-xL overexpression promote the prosurvival phenotype of LPS-induced senescent cholangiocytes. A, immunoblots demonstrate that transfection and OE of ETS1 rescues the expression of BCL-xL in ΔETS1 cells. Although BCL-xL was detected in Ctrl ETS1 OE cells, it is robustly up-regulated in LPS-IS ETS1 OE cells. Phospho-ETS1 is also expressed in LPS-IS ETS1 OE cells, but was not detected in nonsenescent (Ctrl) ETS1 OE cells. B and C, apoptosis, as measured by caspase-3/7 assay and annexin V staining, is increased (∼4.9- and ∼13.6-fold, respectively) in the EV-transfected LPS-IS ΔETS1 versus LPS-IS NHC (n = 6; *, p < 0.05). Apoptosis, assessed, by both assays, was reduced in cholangiocytes overexpressing ETS1 (ETS1 OE) in ΔETS1 cells (∼7.4- and ∼5.8-fold decrease, respectively) versus EV LPS-IS ΔETS1 (n = 6; *, p < 0.05). D, the senescence marker fluorescent β-gal decreased (∼6.9-fold) in EV LPS-IS ΔETS1 cholangiocytes versus LPS-IS NHC (n = 6). However, senescence increased (∼7-fold) in LPS-IS ΔETS1 cholangiocytes overexpressing ETS1 (ETS1 OE) versus EV-transfected LPS-IS ΔETS1 cholangiocytes (n = 6; *, p < 0.05). E, immunoblots show that transfection and forced overexpression of BCL-xL (BCL-xL OE) in ΔETS1 cells re-establishes BCL-xL expression, but not pETS1, CDKN2A (p16), or CDKN1A (p21) expression. F and G, apoptosis, as measured by caspase-3/7 assay and annexin V staining of cholangiocytes, is increased (∼5.1- and ∼4.9-fold, respectively) in EV-transfected LPS-IS ΔETS1 versus LPS-IS NHC (n = 6). However, apoptosis, as assessed by these methods, was reduced in LPS-IS ΔETS1 overexpressing BCL-xL (BCLXL OE; ∼4.6- and ∼2.2-fold decrease, respectively) versus EV-transfected LPS-IS ΔETS1 (n = 6; *, p < 0.05). H, the senescence marker fluorescent β-gal is decreased (∼6-fold decrease) in EV-transfected ΔETS1 cells compared with LPS-IS NHC. Senescence was slightly increased (∼2.6-fold) in LPS-IS ΔETS1 rescued with BCL-xL OE compared with EV-transfected LPS-IS ΔETS1 (n = 6; *, p < 0.05).

RNAi-induced suppression of BCL-xL in senescent cholangiocytes promotes apoptosis

To further confirm the role of BCL-xL in senescent NHC apoptosis resistance, we transfected NHC with a doxycycline-inducible BCL-xL shRNA. Nonsenescent control or LPS-induced senescent, stably transfected NHC were treated with vehicle or doxycycline at day 10. Doxycycline-induced BCL-xL shRNA effectively depleted BCL-xL in both nonsenescent control and senescent NHC, whereas ETS1 expression was unaffected (Fig. 10A). Caspase 3/7 and annexin V assays demonstrated that doxycycline-induced BCL-xL shRNA expression promoted senescent cholangiocyte apoptosis, but did not induce apoptosis in nonsenescent cells (Fig. 10, B and C). Finally, we used fluorescent β-gal detection to measure NHC senescence. Cholangiocytes stably transfected, but not induced to express the BCL-xL shRNA, maintained the senescent state, whereas cholangiocytes induced to express the BCL-xL shRNA exhibited reduced detection of fluorescent β-gal, likely due to increased apoptosis of senescent cholangiocytes (Fig. 10D). These data further support that the anti-apoptotic mediator, BCL-xL, is essential for the apoptotic-resistant phenotype of senescent cholangiocytes.

Figure 10.

Figure 10.

Inducible BCL-xL–shRNA increased apoptosis and decreased apoptosis resistance. A, doxycycline (Dox)-induced expression of a stably transfected BCL-xL shRNA resulted in decreased BCL-xL protein expression in both LPS-IS and nontreated (Ctrl) cholangiocytes versus non-Dox-treated cells. ETS1 was not affected by the BCL-xL shRNA; β-actin was used as a loading control. B and C, apoptosis, as measured by caspase-3/7 assay and annexin V detection, is increased (∼6.4- and 6.1-fold, respectively) in LPS-IS cholangiocytes following induced BCL-xL-shRNA induction versus LPS-IS cells without shRNA induction (n = 6; *, p < 0.05). D, the senescence marker, fluorescent β-gal, is decreased (∼2.2-fold) in LPS-IS cholangiocytes upon the induction of BCL-xL shRNA expression versus LPS-IS cholangiocytes in the absence of doxycline (n = 6; *, p < 0.05).

Discussion

Our results reveal that ETS1 promotes cholangiocyte resistance to apoptosis by selectively up-regulating transcription of the BCL family member, BCL-xL, providing mechanistic insight into the transcriptional regulation of BCL-xL expression, and the resultant resistance to apoptosis of senescent cholangiocytes (Fig. 11). Our in vivo results demonstrate that BCL-xL is up-regulated in cholangiocytes of human PSC and Mdr2−/− mouse liver. Using an in vitro model of stress-induced cholangiocyte senescence, we further demonstrated that: (i) BCL-xL mRNA and protein is increased and pharmacologic inhibition of RAS/MAPK signaling prevented the senescence-associated expression of BCL-xL; (ii) up-regulated BCL-xL physically interacts with the apoptosis effector proteins BAK and BAX; (iii) ETS1 and the histone acetyltransferase p300 physically interact with each other at the BCL-xL promoter locus, promote H3K27 acetylation and active POLR2 (p-Ser-2) occupation at the BCL-xL locus; (iv) site-directed mutagenesis or deletion of the predicted distal ETS-binding sites within the BCL-xL promoter prevented induced luciferase reporter detection; (v) genetic deletion of ETS1 prevented BCL-xL expression and promoted apoptosis, whereas reconstitution of ETS1 restored BCL-xL expression, senescence, and apoptosis resistance; and (vi) induced suppression of BCL-xL (shRNA) resulted in increased apoptosis and reduced detection of senescence. Moreover, we demonstrated the relevance of our mechanistic in vitro data by demonstrating in vivo, with proximity ligation assays in human PSC tissue, that BCL-xL interaction with BAK and BAX and phospho-ETS1 interaction with p300 are likely increased in cholangiocytes of human PSC tissue. These data show for the first time that cholangiocyte ETS1 and p300-dependent chromatin modification of the BCL-xL promoter locus induces BCL-xL expression, which is required for apoptosis resistance of senescent cholangiocytes in vitro, and this pathway is likely operative in cholangiocytes in PSC liver. Thus, our results provide mechanistic insight into stress-induced (i.e. LPS treatment) senescent cholangiocyte apoptosis resistance, a cellular process that may promote the persistence of senescent cholangiocytes and the potential deleterious consequences of the cholangiocyte SASP in PSC. Hence, this cellular phenotype and the identified pathways may contribute to the pathogenesis of PSC, and are novel potential pharmacologic targets for PSC therapy.

