Abstract
Screening for human papillomavirus (HPV) integration into host cell chromosomes typically requires large amounts of time and reagents. We developed a rapid and sensitive assay based on exonuclease V (ExoV) and quantitative polymerase chain reaction (qPCR) to determine HPV genome configurations in cell lines and tissues. We established the assay using genomic DNA from cell lines known to harbor integrated or episomal HPV16. DNA was incubated with ExoV, which is specific for linear DNA, and the DNA fraction resistant to digestion was measured by qPCR. The percent of DNA resistant to ExoV digestion was calculated relative to undigested DNA for determination of episomal or integrated HPV16. The ExoV assay was accurate, capable of distinguishing episomal from integrated HPV16 in cell lines and tissues. Future applications of the ExoV assay may include screening of HPV genome configurations in the progression of HPV-associated cancers.
Keywords: HPV16, qPCR, Exonuclease V, Episomal, Integrated
1. Introduction
Human papillomaviruses (HPVs) carry a circular, chromatinized double-stranded DNA genome, approximately 8kb in length, packaged in a non-enveloped capsid. HPV is an epitheliotropic virus completing its entire productive life cycle as a circular episome in differentiated squamous epithelium. HPV infects basal epithelial cells, gaining access through a micro-abrasion or a wound. Within basal cells, HPV is maintained as a low copy, circular episome that is replicated alongside cellular DNA (Pyeon et al., 2009). As infected basal cells divide and exit the cell cycle, host epithelial cell differentiation induces the expression of HPV oncogenes E6 and E7, proteins necessary for S-phase entry (Doorbar, 2005; McCance et al., 1988). An S-phase like environment is critical for the productive phase of the viral lifecycle, defined by the replication of the HPV genome by host machinery, with thousands of circular copies of viral DNA per host cell produced (Bedell et al., 1991). Terminal differentiation stimulates the expression of HPV structural genes L1 and L2, which encapsidate the HPV genome. Progeny virions are then released at the epithelial surface for transmission.
To date, 240 HPV types have been identified (Egawa and Doorbar, 2017). HPV types that infect mucosal epithelia are categorized as either low-risk (non-oncogenic) or high-risk (oncogenic) types. Persistent infection with high-risk types of HPV, including HPV16 and HPV18, is associated with almost all cervical carcinomas and an increasing number of oropharyngeal squamous cell carcinomas (Burd, 2003; de Martel et al., 2017; Gooi et al., 2016; Walboomers et al., 1999). In its associated cancers, HPV integration is frequently observed. While the majority of HPV-positive cervical cancers harbor integrated HPV, the percent of integrated HPV-positive oropharyngeal squamous cell carcinomas is more variable, as the identification of integrated virus is influence by the methods used for detection (Jiang et al., 2015; Olthof et al., 2014; Parfenov et al., 2014; Wiest et al., 2002). In vitro studies have also shown that HPV integration occurs in long-term cell culture (Pett et al., 2006). Such integration events result in an abortive HPV infection, with the integrated viral genome no longer available for packaging and transmission to a new host. In addition, HPV integration is thought to contribute to oncogenesis through deregulated expression of viral oncogenes E6 and E7. HPV E6 and E7 inactivate the cell cycle checkpoint proteins p53 and pRB, thereby increasing cell proliferation and genetic instability over time (Groves and Coleman, 2015; McBride and Warburton, 2017; McCance et al., 1988; Moody and Laimins, 2010). The mechanism for how HPV genomes integrate into host chromosomes is not understood. HPV can integrate as either a single copy (type 1 integrant) or as multiple concatemeric copies carrying full-length genomes (type 2 integrant). Type 1 integration frequently involves the loss or truncation of the HPV E2 gene, a negative regulator of E6 and E7, resulting in the deregulation of HPV E6 and E7 expression (Groves and Coleman, 2015; McBride and Warburton, 2017).
Identifying the HPV genome status both in vitro and in vivo is critical to understanding the cellular effects that result from distinct HPV genome configurations and their implication in cancer development, progression, and treatment. Southern blots are the standard used to determine HPV genome configurations. However, Southern blot analysis is not only time and labor intensive, but also requires amounts of DNA that may not be achievable from small tissue biopsies (Hubbard, 2003). Limiting DNA quantity has prompted development of polymerase chain reaction (PCR)–based assays that can be applied to study viral integration in HPV-associated cancers (Carow et al., 2017; Scarpini et al., 2014). Amplification of papillomavirus oncogene transcripts (APOT-PCR) is a standard approach that analyzes changes in the length of HPV transcripts from integrated and episomal viral genomes using reverse-transcription PCR and gel electrophoresis (Klaes et al., 1999). While useful, the APOT assay requires isolation of high-quality RNA and several enzymatic steps for analysis in PCR. In the APOT assay, detection of fused transcripts from integrated HPV forms can be missed when excess episomal forms are present (Dona et al., 2013). Another approach directly detects integrated papillomavirus sequences (DIPS-PCR) using DNA template and ligation-mediated PCR to amplify the viral-cellular junctions of integrated HPV genomes (Luft et al., 2001). Addition of sequencing provides nucleotide-level resolution of the viral sequences lost and allows for assessment of viral clonality by determining the viral integration site on host chromosomes. However, this method is also labor-intensive and does not measure the presence of episomal forms, which are often present with HPV integrants as mixed forms. Whole genome, exome, or RNA sequencing methods overcome these limitations but are expensive and require complex bioinformatic analysis that may not be available to many investigators. A straight-forward method that is often used to determine the HPV physical state in tumor samples measures the ratio of E2/E6 DNA using quantitative PCR (qPCR). This method is based on observations that the E2 region is frequently lost following integration. A limitation of the E2/E6 ratio analysis is distinguishing type 2 HPV integrants from episomal HPV, due to preservation of E2 sequences in type 2 integrants and episomes (Yoshinouchi et al., 1999).
Here, we describe a rapid and sensitive enzymatic approach combined with qPCR to determine the HPV genome status within HPV-positive tissues and cell lines. Genomic DNAs were subjected to digestion by exonuclease V (ExoV), an enzyme that preserves nicked and supercoiled DNAs but degrades linear DNAs. Because episomal genomes are circular and integrated forms are linear, ExoV selectively digests integrated HPV DNA. With qPCR, the fraction resistant to ExoV digestion is calculated as a readout for the presence or absence of episomal HPV genomes. Using the ExoV assay, we have accurately determined the HPV genome configuration within cell lines and tissues grown in organotypic raft culture. The ExoV assay provides a rapid and sensitive method for routine monitoring of HPV16 genomic states that can be applied to both the laboratory and clinical settings.