Figure 11.

Figure 11.

Conceptual framework of BCL-xL expression during persistent LPS senescence induction. Persistent cholangiocyte stress results in the activation of NRAS and subsequently the MAPK/ERK signaling pathway. ETS1 is up-regulated, phosphorylated, and translocates to the nucleus. In previous work we demonstrated that pharmacologic inhibition of Ras/MEK/ERK (manumycin A, PD98059, or UO126) and molecular inhibition of ETS1 (Ets1-shRNA) or genetic deletion of ETS1 prevents p16INK4a transcription and senescence (18). Here, we demonstrate that ETS1 recruits the histone acetyltransferase, p300, to the BCL-xL proximal promoter, resulting in H3K27ac, BCL-xL transcription, and ultimately senescence-associated apoptosis resistance, likely via sequestration of BAK and BAX and prevention of MOMP.

The Ets family of transcription factors, including ETS1 and ETS2 are effectors of the RAS/MAPK signaling pathway (3436). Moreover, ETS1 was previously implicated in CDKN2A (p16INK4a) expression and senescence in human diploid fibroblasts (37). Additionally, our previous in vitro and in vivo studies identified ETS1, but not ETS2, as a central mediator of persistent LPS-induced cholangiocyte CDKN2A (p16INK4a) expression and hence, senescence (18). More recently, we demonstrated, in vitro, that the anti-apoptotic protein BCL-xL is up-regulated in irradiation-induced senescent cholangiocytes, and pharmacological inhibition of BCL-xL with the small molecule inhibitor, A1331852, selectively kills cultured senescent cholangiocytes. Moreover, pharmacological inhibition of BCL-xL in the Mdr2−/− mouse with A1331852 diminished the number of senescent cholangiocytes and decreased liver fibrosis (24). However, the molecular mechanisms of BCL-xL up-regulation in senescent cholangiocytes remained unclear and were the focus of our efforts in this manuscript. Although there is no consensus regarding the role of ETS1 in apoptosis regulation, reports have implicated this transcription factor in the induced expression of anti-apoptotic Bcl2 family members (25, 26). Together with our previous data, here we demonstrate that ETS1 not only induces cholangiocyte withdrawal from the cell cycle via p16INK4a expression, but promotes the phenotypic transition to apoptosis resistance via induced expression of BCL-xL.

The B cell lymphoma 2 (BCL2) gene family regulates mitochondrial-dependent apoptosis. This family comprises both pro- and anti-apoptotic members that interact with each other and the mitochondrial membrane to either prevent or promote mitochondrial outer-membrane permeabilization (MOMP). Pro-apoptotic members of this family promote MOMP, which releases several activators of apoptosis into the cytosol. Anti-apoptotic BCL2 proteins (e.g. BCL2 and BCL-xL) antagonize proapoptotic BH3-only proteins (e.g. BID, BIM, and NOXA) or directly sequester the effector proteins, BAK and BAX. Hence, the balance of pro- and anti-apoptotic BCL2 family members determines cell survival or death (22). Although the short-term presence of senescence can be beneficial in certain circumstances, such as embryonic development (38, 39) and wound healing (40), increasing evidence supports that long-term retention of senescent cells can have detrimental effects on tissue health (9, 4143). Apoptosis resistance of senescent cells likely contributes to their long-term retention in tissues in aging animals as well as in senescence-associated disease states. Importantly, we show that BCL-xL physically interacts with the effector proteins, BAK and BAX, in senescent-cultured cholangiocytes and in human PSC. This interaction of BCL-xL with these apoptosis effector proteins prevents BAK and BAX-dependent MOMP, and hence the induction of apoptosis. Collectively, the data support that induced BCL-xL expression promotes apoptosis resistance of senescent cholangiocytes, and apoptotic-resistant senescent cholangiocytes are a prominent feature of PSC. These data also implicate BCL-xL up-regulation and the resultant apoptotic-resistant phenotype of senescent cholangiocytes as potential therapeutic targets for PSC.

Mechanisms promoting senescent cell apoptotic resistance are currently being explored, but these remain unclear and likely differ among cell types (42). Together with our previous finding that targeted killing of senescent cholangiocytes via targeting BCL-xL improved the Mdr2−/− mouse phenotype, our work presented here implicating ETS1 in the up-regulation of BCL-xL, is the only information regarding apoptosis resistance in senescent cholangiocytes. We demonstrated the transition from repressive to permissive chromatin at the BCL-xL promoter over time in our culture model of senescence. The histone acetyltransferase, p300, and its paralogue, CREB-binding protein (CREBBP, CBP), modulate locus-specific transcription via direct lysine acetyltransferase catalytic activity, and acetylation of histones, promoting accessibility for the transcription apparatus. Our current data demonstrates not only the accumulation of ETS1 and the transcriptional co-activator, p300, to the BCL-xL promoter locus, but the likely physical interaction of these transcriptional regulators. Although the physical interaction between phospho-ETS1 and p300 has been described previously (44, 45), as has the likely requirement of ETS1 for the occupancy of CBP at enhancer regions in activated T-cells (39), our data presented herein suggests that ETS1 directs p300 to the BCL-xL locus during senescence induction. Indeed, genetic depletion of ETS1 prevented the accumulation of p300 at the BCL-xL locus; conversely, depletion of p300 did not prevent ETS1 accumulation. Therefore, the activation of a Ras-responsive transcription factor, ETS1, and the interaction of this transcription factor at specific sites in the genome, may promote loci-specific chromatin modification and gene expression via recruitment of p300. It should be noted that not every cholangiocyte in the PSC patient liver tissue revealed positivity for the PLA products demonstrating BCL-xL:BAK/BAX or ETS1:p300 proximity. This outcome likely reflects the heterogeneity of the cholangiocytes, and the presence of both senescent and nonsenescent cells within bile ducts (14). Although not addressed in this manuscript, the concept of ETS1 promoting global transcriptional modification during cholangiocyte senescence via recruitment of chromatin-modifying enzymes to specific loci merits further investigation as does the question of why some cholangiocytes transition to a senescent phenotype, whereas others do not.

Senescent cells frequently transition to the SASP, a potentially pathologic state of proinflammatory cytokine, chemokine, and growth factor hypersecretion (15). Surprisingly, we previously demonstrated that cells lacking ETS1 express increased expression of the SASP-associated components, interleukin 6 and interleukin 8, both in the presence and absence of LPS (18). We propose that whereas ETS1 is essential for senescence induction and the apoptotic-resistant phenotype via up-regulated gene expression, this transcription factor may function as a negative regulator of cholangiocyte proinflammatory cytokine production. Hence, cholangiocyte senescence, apoptosis resistance, and SASP are regulated by ETS1-dependent gene expression regulation via distinct mechanisms. We are actively interrogating this interesting observation in additional model systems and via unbiased RNAseq and ChIPseq studies in senescent versus nonsenescent cholangiocytes.

In summary, we have defined a mechanism regulating the apoptotic- resistant phenotype of LPS-induced cholangiocyte senescence in vitro and provided compelling evidence for the function of this pathway in human and animal models of PSC. Our findings support the central role of ETS1 not only in senescence via the regulated expression of CDKN2A (18), but also in the apoptosis-resistant phenotype of senescent cholangiocytes via up-regulated BCL-xL expression. These insights provide a better mechanistic understanding of the relationship between cholangiocyte senescence and the cholangiopathies, and identify targets for molecular interventions including pathways (RAS/MAPK), transcriptional regulators (ETS1/p300), and phenotypic features (apoptosis resistance via up-regulated BCL-xL) to selectively prevent or eliminate senescent cholangiocytes (senolytics) as a therapeutic approach for PSC. Moreover, these observations may be generalizable to other progressive, fibroinflammatory diseases especially those that implicate cellular senescence in pathogenesis, for example, idiopathic pulmonary fibrosis (10).

Experimental procedures

This study was approved by the Mayo Clinic Institutional Review Board and abides by the Declaration of Helsinki principles. The Mayo Clinic Institutional Animal Care and Use Committee also approved this study.

Liver tissues

Upon Institutional Animal Care and Use Committee approval, C57bl6 background Mdr2−/− mice and C57bl6 WT mice were housed at the Mayo Clinic animal care facility with a standard 12:12 h light/dark cycle and ad libitum access to water and standard rodent diet.

Following IRB approval, human PSC patient samples, which fulfilled clinical, serological, histological, and/or cholangiographic criteria for stage IV PSC, were obtained at the time of transplant. Normal liver samples from surgical resection or explant were also utilized. Liver specimens were fixed in 10% neutral buffered formalin, embedded in paraffin, and sectioned (4 μm) for immunofluorescence.

Immunofluorescence

Briefly, tissue sections were deparaffinized in xylene and rehydrated through a series of increasing ethanol dilutions. An antigen retrieval step was performed by immersing slides in boiling sodium citrate buffer (pH 6.0) for 10 min. Slides were then washed in buffer containing Tris base, NaCl, and Triton X-100, blocked in 4% BSA solution, and incubated with primary antibodies to BCL-xL (54H6, Cell Signaling) and CK19 (Santa Cruz Biotechnology) overnight at 4 °C. After primary incubation, slides were washed in PBS and incubated with Alexa Fluor secondary antibodies (Life Technologies) for 30 min at room temperature. Slides were washed again in PBS and mounted using Prolong-Gold Antifade with DAPI (Life Technologies). Slides were analyzed using a Zeiss 780 Laser Scanning Confocal Microscope.

Cell culture and in vitro model of senescence

The well-characterized normal human cholangiocyte (NHC) cell line derived from normal liver was provided by Dr. Medina (University of Navarra, Pamplona, Spain) (46). The NHC cells were routinely monitored for mycoplasma by using the Lonza MycoAlertTM and culturing the cells in the presence of Primocin (Invivogen). Our in vitro model of senescence was performed as previously described (14, 18).

Total RNA extraction and quantitative RT-PCR

TRIzol (Invitrogen) was used to extract total RNA from the NHC cells according to the manufacturer's protocol. Following RNA extraction, 2.0 μg of total RNA was used as template for reverse transcription using the SuperScript III First Strand Synthesis system (Invitrogen) according to the manufacturer's directions. The cDNA was then used as template for PCR amplification (primers listed in Table 1), mixed with the Rotor-Gene SYBR Green PCR Master Mix (Qiagen), and analyzed with the Rotor-gene quantitative PCR instrument (Qiagen). All qPCR samples were normalized to 18s RNA.

Table 1.

Primer sequences

Gene-specific primers Sequences (5′ to 3′)
qPCR primer
    BCL-xL fwd AAAAGATCTTCCGGGGGCTG
    BCL-xL rev CCCGGTTGCTCTGAGACATT
    BCL2 fwd GGGAGGATTGTGGCCTTCTT
    BCL2 rev GGGCCAAACTGAGCAGAGTC
    MCL1 fwd TTCCAGTAAGGAGTCGGGGT
    MCL1 rev CTCCCCTCCCCCTATCTCTC
    BCL2A1 fwd AAATTGCCCCGGATGTGGAT
    BCL2A1 rev ACAAAGCCATTTTCCCAGCCT
    Bid fwd CATGGACCGTAGCATCCCT
    Bid rev AGCACCAGCATGGTCTTCTC
    Bad fwd TGTTCCAGATCCCAGAGTTTG
    Bad rev GGTAGGAGCTGTGGCGACT
    Bax fwd TTTCTGACGGCAACTTCAACT
    Bax rev GTGAGGAGGCTTGAGGAGTCT
    Bak fwd TCCTCCACTGAGACCTGAAAA
    Bak rev GTTGCAGAGGTAAGGTGACCA
    Bik fwd GCCCACCAAGAGCCATTCAC
    Bik rev ATTGAGCACTCCTGCTCCTC
    NOXA fwd CTGTGTGAAGAGCCCGATGT
    NOXA rev TTAGGGCTGATCTCCCTGCT
    PUMA fwd ACTCACCAAACCAGAGCAGG
    PUMA rev CTCCCTGGGGCCACAAATC
    CDKN2A fwd CAGCATGGAGCCTTCGGCTGAC
    CDKN2A rev AGTCAGCCGAAGGCTCCAT
    CDKN1A fwd AGTCAGTTCCTTGTGGAGCC
    CDKN1A rev CATTAGCGCATCACAGTCGC
BCL-xL promoter luciferase primers
    Full-length fwd gtagctagcAGAGCTCTTGCGTCTGGAAG
    Full-length rev cgaaagcttCCCCCGTCTTCTCCGAAATG
    Mutagenesis 1 (Δ1) fwd CTCGACCCCT[b]GGTCCTGACCTGAGGAGAGGC
    Mutagenesis 1 (Δ1) rev GCCTGCTCGACGGCCCCA
    Mutagenesis 2 (Δ2) fwd AGGGGGCTGG[b]CGCCTGAGCTTC
    Mutagenesis 2 (Δ2) rev CGCTTGCTTCCTCCTCCA
    Mutagenesis 3 (Δ3) fwd AAAAGATCTT[b]TAACGGGCTGCACC
    Mutagenesis 3 (Δ3) rev GTATCACAGGTCGGGAGA
ChIP primers
    BCL-xL fwd CCTGGGCTGGTGCTTAAATA
    BCL-xL rev GAATTGCGAAGCTCAGGAAC
    Core promoter fwd GCTTCGCAATTCCTGTGTCG
    Core promoter rev CTCGGAAAGTCACTCCCTGG