2. Results and Discussion
2.1. Establishment of an ExoV assay to detect circular and linear DNA
To establish a qPCR-based assay capable of distinguishing circular and linear DNAs, we employed exonuclease V (ExoV), which is a RecBCD complex isolated from Escherichia coli with an enzymatic activity that preserves nicked and supercoiled DNA but degrades linear DNAs. A mixture of circular plasmid DNA with cellular genomic DNA was digested with ExoV and quantitative PCR (qPCR) was used to measure DNA levels (Figure 1A). The percent resistance was calculated as the amount of DNA detected after ExoV digestion relative to the amount in undigested samples. A high percent resistance would be consistent with circular DNA, while low percent resistance would indicate linear DNAs digested by ExoV. Specific primers to a 5kb (luciferase gene) and 10kb plasmid (Epstein-Barr virus BMRF1 gene), as well as primers specific to 16kb human mitochondrial DNA (mtDNA) were used in qPCR (Table 1). Primers to human ribosomal 18S DNA (rDNA) were used to measure enzyme processivity and efficiency in degrading linear DNA, as the 18S rDNA locus is a tandemly repeated 45kB cluster with approximately 400 copies dispersed on 5 chromosomes (Stults et al., 2008).
Figure 1: Establishing size constraints of the Exonuclease V (ExoV) assay with plasmid DNAs.
A) Schematic of the ExoV assay. Plasmid DNA served as a circular, episomal DNA, while 18S ribosomal DNA (rDNA) served as a multi-copy linear DNA control. The percent of DNA resistance to ExoV digestion was calculated relative to undigested DNA and used to determine the physical state of the DNA target. B) Purified HaCaT genomic DNA (post) or unpurified HaCaT lysates (pre) were supplemented with 1.4×107 copies of a 5kb plasmid (pGL3) and analyzed by ExoV digestion. The percent resistance to ExoV digestion for the 5kb plasmid was calculated in qPCR using primers to the luciferase gene. The average percent resistance and standard error of the mean of 4 biological replicates is shown. C) HaCaT genomic DNA (post) and HaCaT DNA lysates (pre) with 1.4×107 copies of a 10kb (Epstein-Barr virus BamHI M) plasmid was analyzed in the ExoV assay. The percent resistance to ExoV digestion was calculated in qPCR using primers to the BMRF1 gene. The average percent resistance and standard error of the mean of 3 biological replicates is shown. D) The DNA percent resistance of mitochondrial DNA (mtDNA) to ExoV digestion was determined from purified HaCaT DNA using primers specific to mtDNA. The average percent resistance and standard error of 3 biological replicates is shown.
Table 1.
Oligonucleotides used in qPCR analysis
| Gene Name | Sequence (5’−3’) |
|---|---|
| Luciferase | F: GAAAGGCCCGGCGCCATTCT |
| R: TTCATAGCTTCTGCCAACCG | |
| EBV BMRF1 | F: CAGGCTGAGGAACGAGCA |
| R: CAACGAGGAAGCCGTCTTG | |
| Ribosomal 18S | F: GCAATTATTCCCCATGAACG |
| R: GGGACTTAATCAACGCAAGC | |
| E2 | F: CCATATAGACTATTGGAAACACATGCGCC |
| R:CTGTAGTTGCAGTTCAATTGCTTGTAATGC | |
| E5 | F: TACGTCCGCTGCTTTTGTCT |
| R: AACGCAGAGGCTGCTGTTAT | |
| E6 | F: GAGAACTGCAATGTTTCAGGACC |
| R: TGTATAGTTGTTTGCAGCTCTGTGC | |
| L2 | F: TGCATCGGCTACCCAACTTT |
| R: ACCCGACCCTGTTCCAATTC |
To establish the assay, we added 5kb plasmid DNA (pGL3) either directly to purified HaCaT DNA or to HaCaT DNA lysates prior to purification using a Qiagen column. We observed that the 5kb plasmid showed a 95% resistance to ExoV when added to purified DNA. The percent resistance dropped to 76% when the plasmid was added to the lysate prior to purification (Figure 1B). The reduction in percent resistance to ExoV could result from breakage of DNA molecules either passing through the column or from residual nuclease or topoisomerase activity in the DNA lysate. To determine if larger DNAs would be more prone to DNA breakage, the experiment was repeated adding a 10kb plasmid (Epstein-Barr Virus (EBV) BamM). The 10kb plasmid was 80% resistant to ExoV digestion when added post-DNA purification but was reduced by an additional 18% when purified together with cellular DNA (Figure 1C). The decrease in percent resistance was proportionately similar to what was observed with the 5kb plasmid. Endogenous 16kb circular mtDNA was approximately 52% resistant to ExoV treatment (Figure 1D). Although some loss of DNA integrity was evident during DNA isolation and purification, the ExoV assay detected circular DNA up to 16kb in size. In all samples, the ExoV resistant fraction of rDNA was below 4%, confirming the enzyme’s efficiency in digesting linear DNA. Together, these data demonstrated the ExoV assay can discriminate circular DNA up to 16kb in size from linear chromosomal DNA.
2.2. Use of the ExoV assay for detection of circular HPV genomes
Human papillomaviruses have 8kb genomes that are maintained as circular, chromatinized, extrachromosomal elements (episomes) following infection. The genome remains circular throughout the HPV lifecycle; however, aberrant viral integration is frequently observed in HPV-positive cancers (Parfenov et al., 2014; Pett and Coleman, 2007). Viral integration is also observed following transfection of the viral genome in cell culture, requiring routine monitoring of HPV-immortalized cell lines (Dall et al., 2008; Pett et al., 2006). Here, we tested if the ExoV assay could be applied to determine the HPV genome configuration of HPV-positive cells. We analyzed various HPV16-positive cell lines that included immortalized human foreskin keratinocytes (HFKs) or human tonsillar epithelial cells (HTEs) established by transfection of the HPV16 genome. We also analyzed UMSCC47 cells, a cell line derived from a head and neck tumor known to carry approximately 18 copies of HPV16 integrated into the cellular genome (Akagi et al., 2014; Brenner et al., 2010; Olthof et al., 2015). We compared our ExoV results to Southern blot analysis, the standard laboratory method used to visualize HPV genome configurations (Hubbard, 2003).
For Southern blot analysis, genomic DNA was digested with HindIII, which does not digest the HPV16 genome, or BamHI, which has a single restriction site on the HPV16 genome. Episomal HPV16 is identified by comparing the uncut supercoiled band in HindIII digestion to the linearized 8kb band following BamHI digestion. Higher molecular weight bands located above the supercoiled band are either nicked/open circular or concatemeric forms of HPV DNA. UMSCC47 DNA digested with HindIII showed an HPV DNA fragment greater than 10kb that migrated at a higher molecular weight when DNA was digested with BamHI. This pattern was consistent with integrated HPV16, as expected for the UMSCC47 cell line (Figure 2A). HPV-positive HFKs established following transfection showed the expected pattern for circular DNA, with the supercoiled band in the HindIII undigested HPV DNA that migrated at 8kb following BamHI digestion (Figure 2A).