Protein isolation and Western blotting

Protein lysate was harvested from NHC cells using the Mammalian Protein Extraction Reagent (M-PER) (Roche) containing cOmplete ULTRA Tablets, Mini, Protease Inhibitor Mixture Tablet (Roche), and PhosSTOP Phosphatase Inhibitor Mixture Tablet (Roche) in 10 ml of M-PER reagent. Protein lysate was subjected to electrophoresis on SDS-PAGE gels and transferred to nitrocellulose membranes. After blocking in 5% milk or 5% BSA, the membranes were incubated with primary antibodies at 1:1000 dilution and incubated overnight at 4 °C. The following primary antibodies used: Bcl2L1, Bcl2, Mcl1, Bcl2A1, and ActB (Sc-1615; Santa Cruz Biotechnology); Bax (clone D2E11; 5023), Bik (4592), Bim (clone C34C5; 2933), Bid (human specific; 2002), Bad (clone D24A9; 9239), Noxa (clone D8L7U; 147667), Puma (clone D30C10; 12450), and Bak (clone D4E4; 12105; Cell Signaling); phosphorylated-p16INK4a (ab135552), phosphorylated-ETS1 (ab59179), p21 (ab7960–1; Abcam), and p16 (clone G175-405; 550834; BD Biosciences). The membranes were washed and incubated with secondary antibodies conjugated to HRP (1:2000 dilution, Cell Signaling). Western blotting bands were detected using Enhanced Chemiluminescent plus detection system (ECL Plus; Promega).

Cloning of the BCL-xL promoter luciferase construct

Genomic DNA was extracted from NHC cells using the DNA Blood and Cell Culture DNA Midi Kit (Qiagen) according the manufacturer's protocol. PCR was performed using the primer pairs found in Table 1 that contain a NheI restriction enzyme site in the forward primer (underlined) and a HindIII site in the reverse primer (bold type). The reverse primer was used in the generation of all the constructs. Following PCR amplification (95 °C for 10 min; 30 cycles of 95 °C for 30 s and 55 °C for 60 s; and 72 °C for 30 s) the PCR amplicons were digested with NheI and HindIII, electrophoresed, and gel-purified by QIAquick gel extraction kit (Qiagen). These digested inserts were then ligated into the XhoI- and HindIII-linearized pGL4.22 luciferase plasmid (Promega). To obtain the ETS1 site-directed mutagenesis (SDM) clones in the BCLXL promoter, we used a Q5 SDM kit (New England BioLabs). Briefly, PCR primers were designed using the NEBaseChanger (New England BioLabs) algorithm. The ΔSDM constructs deleted 2–3 bp within the three putative Ets1-binding sites containing the GGAA motif (−861 bp (Δ1), −314 bp Δ2, 167 bp (Δ3)). Primers used for SDM are found in Table 1 with mutated nucleotides underlined and in bold. PCR for the site-directed mutants was carried out using the following parameters: 98 °C for 10 s, 25 cycles of 98 °C for 10 s, 72 °C (Δ1) or 68 °C (Δ2) or 68 °C (Δ3) for 60 s, 72 °C for 3 min, and 72 °C for 30 s. The Δ2 SDM construct was then used as template for Δ1/2 SDM and Δ2/3 SDM by targeting the Δ1 ETS1 or Δ3 ETS1 sites as above, respectively. The Δ1 SDM construct was then used as template for Δ1/3 SDM by targeting the Δ3 ETS1; finally, the Δ1/2 SDM plasmid was used as template and Δ3 ETS1 was targeted by SDM for the Δ1/2/3 ETS1 plasmid construct. DNA sequencing was performed on all plasmid constructs at the Mayo Clinic DNA Sequencing Core Facility.

Transfection and generation of stable cell lines

NHCs were transfected with EV-pGL4.22, full-length (FL) BCLXLprom-pGL4.22, BCLXLprom (Δ1 ETS1)-pGL4.22, BCLXLprom (Δ2 ETS1)-pGL4.22, BCLXLprom (Δ3 ETS1)-pGL4.22, BCLXLprom (Δ1/2 ETS1)-pGL4.22, BCLXLprom (Δ1/3 ETS1)-pGL4.22, BCLXLprom (Δ2/3 ETS1)-pGL4.22, and BCLXLprom (Δ1/2/3 ETS1)-pGL4.22. To achieve an inducible BCLXL shRNA cell line under the regulation of doxycycline, we transfected NHC cells with a BCLXL SMARTvector Inducible shRNA (Dharmacon). The NHC cells were grown to 60% confluence the day of transfection in a 6-well plate. FuGENE HD (Promega) was used for the transfections based on the manufacturer's directions. Briefly, 2 μg of plasmid DNA was added to 100 μl of Opti-MEM (Promega) low-serum transfection media. Subsequently 8 μl of FuGENE HD was added to the mix to achieve a 4:1 (FuGENE HD:DNA) ratio. The transfection mix was allowed to incubate for 15 min at room temperature and was added to the NHC cells in H69 medium. Twenty-four hours following transfection, the media was replaced with H69 media containing 1.5 μg/ml of puromycin (Invitrogen). After 1 week of selection, only the selected cells remained viable, and the puromycin was removed from the cells and replaced with H69 media. To induce expression of the BCLXL shRNA, doxycycline (1 μg/ml) was added to the media.

Promoter luciferase assay

CDKN2A promoter luciferase constructs and TK-Renilla (Promega), an internal control, were cotransfected into NHC cells using FuGENE HD (Promega) when the cultured cells were 25% confluent. As a baseline control, EV pGL4.22 was cotransfected with TK-Renilla. After transfections, we utilized our in vitro model of senescence while changing the media every 48 h. At the end of the incubation, we used the Dual-Luciferase Reporter Assay System (Promega) to measure the BCLXL promoter-driven firefly luciferase and Renilla luciferase. The values are expressed as fold-change between the relative CDKN2A promoter-driven firefly luciferase to control Renilla luciferase compared with pGL4.22 empty vector firefly luciferase to Renilla luciferase.