Figure 2: Application of the ExoV assay to monitor the physical state of the HPV16 genome in HPV16-positive keratinocytes grown in monolayer and organotypic raft culture.
A) Genomic DNA from UMSCC47 and HPV-transfected (HPV+HFK) grown in monolayer were digested with BamHI or HindIII and analyzed by Southern blot. White lines depict where the image was cropped. Samples were compared to 7×106,7×107,7×108 copies of an HPV16-positive pUC plasmid linearized with BamHI as copy number controls (equivalent to 10, 100, 1000 HPV copies per cell). B) Percent resistance to ExoV digestion of HPV16 E6 DNA from UMSCC47 and HPV+HFK cell lines. C) Southern blot analysis of HTE 16D and 16E cells grown in monolayer. DNAs were either digested with BamHI or HindIII. An HPV16-positive pUC plasmid digested with BamHI loaded at 7×106,7×107,7×108 copies served as copy number controls. White lines depict where image was cropped. HTE16E image was taken from a longer exposure. D) Percent resistance to ExoV digestion of HPV16 E6 DNA from the HTE cell line 16D carrying episomal HPV grown in three separate organotypic raft cultures. E) Percent resistance to ExoV digestion of HPV16 E6 DNA from the HTE cell line carrying integrated HPV16 grown in two separate organotypic raft cultures.
Using the same DNA samples as used in the Southern blots, we analyzed the HPV genome configurations using the ExoV assay with E6-specific primers for amplification in qPCR. In UMSCC47 cells, HPV E6 DNA percent resistance was below 1%, consistent with linear, integrated DNA (Figure 2B). HPV-transfected HFKs exhibited HPV E6 percent resistance of ~63%, reflecting the presence of circular, episomal HPV DNA. rDNA percent resistance remained below 4% for all DNAs analyzed, indicating complete enzymatic digestion of linear DNA. Together these results demonstrate that the ExoV assay can distinguish episomal and integrated HPV-positive epithelial cell lines.
2.3. The ExoV assay confirmed the HPV16 genome status in organotypic raft tissues
As the ExoV assay requires low amount of input DNA, analysis of HPV in tissues could be used as a screening approach for HPV integration of fresh biopsy samples in clinical and laboratory settings. We examined if the ExoV assay can be applied to monitoring HPV genome configurations in tissue samples using HPV16-postive human tonsillar epithelial cells (HTE) grown in organotypic raft culture (Asselineau and Prunieras, 1984; Meyers et al., 1992). Prior to growth in organotypic raft culture, the HPV genome configuration for HPV-positive HTE cell lines grown in monolayer was determined by Southern blot. HTE cell line 16D contained episomal HPV16, while 16E contained integrated HPV16 (Figure 2C). Using the ExoV assay examining the HPV16 E6 region, the HTE 16D rafts showed an average 71% resistance indicative of circular, episomal HPV genomes in three raft tissues tested (Figure 2D). In contrast, HPV E6 percent resistance was below 1% for HTE 16E rafts, as expected for linear, integrated HPV (Figure 2E). rDNA percent resistance for all rafts tested using the ExoV assay was below 9% confirming ExoV enzymatic activity (Figure 2D, 2E). We extended our analysis to include immortalized HFK cell lines that had been infected with replication-competent or defective HPV genomes grown in organotypic raft culture. Replication-defective HPV with a translation termination linker (TTL) mutation in E1 or E2 E39A mutation are unable to be maintained episomally, such that immortalized cell lines have integrated HPV. For the HPV16 E1 and E2 mutants examined, a low HPV E6 DNA copy number was observed in undigested samples, consistent with cell lines carrying an integrated HPV genome. Cells infected with wildtype virus maintain HPV as a circular episome, although integration can also occur. However, growth in raft culture would replicate/amplify the episomal DNA, which would not occur with cases with integrated DNA. Indeed, analysis of wildtype HPV-infected HFK cell lines grown as rafts showed resistance to ExoV digestion that ranged from 59 to 85% (Table 2). In contrast, HFK cell lines infected with E1 or E2 replication-defective mutants showed percent resistance to ExoV typically below that of rDNA, indicating that HPV was integrated, as expected, in these rafted samples (Table 2). Thus, the ExoV assay can be used to determine HPV16 genome configurations in fresh tissue samples and may be applied to monitoring the HPV16 genome status in patient samples.
Table 2:
ExoV analysis of raft DNA derived from keratinocytes infected with wildtype or replication-defective HPV
| Samples (DNA) |
% E6 DNA Resistance |
% rDNA Resistance |
Undigested DNA | HPV Genomic State |
||
|---|---|---|---|---|---|---|
| Ratio E2/E6 |
Ratio E5/E6 |
Ratio L2/E6 |
||||
| WT -1 | 59 | 2.2 | 1.2 | 1.1 | 1.1 | Episomal |
| WT -2 | 85 | 3.4 | 1.2 | 1.1 | 1.3 | Episomal |
| WT -3 | 66 | 4.5 | 1.1 | 1.1 | 1.2 | Episomal |
| E1-TTL -1 | 1.5 | 2.1 | 0.4 | 0.3 | 0.3 | Integrated |
| E1-TTL -2 | 2.4 | 8.5 | 0.6 | 0.3 | 0.3 | Integrated |
| E1-TTL -3 | 1.8 | 7.6 | 0.4 | 0.4 | 0.3 | Integrated |
| E2 E39A -1 | 3.7 | 2.1 | 0.3 | 0.3 | 0.2 | Integrated |
| E2 E39A -2 | 1.6 | 3.0 | 0.6 | 0.7 | 0.7 | Integrated |
| E2 E39A -3 | 1.3 | 2.0 | 0.3 | 0.3 | 0.2 | Integrated |
| UMSCC47 | 0.9 | 2.5 | 1.5 | 1.1 | 1.4 | Integrated |
grey rows – CT values around 30 in undigested samples
2.4. The ExoV assay is unaffected by multiple rounds of DNA thawing
The detection of circular DNA using the ExoV assay depends on the integrity of the sample. Introduction of double-stranded DNA breaks from tissue or DNA storage and processing would result in loss of circular templates. Repeated thawing and freezing of DNA samples can result in DNA degradation and compromise the accuracy of the ExoV assay (Shao et al., 2012). To determine how freeze/thaw cycles affect the detection of circular DNA by the ExoV assay, we subjected HPV-transfected HFK genomic DNA supplemented with the 5kb plasmid to 10 freeze/thaw cycles. We observed little reduction in the detection of the 5kb or the HPV circular, episomal DNA (Figure 3). Larger circular 16kb mtDNA showed a slight reduction in the percent resistance to ExoV only after 6 freeze/thaw cycles. Our results indicate that small circular DNA, including the HPV16 genome, can tolerate several freeze/thaw cycles. Thus, frozen samples can be analyzed using the ExoV assay. Addition of a plasmid reporter at the time of DNA harvest can serve to monitor DNA integrity over time. Although not tested, it is unlikely that the ExoV assay will work with formalin fixed, paraffin embedded (FFPE) tissues as DNA degradation occurs during storage that would compromise detection of any circular episomal DNA (Guyard et al., 2017).