ChIP-PCR

ChIP was performed according to the Abcam cross-linking ChIP protocol. Briefly, NHCs were treated with or without LPS using our in vitro model of senescence protocol. The cells were incubated at room temperature for 10 min with formaldehyde to cross-link the proteins to genomic DNA, and glycine was added at a final concentration of 125 mm to terminate the cross-linking reaction. The cells were then scraped, lysed, and subsequently sheared with a sonicator to generate genomic DNA fragments ranging in length from 500 to 1000 bp. An aliquot of this lysate was stored as “input” DNA and the remainder of the lysate was immunoprecipitated. Immunoprecipitations were performed with the following antibodies: anti-ETS1 (Thr(P)-38, AB59179; Abcam), EP300 (AB14984; Abcam), anti-RNA POLR2 (Ser(P)-2, MABE953; Millipore), and H3K27ac (39685; Active Motif). Upon completion of the immunoprecipitation, the lysate cross-links we reversed and elutions were purified using Chromatin IP DNA Purification Kit (Active Motif). The DNA from the ChIP was used as template for the respective PCR amplifications and the appropriate primers are shown in Table 1. For block PCR, a GeneAmp PCR System 9700 (PE Applied Biosystems) was utilized and the resulting amplicons were resolved on a 1.5% agarose gel stained with ethidium bromide. Quantitative PCR was performed in a Rotor-Gene Q (Qiagen) system using Rotor-Gene SYBR Green master mix (Qiagen) according to manufacturer's directions.

Histone acetyltransferase activity assay

To measure the histone acetyltransferase activity, we used a HAT activity kit (ScienCell). This assay is based on the acetylation of a peptide substrate by cellular HATs and the subsequent release of CoA. CoA serves as a coenzyme of a NADH-generating enzyme to produce NADH. The NADH stoichiometry is spectrophotometrically quantified following the reaction with tetrazolium-1 (WST-1). The protocol was followed according to the manufacturer's directions. Briefly, 10 μl of cell lysate was serial diluted on a 96-well plate. A blank consisting of 10 μl of HAT assay buffer and 5 μl of HAT positive control diluted with 5 μl of HAT assay buffer was added onto the plate.

For each well of reaction, we prepared a working reagent by mixing 39 μl of HAT assay buffer, 10 μl of 1× developer solution, 1 μl of NADH generating enzyme, 10 μl of WST-1 solution, 10 μl of substrate I, 10 μl of substrate II, and 10 μl of cofactors. Then we added 90 μl of working reagent mix into each well of the 96-well plate containing the test samples, HAT positive control, and blank. The reagent was mixed well and recorded every 5 min at OD440 nm for a total of 25 min. The HAT activity was calculated using the manufacturer's provided equation.

SA-β-galactosidase staining

Senescence-associated β-gal activity is a widely used biomarker to detect senescent cells in culture and tissues (47, 48). Cells grown in 6-well plates were washed, fixed, and stained using the SA-β-gal staining kit (Cell Biolabs) according to the manufacturer's directions. The percentage of senescent cells was determined for each condition using a ×20 objective and bright field illumination of no fewer than five randomly selected areas (14). Alternatively, using a SA-β-gal fluorescent staining kit (Cell Biolabs), which allows for the detection of cellular senescence by measuring SA-β-Gal activity using a fluorometric substrate. The staining was performed according to manufacturer's directions and fluorescence was read with a fluorescence plate reader at OD360 nm (excitation)/OD465 nm (emission).

qRT-PCR

mRNA analysis was performed using the Light Cycler Fast Start DNA Master Plus SYBR Green I kit (Roche) as previously described. Primer sequences used are provided in Table 1. Samples were normalized to 18s rRNA. qRT-PCR was performed using the Light Cycler Fast Start DNA Master plus SYBR Green I kit (Roche) as previously described. Samples were normalized to 18s rRNA.

Caspase 3/7 apoptosis assays

Apoptosis was assessed biochemically by measuring caspase-3/7 activity in cell cultures using the Apo-ONE homogeneous caspase-3/7 kit (Promega) following the supplier's instructions. Briefly, the NHC cells plus/minus senescence were grown in black 96-well plates. TRAIL (20 ng/ml, R & D Systems) and/or Z-VAD-FMK (10 μm, R & D Systems) were added to the cultured cells for 24 h. Next, 100 μl of Apo-ONE® caspase-3/7 reagent was added including the blank and the reaction was incubated for 2 h at 37 °C. Finally following the incubation, fluorescence was measured using a spectrofluorometer at an excitation wavelength 485 nm and an emission wavelength range of 530 nm.

Immunoprecipitations

Immunoprecipitation was performed as previously reported (17). Briefly, total protein was extracted from nonsenescent and LPS-induced senescent cholangiocytes. Lysates were pre-cleared with Protein A/G-Sepharose beads (Santa Cruz) at 4 °C and incubated with BAK (AB1, clone TC-100 Millipore Sigma), BAX (clone 6A7, Invitrogen), BCLXL (54H6, Cell Signaling), P300 (SC-48343 AC, Santa Cruz), or ETS1 (SC-55581 AC, Santa Cruz) antibodies overnight at 4 °C. Both the BAK and BAX antibodies recognize only the activated forms of the molecule under nondenaturing, native conditions (49, 50). Protein A/G-Sepharose beads were added to the samples, centrifuged, washed either in ice-cold CHAPS IP buffer (BAK/BCLXL and BAX/BCLXL IPs; 0.3% CHAPS, 40 mm Hepes, pH 7.5, 120 mm NaCl, 1 mm EDTA, 10 mm pyrophosphate and protease/phosphatase inhibitors (Pierce)), or RIPA IP buffer (p300/ETS1 IPs; 150 mm NaCl, 1% Nonidet P-40, 0.5% sodium deoxycholate, 0.1% SDS, 25 mm Tris) and resuspended in Laemmli sample buffer.