Figure 3: Effect of frozen storage on sensitizing circular, episomal DNA to ExoV digestion.
A) Genomic DNA from HPV-transfected HFKs supplemented with 1.4×107 copies of the 5kb plasmid (pGL3) was frozen at −80°C for 30 minutes and thawed on ice for 15 minutes up to 10 rounds. The percent resistance to ExoV digestion was calculated for the 5kb plasmid, HPV16 E6 DNA, mitochondrial DNA (mtDNA), and 18S ribosomal DNA (rDNA) at every second interval. The average percent resistance and standard error of the mean from 3 biological replicates is shown.
2.5. Detection of mixed HPV forms using the ExoV assay
Mixed HPV forms consisting of both episomal and integrated HPV genomes can be difficult to differentiate by a number of established assays. In addition, HPV can integrate in a concatemeric configuration, where multiple genomes are joined in a head-to-tail repeated manner (type 2 integrant) that can be difficult to distinguish from circular intact genomes in various assays. To determine if the ExoV assay can quantify mixed HPV forms, DNAs previously supplemented with the 5kb plasmid carrying either type 2 integrated DNA from UMSCC47 cells or episomal DNA from HPV16+HFK cells were mixed at various ratios (Figure 4A). The 5kb plasmid DNA was used as a standard for DNA integrity. The percent resistance of the 5kb plasmid ranged between 59% to 73%, with the inconsistency likely due to slight pipetting errors during mixing of the spiked DNA samples. HPV16 E6 DNA showed an increase in the ExoV percent resistance that was proportional to the ratio of circular/episomal DNA versus linear/integrated DNA, reaching a maximum percent resistance of 46% for the HPV-positive HFK DNA. (Figure 4A). The proportional increase in HPV E6 DNA showed a linear correlation with an R2 value of 0.97 (Figure 4B).
Figure 4: Estimating the limit of detection of circular, episomal HPV16 DNA in the ExoV assay.
A) Genomic DNA from HPV-transfected HFKs containing circular, episomal HPV were mixed with DNA from UMSCC47 cells containing integrated HPV. Before mixing, HFK and UMSCC47 genomic DNAs were supplemented with 5kb (pGL3) plasmid. The average percent resistance to ExoV digestion is shown for the 5kb plasmid, HPV16 E6 DNA, mitochondrial DNA (mtDNA), and 18S ribosomal DNA (rDNA). Error bars represent the standard deviation of the mean from 2 biological replicates. B) A linear correlation in the percent resistance of HPV16 E6 DNA relative to the percent input was observed. Each point represents the percent resistance to ExoV digestion of 2 technical replicates from 2 independent biological experiments.
The HPV-positive HFK cell lines examined showed on average a ~50% resistance to ExoV when grown as a monolayer (Figure 2 and 3). The reason for incomplete percent resistance in these samples may reflect loss of DNA integrity of the HPV episome due to isolation of DNA from HFK cell lines or represent pooled populations containing both integrated and episomal HPV. Considering these caveats, the ExoV assay is unable to estimate the absolute amount of episomal DNA versus integrated DNA. Instead, the ExoV assay can be simply used for detecting if a sample carries episomal or integrated HPV DNA. The percent resistance for the linear rDNA would be used to set the value for discrimination of linear from circular DNA in a given sample.
2.6. Accuracy of ExoV assay in determining the physical state of the HPV genome compared to other established methods
To determine the accuracy of the ExoV assay as a screening tool for analyzing HPV genome configurations, a panel of HPV-positive cell lines was evaluated. Three HFK lines were generated by HPV infection (HFK WT infected) using the extracellular matrix to cell transfer method as previously described (Bienkowska-Haba et al., 2018). Eight HFK lines were generated by transfection of HPV16 genomes (wildtype, WT, or E5 TTL mutant). UMSCC47 was included as a control for integrated HPV DNA (Table 3). Southern blot analysis showed 7 cell lines as having integrated HPV16, and 5 cell lines showed an episomal banding pattern (Figure 2, 5, Table 3). For the ExoV assay, samples were called episomal if the E6 DNA percent resistance was at least 10% and 3-fold above that of rDNA. ExoV analysis confirmed all 5 episomal samples by Southern blot analysis (HFK lines 1, 2, 4, 5, 8; Table 3). ExoV analysis of samples with integrated HPV16 DNA by Southern blot identified 5/7 cell lines as having integrated HPV16 DNA (UMSCC47, HFK lines 3, 6, 7,10; Table 3). However, ExoV analysis called HFK lines 9 and 11 positive for episomal HPV16 DNA with 20% and 29% resistance to ExoV digestion, respectively. In both cases, the rDNA percent resistance was below 3. To ensure that the episomal E6 DNA signal represented intact genomes, we also measured the percent resistance of E2, E5, and L2 regions of the HPV genome. All samples, including HFK lines 9 and 11, showed a similar percent resistance across the HPV genome, further validating the episomal and integrated calls based on the ExoV assay (Table 3). Overall, the ExoV assay showed an 83% concordance in detecting episomal and integrated HPV16 DNA compared to Southern blot analysis.
Table 3:
Accuracy of ExoV assay in determining the physical state of the HPV genome compared to other assays
| Cell Line | Southern Blot Analysis |
HPV* Copy Per Cell |
ExoV digested DNA Percent Resistance# |
Undigested DNA | Combined Analysis |
||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| E6 | E2 | E5 | L2 | rDNA | Ratio E2/E6 | Ratio E5/E6 | Ratio L2/E6 | ||||
| UMSCC47 | Integrated | 18 | 0.1 | 0.1 | 0.2 | 0.1 | 4.2 | 1.0 | 0.9 | 0.8 | Integrated Type 2 |
| 1 HFK WT Infected | Episomal | 26 | 36 | 35 | 42 | 43 | 1.5 | 1.1 | 1.0 | 1.6 | Episomal |
| 2 HFK WT | Episomal | 70 | 15 | 11 | 14 | 10 | 1.4 | 0.8 | 0.8 | 0.8 | Episomal |
| 3 HFK WT | Integrated | 0.1 | 0 | 6 | 0 | 0 | 0.8 | 0.03 | 0.08 | 0.01 | Integrated Type 1 |
| 4 HFK WT infected | Episomal | 41 | 22 | 18 | 20 | 19 | 5.7 | 0.9 | 0.8 | 0.8 | Episomal |
| 5 HFK WT infected | Episomal | 58 | 19 | 13 | 15 | 13 | 2.7 | 0.9 | 0.9 | 0.9 | Episomal |
| 6 HFK WT | Integrated | 0.4 | 1 | 2 | 1 | 1 | 2.5 | 0.9 | 0.9 | 0.9 | Integrated Type 2 |
| 7 HFK E5 mutant | Integrated | 5 | 4 | 3 | 5 | 4 | 1.1 | 0.9 | 0.7 | 0.9 | Integrated Type 2 |
| 8 HFK E5 mutant | Episomal | 37 | 44 | 34 | 43 | 42 | 1.3 | 1.0 | 1.0 | 1.0 | Episomal |
| 9 HFK E5 mutant | Integrated | 3 | 20 | 14 | 24 | 22 | 0.8 | 1.0 | 0.8 | 0.8 | Mixed† |
| 10 HFK WT | Integrated | 3 | 1 | 1 | 3 | 2 | 3.8 | 1.2 | 0.3 | 0.2 | Integrated Type 1 |
| 11 HFK E5 mutant | Integrated | 15 | 29 | 21 | 27 | 26 | 2.3 | 1.1 | 0.8 | 1.0 | Episomal |
HPV copy number per cell was calculated from the ratio of relative HPV E6 DNA to human ribosomal 18S DNA and normalized to UMSCC47 HPV copies per cell.
Episomal calls were based on percent resistance for HPV (E6, E2, E6, and L2) being greater than 10% and being at least 3-fold over rDNA.
Mixed calls were determined by having less than 1 episome per cell (ExoV percent resistance times the HPV copies per cell)
Figure 5: Southern blot analysis to determine the HPV16 genome configuration in a panel of HPV-positive keratinocyte cell lines.
Southern blot analysis of genomic DNA from HFKs either infected with wild type HPV (samples 1, 4, 5) or transfected with wild type or mutant HPV genomes (samples 2, 3, 6–11) were digested with BamHI or HindIII. An HPV16-positive pUC plasmid was digested with BamHI and loaded at 7×106,7×107,7×108 copies as copy number controls (equivalent to 10, 100, and 1000 copies per cell). Sample 1 was run on a separate gel; while copy number standards and samples 2 – 5 were run on the same gel. *represents samples with episomal HPV on Southern blot analysis.
The ExoV assay is highly sensitive to detection of episomal DNA, raising the possibility that the episomal calls for HFK lines 9 and 11 were false positives. However, Southern blot analysis has its own set of limitations that include an inability to detect low copy number episomes (with a limit of ~10 copies per cell, Figure 5). To address this concern, we measured the E6 DNA copy number in undigested DNA samples. HFK lines 9 and 11 had a low copy number near or below the limit of detection on the Southern blot, indicating that the discrepancy is likely a failure of the Southern blot in detecting episomal signals for these samples (Table 3).
Loss of HPV viral sequences can occur following integration, with the ratio of E2 to E6 DNA used to determine the HPV genome state in clinical samples. Thus, samples with episomal HPV retain E2 and E6 with a ratio greater than 0.9, while integrated HPV samples with a loss of E2 DNA have a E2/E6 ratio less than 0.1 (Boulet et al., 2009; Choi et al., 2018; Lorenzi et al., 2017). Using this analysis, most HPV-positive cell lines met the criteria for having episomal DNA (ratio >0.9 for E2/E6; Table 3). However, this method cannot distinguish a type 2 integrant from episomal HPV as observed for the UMSCC47 cell line, known to harbor type 2 integrated HPV16 DNA (Table 3). We included the copy number ratio of HPV16 E2, E5, and L2 regions to detect integration at other sites of the HPV genome. A loss of viral sequences relative to E6 was observed for HFK cell lines 3 and 10, consistent with viral integration. The HFK line 10 showed that viral integration retained E2 but lost the E5 and L2 region of the HPV genome, which was consistent with the absence of a signal for full length genomes on the Southern blot. For HFK lines 9 and 11, the ratio analysis was inconclusive and showed ratios consistent with episomal or type 2 integrated HPV. However, if we combined the ExoV percent resistance and copy number analysis, HFK line 9 had less than 1 copy of episomal HPV per cell, likely being a mixed sample with integrated and episomal DNA. HFK line 14 had at least 3 copies of episomal HPV per cell, illustrating the increased sensitivity of the ExoV assay in detecting samples with episomal DNA when compared to Southern blotting.
Conclusions
While it is not a prerequisite for cancer progression, HPV integration has been observed in a majority of HPV-positive cervical cancers and a portion of oropharyngeal squamous cell carcinomas (McBride and Warburton, 2017; Pett and Coleman, 2007). HPV has also been observed to frequently integrate in cell culture as cells are passaged in the laboratory over time. Southern blots are routinely used to screen for HPV genome configurations; however, Southern blotting requires amounts of DNA that may not be achievable from small tissues biopsies or tissues grown in culture, while also being labor and time intensive. To rapidly and efficiently determine HPV genome configurations within tissues and cell lines, we developed a simple ExoV-qPCR based assay that is rapid and sensitive, requiring nanogram quantities of genomic DNA. The ExoV assay, when combined with copy number analysis of the HPV genome, accurately detected episomal and integrated forms of HPV in both cell lines and tissues grown in organotypic raft culture.
A limitation of the ExoV assay is that it may be prone to calling samples as having episomal DNA (false positives) due to its high sensitivity in detecting circular DNA. As such, samples should be extracted in clean work areas and negative controls included to monitor for unintended plasmid contamination. Any plasmids carrying the target region amplified in PCR would confound the data and increase the false positive calls. As a sentinel for contamination, HaCaT DNA was purified in parallel with most of the samples analyzed and was negative for HPV in our PCR assays. In addition, we improved the accuracy of the ExoV assay in identifying episomal samples by measuring the copy number at various regions across the HPV genome, which informed on the structure of the HPV DNA, monitored potential contamination, and validated the intact state of episomes detected. Such analysis has biological implications as a recent RNA-seq study identified structural variants that were consistent with being HPV episomal hybrids carrying partially deleted viral DNA interspersed with human DNA in head and neck tumors (Nulton et al., 2017). Although we observed that small genomes like HPV were rather stable tolerating several rounds of freeze/thawing, addition of an unrelated plasmid could be used to monitor DNA integrity of stored samples. Although the ExoV assay was only applied to screening the HPV genome, the assay can be adapted to examine other small DNA viruses adopting circular, episomal configurations in their life cycles. Future applications of the ExoV assay may include screening of HPV genome configurations in the progression of HPV-associated cancers.