PLA

PLAs were performed as an approach to determine protein-protein interactions in vivo. The Sigma Doulink PLA kit was used to detect interactions between ETS1 and p300 and BCLXL with BAK or BAX. The PLA's were performed according to manufacturer's directions using from normal or PSC human and WT or Mdr2−/− mouse paraffin sections. The following primary antibodies were used for the PLA assays; mouse monoclonal p300 antibody (AB54984; Abcam) and rabbit phosphor-T38 ETS1 (AB59179, Abcam) and rabbit BCLXL (54H6, Cell Signaling) and mouse monoclonal BAX (clone 6A7, Invitrogen) or BAK (AB1, clone TC-100, CalBiochem). After washing the slides, mouse-minus and rabbit-plus were incubated to the slides for 60 min at 37 °C. Next the ligase was diluted 1:40 and incubated for 30 min at 37 °C. Again washes were performed; polymerase was diluted 1:80 and incubated for 100 min at 37 °C. The slides were washed 2 × 10 min in 1× wash buffer B and washed for 1 min with 0.01× wash buffer B prior to mounting the samples with Duolink in situ mounting medium with DAPI. For dual PLA and Lamin A immunofluorescence, prior to mounting, the slides were washed 1× with PBS, blocked with 3% BSA, and incubated with a primary antibody to Lamin A (133A2, Cell Signaling). After primary incubation, slides were washed in PBS and incubated with Alexa Fluor secondary antibody (Life Technologies) for 30 min at room temperature. Slides were washed again in PBS and mounted. The slides were analyzed using a Zeiss 780 laser scanning confocal microscope.

Statistical analysis

All data are reported as the mean (or fold-change in mean) ± S.D. from a minimum of three independent experiments. Statistical analyses were performed with Student's t test or analysis of variance when appropriate. p < 0.05 was considered statistically significant.

Author contributions

S. P. O., P. L. S., M. E. G., G. J. G., and N. F. L. conceptualization; S. P. O. data curation; S. P. O., M. S. A. S., and N. N.-G. formal analysis; S.P. O. and N. F. L. supervision; S. P. O., P. L. S., C. E. T., N. P. S., M. S. A. S., N. N.-G., and D. S. investigation; S. P. O. writing-original draft; S. P. O. project administration; P. L. S., C. E. T., N. P. S., M. S. A. S., and D. S. methodology; P. L. S., C. E. T., M. E. G., G. J. G., and N. F. L. writing-review and editing; N. F. L. funding acquisition.

Supplementary Material

Supporting Information

Acknowledgments

We thank Dr. Steven A. Johnsen for his encouragement and critical reading of the manuscript and we acknowledge D. Hintz for assistance in preparation of the manuscript.

This work was supported by National Institutes of Health Grant DK57993 (to N. F. L), the Mayo Foundation, the Clinical and Optical Microscopy Cores of the Mayo Clinic Center for Cell Signaling in Gastroenterology Grant P30DK084567, and The Chris M. Carlos and Catharine Nicole Jockisch Carlos Endowment Fund in Primary Sclerosing Cholangitis (PSC). The authors declare that they have no conflicts of interest with the contents of this article. The content is solely the responsibility of the authors and does not necessarily represent the official views of the National Institutes of Health.

This article contains Figs. S1 and S2.

4

Please note that the JBC is not responsible for the long-term archiving and maintenance of this site or any other third party hosted site.

3
The abbreviations used are:
PSC
primary sclerosing cholangitis
Ets
V-Ets avian erythroblastosis virus E26 oncogene homolog 1
EP300
E1A-binding protein p300
BCL2L1
BCL2-like 1
SASP
senescence-associated secretory phenotype
LPS
lipopolysaccharide
H3K27Ac
histone 3 lysine 27 acetylation
SA-β-gal
senescence-associated β-galactosidase
PLA
proximity ligation assay
qPCR
quantitative PCR
PCNA
proliferating cell nuclear antigen
β-gal
β-galactosidase
fmk
fluoromethyl ketone
POLR2
RNA polymerase 2
DAPI
4′,6-diamidino-2-phenylindole
EV
empty vector
FL
full-length
OE
overexpression
shRNA
short hairpin RNA
MOMP
mitochondrial outer-membrane permeabilization
BCL2
B cell lymphoma 2
CREB
cAMP-response element-binding protein
NHC
normal human cholangiocyte
SDM
site-directed mutagenesis
HAT
hypoxanthine/aminopterin/thymidine medium
IP
immunoprecipitation
LPS-IS
LPS-induced senescence
Ctrl
control.