3. Materials and Methods
4.1. Cell and organotypic raft culture
Human tonsillar epithelial cells (HTE) and human foreskin keratinocytes (HFK) were isolated and transfected with the HPV16 genome as previously described using cre-loxP recombination to generate circular full length HPV16 genomes (Bodily et al., 2011; Guidry et al., 2019; Wilson and Laimins, 2005). HPV-infected HFKs were generated from extracellular matrix enhancement of infection as previously described (Bienkowska-Haba et al., 2018). Immortalized outgrowths represent a pooled population. HFKs were co-cultured with mitomycin C-treated NIH 3T3 J2 feeder fibroblasts and grown in E medium supplemented with 5% fetal bovine serum (FBS, GIBCO) as previously described (Meyers and Laimins, 1994). HTEs were also co-cultured with mitomycin C-treated NIH 3T3 J2 feeder fibroblasts and grown in E medium supplemented with 5% FBS and 10µM Rho kinase inhibitor Y-27632 (Tocris). 3T3 J2 fibroblasts were cultured in Dulbecco’s modified Eagle medium (DMEM) supplemented with 10% calf serum (HyClone). The 3T3 J2 fibroblasts were treated with 8µg/mL of mitomycin C (Santa Cruz) in 10% FBS-supplemented DMEM for 2 to 4 hours, washed with 1X PBS three times, and kept in 10% FBS-supplemented DMEM. Treated J2 fibroblasts were used within 2 weeks after mitomycin C treatment. UMSCC47 cells were cultured in DMEM + GlutaMAX (Gibco, 1g/L D-glucose, 110mg/L sodium pyruvate) supplemented 10% FBS (Brenner et al., 2010). HaCaT cells were cultured in DMEM + GlutaMAX supplemented with 5% FBS. All cells were grown in a 37°C humidified incubator supplied with 5% CO2. Organotypic rafts were cultured as previously described (Guidry et al., 2019).
4.2. Plasmid and genomic DNA isolation and ExoV digestion
Plasmid DNA was isolated using the NucleoSpin Plasmid kit (Macherey-Nagel). All DNA isolations followed manufacturer’s instructions. Total cellular DNA from rafts, UMSCC47, and HaCaT cells were isolated using the QIAamp Blood Mini Kit (Qiagen). HTEs and HPV-transfected HFKs grown in monolayer were isolated using phenol chloroform extraction and ethanol precipitation (Fehrmann et al., 2003). HPV-infected HFK DNA was isolated using the Nucleospin Blood Quick Pure kit (Macherey-Nagel). Approximately, 7×108 copies of plasmid DNA were added to purified genomic DNA isolated from 5×105 HaCaT cells, (equivalent to ~5 micrograms (µg) added post-purification) or to 5×105 HaCaT cells lysed in 200µl of Qiagen AL lysis buffer and 200µl 1X phosphate-buffered saline (PBS, Corning) that was subsequently purified using a QiaAmp Blood mini column (pre). Genomic DNA was stored in 10mM tris buffer at 4oC to avoid damage by freeze-thawing DNA. For ExoV digestion, 100 nanograms of genomic ± plasmid DNA was treated with or without 3.3 units of ExoV (RecBCD, NEB) in a 10µl reaction volume and incubated for 1 hour at 37°C. Digestion was followed by heat inactivation at 95°C for 10 minutes. DNA was then kept on ice or stored at −20°C until qPCR analysis. In the mixing experiment, approximately 5 micrograms of either UMSCC47 or HPV-positive HFK genomic DNAs were supplemented with 7×108 copies of the 5kb plasmid and then mixed at ratios starting at 10% HFK + 90% UMSCC47 up to 100% HFK or UMSCC47, with the final DNA amount totaling 100ng.
4.3. Southern blot analysis
Southern blots were prepared as previously described (Bodily et al., 2011; Fehrmann et al., 2003; Southern, 1975). Briefly, 5µg or 10µg of total cellular DNA was digested with either BamHI (cuts HPV16 once) or HindIII (does not cut HPV16) restriction enzymes (NEB) and resolved on a 0.8% agarose gel with 0.5 µg /ml of ethidium bromide. 7×106, 7×107, and 7×108 copies (equivalent to 10, 100, and 1,000 copies per cell) of an HPV16-positive pUC plasmid linearized with BamHI was included on the Southern blot analysis for estimation of viral copy number. DNA was transferred onto a nylon membrane (GE Water and Process Technologies or GeneScreen Plus) and hybridized with full length HPV16 genome labeled with α−32P dCTP using the Rediprime II Random Prime Labelling System (Amersham Biosciences) or the Invitrogen RadPrime DNA Labeling System according to the manufacturer’s instructions. Radioactive signals were visualized by autoradiography (Amersham Hyperfilm).
4.4. qPCR analysis
DNA from a four nanogram equivalent (4 ul of 1:10 dilution from the ExoV digested/undigested reaction) was quantified by qPCR using a 7500 FAST Applied Biosystems thermocycler with SYBR Green PCR Master Mix (Applied Biosystems) and 300nM of each primer in a 15 µl reaction (Primer sequences in Table 1). qPCR cycling conditions were as previously described: 50°C for 2 minutes, 95ºC for 10 minutes, 40 cycles at 95°C for 15 seconds, followed by melting curve analysis (Bienkowska-Haba et al., 2018; Guidry et al., 2019). No template controls (HaCaT alone or water as template) were included to control for PCR contamination. Relative DNA amounts were calculated based on a standard curve generated using a 10-fold dilution spanning 5 logs that started at 100ng of either undigested UMSCC47 (Figures 1–3) or HaCaT DNA containing 1.4 × 107 copies of pUC plasmid containing the full HPV16 genome (Figure 4 and Table 2, 3). The efficiency of primers was accounted for in the standard curve calculations, with all qPCRs having slopes ranging between −3.1 to −3.4. The percent resistant fraction to ExoV digestion was calculated from amount of DNA relative to the standard curve after ExoV digestion divided by amount of DNA relative to the standard curved in the undigested sample times 100. The copy number was calculated based on the standard curve generated from a 10-fold dilution series of HaCaT DNA supplemented with an HPV16 positive plasmid for E6, E2, E5, and L2 primers. HPV copy number per cell was relative to the rDNA (18S) copy number, and normalized to UMSCC47 DNA, set at 18 copies per cell (Akagi et al., 2014; Olthof et al., 2015)
Highlights.
The ExoV assay is a rapid and sensitive assay for detecting episomal and integrated HPV DNA.
The ExoV assay, combined with a copy number ratio analysis across the HPV genome, distinguished episomal DNA and identified either type I or type II HPV integrants.
The ExoV assay provides an alternative approach for determining the physical state of small circular DNA viral genomes in laboratory and clinical samples.
Acknowledgments
Funding
This work was supported by grants from the National Institutes of Health/National Institute for Dental and Craniofacial Research (DE025565) to RSS, National Institute for Allergy and Infectious Disease (AI118904) to JMB, National Cancer Institute (CA211576) to MJS, National Institute of General Medicine COBRE grant (P30GM110703), and Carroll Feist Predoctoral Fellowships to JTG and MLS.
Footnotes
Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
References
- Akagi K, Li J, Broutian TR, Padilla-Nash H, Xiao W, Jiang B, Rocco JW, Teknos TN, Kumar B, Wangsa D, He D, Ried T, Symer DE, Gillison ML, 2014. Genome-wide analysis of HPV integration in human cancers reveals recurrent, focal genomic instability. Genome Res 24, 185–199. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Asselineau D, Prunieras M, 1984. Reconstruction of ‘simplified’ skin: control of fabrication. Br J Dermatol 111 Suppl 27, 219–222. [DOI] [PubMed] [Google Scholar]
- Bedell MA, Hudson JB, Golub TR, Turyk ME, Hosken M, Wilbanks GD, Laimins LA, 1991. Amplification of human papillomavirus genomes in vitro is dependent on epithelial differentiation. J Virol 65, 2254–2260. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Bienkowska-Haba M, Luszczek W, Myers JE, Keiffer TR, DiGiuseppe S, Polk P, Bodily JM, Scott RS, Sapp M, 2018. A new cell culture model to genetically dissect the complete human papillomavirus life cycle. PLoS Pathog 14, e1006846. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Bodily JM, Mehta KP, Cruz L, Meyers C, Laimins LA, 2011. The E7 open reading frame acts in cis and in trans to mediate differentiation-dependent activities in the human papillomavirus type 16 life cycle. J Virol 85, 8852–8862. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Boulet GA, Benoy IH, Depuydt CE, Horvath CA, Aerts M, Hens N, Vereecken AJ, Bogers JJ, 2009. Human papillomavirus 16 load and E2/E6 ratio in HPV16-positive women: biomarkers for cervical intraepithelial neoplasia >or=2 in a liquid-based cytology setting? Cancer Epidemiol Biomarkers Prev 18, 2992–2999. [DOI] [PubMed] [Google Scholar]
- Brenner JC, Graham MP, Kumar B, Saunders LM, Kupfer R, Lyons RH, Bradford CR, Carey TE, 2010. Genotyping of 73 UM-SCC head and neck squamous cell carcinoma cell lines. Head Neck 32, 417–426. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Burd EM, 2003. Human papillomavirus and cervical cancer. Clin Microbiol Rev 16, 1–17. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Carow K, Golitz M, Wolf M, Hafner N, Jansen L, Hoyer H, Schwarz E, Runnebaum IB, Durst M, 2017. Viral-Cellular DNA Junctions as Molecular Markers for Assessing Intra-Tumor Heterogeneity in Cervical Cancer and for the Detection of Circulating Tumor DNA. Int J Mol Sci 18. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Choi YJ, Lee A, Kim TJ, Jin HT, Seo YB, Park JS, Lee SJ, 2018. E2/E6 ratio and L1 immunoreactivity as biomarkers to determine HPV16-positive high-grade squamous intraepithelial lesions (CIN2 and 3) and cervical squamous cell carcinoma. J Gynecol Oncol 29, e38. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Dall KL, Scarpini CG, Roberts I, Winder DM, Stanley MA, Muralidhar B, Herdman MT, Pett MR, Coleman N, 2008. Characterization of naturally occurring HPV16 integration sites isolated from cervical keratinocytes under noncompetitive conditions. Cancer Res 68, 8249–8259. [DOI] [PubMed] [Google Scholar]
- de Martel C, Plummer M, Vignat J, Franceschi S, 2017. Worldwide burden of cancer attributable to HPV by site, country and HPV type. Int J Cancer 141, 664–670. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Dona MG, Paolini F, Benevolo M, Vocaturo A, Latini A, Giglio A, Venuti A, Giuliani M, 2013. Identification of episomal human papillomavirus and other DNA viruses in cytological anal samples of HIV-uninfected men who have sex with men. PLoS One 8, e72228. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Doorbar J, 2005. The papillomavirus life cycle. J Clin Virol 32 Suppl 1, S7–15. [DOI] [PubMed] [Google Scholar]
- Egawa N, Doorbar J, 2017. The low-risk papillomaviruses. Virus Res 231, 119–127. [DOI] [PubMed] [Google Scholar]
- Fehrmann F, Klumpp DJ, Laimins LA, 2003. Human papillomavirus type 31 E5 protein supports cell cycle progression and activates late viral functions upon epithelial differentiation. J Virol 77, 2819–2831. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Gooi Z, Chan JY, Fakhry C, 2016. The epidemiology of the human papillomavirus related to oropharyngeal head and neck cancer. Laryngoscope 126, 894–900. [DOI] [PubMed] [Google Scholar]
- Groves IJ, Coleman N, 2015. Pathogenesis of human papillomavirus-associated mucosal disease. J Pathol 235, 527–538. [DOI] [PubMed] [Google Scholar]
- Guidry JT, Myers JE, Bienkowska-Haba M, Songock WK, Ma X, Shi M, Nathan CO, Bodily JM, Sapp MJ, Scott RS, 2019. Inhibition of Epstein-Barr Virus Replication in Human Papillomavirus-Immortalized Keratinocytes. J Virol 93. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Guyard A, Boyez A, Pujals A, Robe C, Tran Van Nhieu J, Allory Y, Moroch J, Georges O, Fournet JC, Zafrani ES, Leroy K, 2017. DNA degrades during storage in formalin-fixed and paraffin-embedded tissue blocks. Virchows Arch 471, 491–500. [DOI] [PubMed] [Google Scholar]
- Hubbard RA, 2003. Human papillomavirus testing methods. Arch Pathol Lab Med 127, 940–945. [DOI] [PubMed] [Google Scholar]