References

  • 1. Lazaridis K. N., and LaRusso N. F. (2016) Primary sclerosing cholangitis. N. Engl. J. Med. 375, 1161–1170 10.1056/NEJMra1506330 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2. Tabibian J. H., and Lindor K. D. (2013) Primary sclerosing cholangitis: a review and update on therapeutic developments. Expert Rev. Gastroenterol. Hepatol. 7, 103–114 10.1586/egh.12.80 [DOI] [PubMed] [Google Scholar]
  • 3. Farrant J. M., Hayllar K. M., Wilkinson M. L., Karani J., Portmann B. C., Westaby D., and Williams R. (1991) Natural history and prognostic variables in primary sclerosing cholangitis. Gastroenterology 100, 1710–1717 10.1016/0016-5085(91)90673-9 [DOI] [PubMed] [Google Scholar]
  • 4. Campisi J., and d'Adda di Fagagna F. (2007) Cellular senescence: when bad things happen to good cells. Nat. Rev. Mol. Cell Biol. 8, 729–740 10.1038/nrm2233 [DOI] [PubMed] [Google Scholar]
  • 5. Mao Z., Ke Z., Gorbunova V., and Seluanov A. (2012) Replicatively senescent cells are arrested in G1 and G2 phases. Aging (Albany, NY) 4, 431–435 10.18632/aging.100467 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6. Armanios M. Y., Chen J. J., Cogan J. D., Alder J. K., Ingersoll R. G., Markin C., Lawson W. E., Xie M., Vulto I., Phillips J. A. 3rd, Lansdorp P. M., Greider C. W., and Loyd J. E. (2007) Telomerase mutations in families with idiopathic pulmonary fibrosis. N. Engl. J. Med. 356, 1317–1326 10.1056/NEJMoa066157 [DOI] [PubMed] [Google Scholar]
  • 7. Burton D. G. (2009) Cellular senescence, ageing and disease. Age (Dordr) 31, 1–9 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8. Hecker L., Logsdon N. J., Kurundkar D., Kurundkar A., Bernard K., Hock T., Meldrum E., Sanders Y. Y., and Thannickal V. J. (2014) Reversal of persistent fibrosis in aging by targeting Nox4-Nrf2 redox imbalance. Sci. Transl. Med. 6, 231ra247 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9. Tchkonia T., Morbeck D. E., Von Zglinicki T., Van Deursen J., Lustgarten J., Scrable H., Khosla S., Jensen M. D., and Kirkland J. L. (2010) Fat tissue, aging, and cellular senescence. Aging Cell 9, 667–684 10.1111/j.1474-9726.2010.00608.x [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10. Schafer M. J., White T. A., Iijima K., Haak A. J., Ligresti G., Atkinson E. J., Oberg A. L., Birch J., Salmonowicz H., Zhu Y., Mazula D. L., Brooks R. W., Fuhrmann-Stroissnigg H., Pirtskhalava T., Prakash Y. S., et al. (2017) Cellular senescence mediates fibrotic pulmonary disease. Nat. Commun. 8, 14532 10.1038/ncomms14532 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11. Anderson R., Lagnado A., Maggiorani D., Walaszczyk A., Dookun E., Chapman J., Birch J., Salmonowicz H., Ogrodnik M., Jurk D., Proctor C., Correia-Melo C., Victorelli S., Fielder E., Berlinguer-Palmini R., et al. (2019) Length-independent telomere damage drives post-mitotic cardiomyocyte senescence. EMBO J. 38, e100492 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12. Jeyapalan J. C., and Sedivy J. M. (2008) Cellular senescence and organismal aging. Mech. Ageing Dev. 129, 467–474 10.1016/j.mad.2008.04.001 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13. Victorelli S., and Passos J. F. (2017) Telomeres and cell senescence: size matters not. EBioMedicine 21, 14–20 10.1016/j.ebiom.2017.03.027 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14. Tabibian J. H., O'Hara S. P., Splinter P. L., Trussoni C. E., and LaRusso N. F. (2014) Cholangiocyte senescence by way of N-ras activation is a characteristic of primary sclerosing cholangitis. Hepatology 59, 2263–2275 10.1002/hep.26993 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15. Coppé J. P., Patil C. K., Rodier F., Sun Y., Munoz D. P., Goldstein J., Nelson P. S., Desprez P. Y., and Campisi J. (2008) Senescence-associated secretory phenotypes reveal cell-nonautonomous functions of oncogenic RAS and the p53 tumor suppressor. PLos Biol. 6, 2853–2868 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16. O'Hara S. P., Splinter P. L., Trussoni C. E., Gajdos G. B., Lineswala P. N., and LaRusso N. F. (2011) Cholangiocyte N-Ras protein mediates lipopolysaccharide-induced interleukin 6 secretion and proliferation. J. Biol. Chem. 286, 30352–30360 10.1074/jbc.M111.269464 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17. Trussoni C. E., Tabibian J. H., Splinter P. L., and O'Hara S. P. (2015) Lipopolysaccharide (LPS)-induced biliary epithelial cell NRas activation requires epidermal growth factor receptor (EGFR). PLoS ONE 10, e0125793 10.1371/journal.pone.0125793 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18. O'Hara S. P., Splinter P. L., Trussoni C. E., Pisarello M. J., Loarca L., Splinter N. S., Schutte B. F., and LaRusso N. F. (2017) ETS proto-oncogene 1 transcriptionally up-regulates the cholangiocyte senescence-associated protein cyclin-dependent kinase inhibitor 2A. J. Biol. Chem. 292, 4833–4846 10.1074/jbc.M117.777409 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19. Wang E. (1995) Senescent human fibroblasts resist programmed cell death, and failure to suppress bcl2 is involved. Cancer Res. 55, 2284–2292 [PubMed] [Google Scholar]
  • 20. Yosef R., Pilpel N., Tokarsky-Amiel R., Biran A., Ovadya Y., Cohen S., Vadai E., Dassa L., Shahar E., Condiotti R., Ben-Porath I., and Krizhanovsky V. (2016) Directed elimination of senescent cells by inhibition of BCL-W and BCL-XL. Nat. Commun. 7, 11190 10.1038/ncomms11190 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21. Zhu Y., Doornebal E. J., Pirtskhalava T., Giorgadze N., Wentworth M., Fuhrmann-Stroissnigg H., Niedernhofer L. J., Robbins P. D., Tchkonia T., and Kirkland J. L. (2017) New agents that target senescent cells: the flavone, fisetin, and the BCL-XL inhibitors, A1331852 and A1155463. Aging (Albany, NY) 9, 955–963 10.18632/aging.101202 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22. Adams J. M., and Cory S. (2007) Bcl-2-regulated apoptosis: mechanism and therapeutic potential. Curr. Opin. Immunol. 19, 488–496 10.1016/j.coi.2007.05.004 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23. Wang C., and Youle R. J. (2009) The role of mitochondria in apoptosis. Annu. Rev. Genet 43, 95–118 10.1146/annurev-genet-102108-134850 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24. Moncsek A., Al-Suraih M. S., Trussoni C. E., O'Hara S. P., Splinter P. L., Zuber C., Patsenker E., Valli P. V., Fingas C. D., Weber A., Zhu Y., Tchkonia T., Kirkland J. L., Gores G. J., Müllhaupt B., LaRusso N. F., and Mertens J. C. (2018) Targeting senescent cholangiocytes and activated fibroblasts with B-cell lymphoma-extra large inhibitors ameliorates fibrosis in multidrug resistance 2 gene knockout (Mdr2(−/−)) mice. Hepatology 67, 247–259 10.1002/hep.29464 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25. Li R., Pei H., Watson D. K., and Papas T. S. (2000) EAP1/Daxx interacts with ETS1 and represses transcriptional activation of ETS1 target genes. Oncogene 19, 745–753 10.1038/sj.onc.1203385 [DOI] [PubMed] [Google Scholar]
  • 26. Yu Z., and Shah D. M. (2007) Curcumin down-regulates Ets-1 and Bcl-2 expression in human endometrial carcinoma HEC-1-A cells. Gynecol. Oncol. 106, 541–548 10.1016/j.ygyno.2007.05.024 [DOI] [PubMed] [Google Scholar]