- Jiang R, Ekshyyan O, Moore-Medlin T, Rong X, Nathan S, Gu X, Abreo F, Rosenthal EL, Shi M, Guidry JT, Scott RS, Hutt-Fletcher LM, Nathan CA, 2015. Association between human papilloma virus/Epstein-Barr virus coinfection and oral carcinogenesis. J Oral Pathol Med 44, 28–36. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Klaes R, Woerner SM, Ridder R, Wentzensen N, Duerst M, Schneider A, Lotz B, Melsheimer P, von Knebel Doeberitz M, 1999. Detection of high-risk cervical intraepithelial neoplasia and cervical cancer by amplification of transcripts derived from integrated papillomavirus oncogenes. Cancer Res 59, 6132–6136. [PubMed] [Google Scholar]
- Lorenzi A, Rautava J, Kero K, Syrjanen K, Longatto-Filho A, Grenman S, Syrjanen S, 2017. Physical state and copy numbers of HPV16 in oral asymptomatic infections that persisted or cleared during the 6-year follow-up. J Gen Virol 98, 681–689. [DOI] [PubMed] [Google Scholar]
- Luft F, Klaes R, Nees M, Durst M, Heilmann V, Melsheimer P, von Knebel Doeberitz M, 2001. Detection of integrated papillomavirus sequences by ligation-mediated PCR (DIPS-PCR) and molecular characterization in cervical cancer cells. Int J Cancer 92, 9–17. [PubMed] [Google Scholar]
- McBride AA, Warburton A, 2017. The role of integration in oncogenic progression of HPV-associated cancers. PLoS Pathog 13, e1006211. [DOI] [PMC free article] [PubMed] [Google Scholar]
- McCance DJ, Kopan R, Fuchs E, Laimins LA, 1988. Human papillomavirus type 16 alters human epithelial cell differentiation in vitro. Proc Natl Acad Sci U S A 85, 7169–7173. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Meyers C, Frattini MG, Hudson JB, Laimins LA, 1992. Biosynthesis of human papillomavirus from a continuous cell line upon epithelial differentiation. Science 257, 971–973. [DOI] [PubMed] [Google Scholar]
- Meyers C, Laimins LA, 1994. In vitro systems for the study and propagation of human papillomaviruses. Curr Top Microbiol Immunol 186, 199–215. [DOI] [PubMed] [Google Scholar]
- Moody CA, Laimins LA, 2010. Human papillomavirus oncoproteins: pathways to transformation. Nat Rev Cancer 10, 550–560. [DOI] [PubMed] [Google Scholar]
- Nulton TJ, Olex AL, Dozmorov M, Morgan IM, Windle B, 2017. Analysis of The Cancer Genome Atlas sequencing data reveals novel properties of the human papillomavirus 16 genome in head and neck squamous cell carcinoma. Oncotarget 8, 17684–17699. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Olthof NC, Huebbers CU, Kolligs J, Henfling M, Ramaekers FC, Cornet I, van Lent-Albrechts JA, Stegmann AP, Silling S, Wieland U, Carey TE, Walline HM, Gollin SM, Hoffmann TK, de Winter J, Kremer B, Klussmann JP, Speel EJ, 2015. Viral load, gene expression and mapping of viral integration sites in HPV16-associated HNSCC cell lines. Int J Cancer 136, E207–218. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Olthof NC, Speel EJ, Kolligs J, Haesevoets A, Henfling M, Ramaekers FC, Preuss SF, Drebber U, Wieland U, Silling S, Lam WL, Vucic EA, Kremer B, Klussmann JP, Huebbers CU, 2014. Comprehensive analysis of HPV16 integration in OSCC reveals no significant impact of physical status on viral oncogene and virally disrupted human gene expression. PLoS One 9, e88718. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Parfenov M, Pedamallu CS, Gehlenborg N, Freeman SS, Danilova L, Bristow CA, Lee S, Hadjipanayis AG, Ivanova EV, Wilkerson MD, Protopopov A, Yang L, Seth S, Song X, Tang J, Ren X, Zhang J, Pantazi A, Santoso N, Xu AW, Mahadeshwar H, Wheeler DA, Haddad RI, Jung J, Ojesina AI, Issaeva N, Yarbrough WG, Hayes DN, Grandis JR, El-Naggar AK, Meyerson M, Park PJ, Chin L, Seidman JG, Hammerman PS, Kucherlapati R, 2014. Characterization of HPV and host genome interactions in primary head and neck cancers. Proc Natl Acad Sci U S A 111, 15544–15549. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Pett M, Coleman N, 2007. Integration of high-risk human papillomavirus: a key event in cervical carcinogenesis? J Pathol 212, 356–367. [DOI] [PubMed] [Google Scholar]
- Pett MR, Herdman MT, Palmer RD, Yeo GS, Shivji MK, Stanley MA, Coleman N, 2006. Selection of cervical keratinocytes containing integrated HPV16 associates with episome loss and an endogenous antiviral response. Proc Natl Acad Sci U S A 103, 3822–3827. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Pyeon D, Pearce SM, Lank SM, Ahlquist P, Lambert PF, 2009. Establishment of human papillomavirus infection requires cell cycle progression. PLoS Pathog 5, e1000318. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Scarpini CG, Groves IJ, Pett MR, Ward D, Coleman N, 2014. Virus transcript levels and cell growth rates after naturally occurring HPV16 integration events in basal cervical keratinocytes. J Pathol 233, 281–293. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Shao W, Khin S, Kopp WC, 2012. Characterization of effect of repeated freeze and thaw cycles on stability of genomic DNA using pulsed field gel electrophoresis. Biopreserv Biobank 10, 4–11. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Southern EM, 1975. Detection of specific sequences among DNA fragments separated by gel electrophoresis. J Mol Biol 98, 503–517. [DOI] [PubMed] [Google Scholar]
- Stults DM, Killen MW, Pierce HH, Pierce AJ, 2008. Genomic architecture and inheritance of human ribosomal RNA gene clusters. Genome Res 18, 13–18. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Walboomers JM, Jacobs MV, Manos MM, Bosch FX, Kummer JA, Shah KV, Snijders PJ, Peto J, Meijer CJ, Munoz N, 1999. Human papillomavirus is a necessary cause of invasive cervical cancer worldwide. J Pathol 189, 12–19. [DOI] [PubMed] [Google Scholar]
- Wiest T, Schwarz E, Enders C, Flechtenmacher C, Bosch FX, 2002. Involvement of intact HPV16 E6/E7 gene expression in head and neck cancers with unaltered p53 status and perturbed pRb cell cycle control. Oncogene 21, 1510–1517. [DOI] [PubMed] [Google Scholar]
- Wilson R, Laimins LA, 2005. Differentiation of HPV-containing cells using organotypic “raft” culture or methylcellulose. Methods Mol Med 119, 157–169. [DOI] [PubMed] [Google Scholar]
- Yoshinouchi M, Hongo A, Nakamura K, Kodama J, Itoh S, Sakai H, Kudo T, 1999. Analysis by multiplex PCR of the physical status of human papillomavirus type 16 DNA in cervical cancers. J Clin Microbiol 37, 3514–3517. [DOI] [PMC free article] [PubMed] [Google Scholar]