  • 27. Guicciardi M. E., Malhi H., Mott J. L., and Gores G. J. (2013) Apoptosis and necrosis in the liver. Compr. Physiol. 3, 977–1010 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28. Kurita S., Mott J. L., Cazanave S. C., Fingas C. D., Guicciardi M. E., Bronk S. F., Roberts L. R., Fernandez-Zapico M. E., and Gores G. J. (2011) Hedgehog inhibition promotes a switch from type II to type I cell death receptor signaling in cancer cells. PLoS ONE 6, e18330 10.1371/journal.pone.0018330 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29. Kale J., Osterlund E. J., and Andrews D. W. (2018) BCL-2 family proteins: changing partners in the dance towards death. Cell Death Differ. 25, 65–80 10.1038/cdd.2017.186 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30. Rosenbloom K. R., Armstrong J., Barber G. P., Casper J., Clawson H., Diekhans M., Dreszer T. R., Fujita P. A., Guruvadoo L., Haeussler M., Harte R. A., Heitner S., Hickey G., Hinrichs A. S., Hubley R., et al. (2015) The UCSC genome browser database: 2015 update. Nucleic Acids Res. 43, D670–D681 10.1093/nar/gku1177 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31. Kent W. J., Sugnet C. W., Furey T. S., Roskin K. M., Pringle T. H., Zahler A. M., and Haussler D. (2002) The human genome browser at UCSC. Genome Res. 12, 996–1006 10.1101/gr.229102 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32. Kent W. J. (2002) BLAT: the BLAST-like alignment tool. Genome Res. 12, 656–664 10.1101/gr.229202 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33. Wei G. H., Badis G., Berger M. F., Kivioja T., Palin K., Enge M., Bonke M., Jolma A., Varjosalo M., Gehrke A. R., Yan J., Talukder S., Turunen M., Taipale M., Stunnenberg H. G., et al. (2010) Genome-wide analysis of ETS-family DNA-binding in vitro and in vivo. EMBO J. 29, 2147–2160 10.1038/emboj.2010.106 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34. Cho M. C., Choi H. S., Lee S., Kim B. Y., Jung M., Park S. N., and Yoon D. Y. (2008) Epiregulin expression by Ets-1 and ERK signaling pathway in Ki-ras-transformed cells. Biochem. Biophys. Res. Commun. 377, 832–837 10.1016/j.bbrc.2008.10.053 [DOI] [PubMed] [Google Scholar]
  • 35. Hollenhorst P. C. (2012) RAS/ERK pathway transcriptional regulation through ETS/AP-1 binding sites. Small GTPases 3, 154–158 10.4161/sgtp.19630 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36. Plotnik J. P., Budka J. A., Ferris M. W., and Hollenhorst P. C. (2014) ETS1 is a genome-wide effector of RAS/ERK signaling in epithelial cells. Nucleic Acids Res. 42, 11928–11940 10.1093/nar/gku929 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37. Ohtani N., Zebedee Z., Huot T. J., Stinson J. A., Sugimoto M., Ohashi Y., Sharrocks A. D., Peters G., and Hara E. (2001) Opposing effects of Ets and Id proteins on p16INK4a expression during cellular senescence. Nature 409, 1067–1070 10.1038/35059131 [DOI] [PubMed] [Google Scholar]
  • 38. Muñoz-Espin D., Canamero M., Maraver A., Gómez-López G., Contreras J., Murillo-Cuesta S., Rodríguez-Baeza A., Varela-Nieto I., Ruberte J., Collado M., and Serrano M. (2013) Programmed cell senescence during mammalian embryonic development. Cell 155, 1104–1118 10.1016/j.cell.2013.10.019 [DOI] [PubMed] [Google Scholar]
  • 39. Storer M., Mas A., Robert-Moreno A., Pecoraro M., Ortells M. C., Di Giacomo V., Yosef R., Pilpel N., Krizhanovsky V., Sharpe J., and Keyes W. M. (2013) Senescence is a developmental mechanism that contributes to embryonic growth and patterning. Cell 155, 1119–1130 10.1016/j.cell.2013.10.041 [DOI] [PubMed] [Google Scholar]
  • 40. Demaria M., Ohtani N., Youssef S. A., Rodier F., Toussaint W., Mitchell J. R., Laberge R. M., Vijg J., Van Steeg H., Dollé M. E., Hoeijmakers J. H., de Bruin A., Hara E., and Campisi J. (2014) An essential role for senescent cells in optimal wound healing through secretion of PDGF-AA. Dev. Cell 31, 722–733 10.1016/j.devcel.2014.11.012 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41. Childs B. G., Durik M., Baker D. J., and van Deursen J. M. (2015) Cellular senescence in aging and age-related disease: from mechanisms to therapy. Nat. Med. 21, 1424–1435 10.1038/nm.4000 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42. Kirkland J. L., and Tchkonia T. (2017) Cellular senescence: a translational perspective. EBioMedicine 21, 21–28 10.1016/j.ebiom.2017.04.013 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43. Xu M., Palmer A. K., Ding H., Weivoda M. M., Pirtskhalava T., White T. A., Sepe A., Johnson K. O., Stout M. B., Giorgadze N., Jensen M. D., LeBrasseur N. K., Tchkonia T., and Kirkland J. L. (2015) Targeting senescent cells enhances adipogenesis and metabolic function in old age. Elife 4, e12997 10.7554/eLife.12997 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44. Foulds C. E., Nelson M. L., Blaszczak A. G., and Graves B. J. (2004) Ras/mitogen-activated protein kinase signaling activates Ets-1 and Ets-2 by CBP/p300 recruitment. Mol. Cell. Biol. 24, 10954–10964 10.1128/MCB.24.24.10954-10964.2004 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45. Hollenhorst P. C., Chandler K. J., Poulsen R. L., Johnson W. E., Speck N. A., and Graves B. J. (2009) DNA specificity determinants associate with distinct transcription factor functions. PLoS Genet. 5, e1000778 10.1371/journal.pgen.1000778 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46. Joplin R., Strain A. J., and Neuberger J. M. (1989) Immuno-isolation and culture of biliary epithelial cells from normal human liver. In Vitro Cell Dev. Biol. 25, 1189–1192 10.1007/BF02621273 [DOI] [PubMed] [Google Scholar]
  • 47. Debacq-Chainiaux F., Erusalimsky J. D., Campisi J., and Toussaint O. (2009) Protocols to detect senescence-associated β-galactosidase (SA-βgal) activity, a biomarker of senescent cells in culture and in vivo. Nat. Protoc. 4, 1798–1806 10.1038/nprot.2009.191 [DOI] [PubMed] [Google Scholar]
  • 48. Dimri G. P., Lee X., Basile G., Acosta M., Scott G., Roskelley C., Medrano E. E., Linskens M., Rubelj I., and Pereira-Smith O. (1995) A biomarker that identifies senescent human cells in culture and in aging skin in vivo. Proc. Natl. Acad. Sci. U.S.A. 92, 9363–9367 10.1073/pnas.92.20.9363 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49. Griffiths G. J., Dubrez L., Morgan C. P., Jones N. A., Whitehouse J., Corfe B. M., Dive C., and Hickman J. A. (1999) Cell damage-induced conformational changes of the pro-apoptotic protein Bak in vivo precede the onset of apoptosis. J. Cell Biol. 144, 903–914 10.1083/jcb.144.5.903 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50. Hsu Y. T., and Youle R. J. (1998) Bax in murine thymus is a soluble monomeric protein that displays differential detergent-induced conformations. J. Biol. Chem. 273, 10777–10783 10.1074/jbc.273.17.10777 [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supporting Information

Articles from The Journal of Biological Chemistry are provided here courtesy of American Society for Biochemistry and Molecular Biology

RESOURCES