Skip to main content
NCBI home page
Immunology logoLink to Immunology
. 2019 Nov 10;159(1):109–120. doi: 10.1111/imm.13130

The immunosuppressive functions of two novel tick serpins, HlSerpin‐a and HlSerpin‐b, from Haemaphysalis longicornis

Fanqi Wang 1, Zhenyu Song 1, Jing Chen 2, Qihan Wu 2, Xia Zhou 3, Xiaohua Ni 2,✉, Jianfeng Dai 1,✉
PMCID: PMC6904602  PMID: 31606893

Summary

Serpins are evolutionarily conserved serine protease inhibitors that are widely distributed in animals, plants and microbes. In this study, we reported the cloning and functional characterizations of two novel serpin genes, HlSerpin‐a and HlSerpin‐b, from the hard tick Haemaphysalis longicornis of China. Recombinant HlSerpin‐a and HlSerpin‐b displayed protease inhibitory activities against multiple mammalian proteases. Similar to other tick serpins, HlSerpin‐a and HlSerpin‐b suppressed the expression of inflammatory cytokines such as TNF‐α, interleukin (IL)‐6 and IL‐1β from lipopolysaccharide‐stimulated mouse bone‐marrow‐derived macrophages (BMDMs) or mouse bone‐marrow‐derived dendritic cells (BMDCs). The minimum active region (reaction centre loop) of HlSerpin‐a, named SA‐RCL, showed similar biological activities as HlSerpin‐a in the protease inhibition and immune suppression assays. The immunosuppressive activities of full‐length HlSerpin‐a and SA‐RCL are impaired in Cathepsin G or Cathepsin B knockout mouse macrophages, suggesting that the immunomodulation functions of SA and SA‐RCL are dependent on their protease inhibitory activity. Finally, we showed that both full‐length HlSerpins and SA‐RCL can relieve the joint swelling and inflammatory response in collagen‐induced mouse arthritis models. These results suggested that HlSerpin‐a and HlSerpin‐b are two functional arthropod serpins, and the minimal reactive peptide SA‐RCL is a potential candidate for drug development against inflammatory diseases.

Keywords: activation, inflammation, regulation, suppression

HlSerpin-a and HlSerpin-b are two functional arthropod serpins. HlSerpin-a RCL region displays the enzymatic inhibitory activity and immunosuppressive property. SA-RCL is a potential candidate for drug development against inflammatory diseases.

graphic file with name IMM-159-109-g007.jpg

Abbreviations

BMDC

mouse bone‐marrow‐derived dendritic cells

BMDM

mouse bone‐marrow‐derived macrophages

CIA

collagen‐induced arthritis

SA

HlSerpin‐a

SA‐RCL

HlSerpin‐a centre reaction loop

SB

HlSerpin‐b

Introduction

Ticks are blood‐feeding arthropods that transmit numerous pathogens, imposing a serious threat to human health.1 In China, ticks transmit pathogens for Lyme disease, human Babesiosis, Tick‐Borne Encephalitis and Severe Fever with Thrombocytopaenia syndrome, among others.2 During their long‐term blood‐feeding period, ticks secrete saliva to assist blood feeding and pathogen transmission. Tick saliva contains biological active components that regulate host inflammatory responses, complement activation, blood coagulation, platelet aggregation, as well as the adaptive immune response.3, 4

Serpins are the largest and most broadly distributed superfamily of protease inhibitors, which are critical requirements in the maintenance of immune homeostasis.5 Serpins are evolutionarily conserved and also widely distributed in arthropods.6, 7 Large numbers of protease inhibitors were found to be expressed in the tick salivary glands, including Cystatin, Serpin and Kunitz‐like family.8 cDNAs encoding serpin‐like proteins have now been cloned from several tick species, including Ixodes scapularis, Ixodes ricinus, Boophilus microplus, Haemaphysalis longicornis and Rhipicephalus appendiculatus.9 Some tick serpins have been shown to be associated with counter defense against anti‐tick responses in the host, such as inflammation, complement activation, platelet aggregation, and blood clotting.8, 9 In other studies, tick serpins are suggested as being important in tick feeding physiology, as significant reductions in feeding efficiency had been observed in ticks that fed on animals immunized with recombinant tick serpins.8, 9 However, very little information has been provided for the mechanisms of how these arthropod serpins act as immunosuppressants and how to utilize these large proteins in disease models in a proper way.

Host immune cells express a wide variety of proteases, such as granzymes in cytotoxic lymphocytes, neutrophil elastase, Cathepsin G and proteinase 3 in neutrophils and chymase in mast cells.11 Serpins targeted mainly toward the serine proteinases known to be involved in phagocytosis, coagulation, complement activation and fibrinolysis.11, 12 Recent progress suggested that endo‐lysosomal proteases, for example, the cathepsin family, play key roles within the immune response.13 Cathepsins induce proteolytic cleavage of TLRs (e.g. TLR7 and TLR9), which is a prerequisite for their signalling.14, 15 Interleukin (IL)‐8 processing in neutrophils depends on the activation of granule‐localized serine proteases such as Cathepsin G and proteinase‐3.16 Cathepsin B was required for optimal posttranslational processing and production of TNF‐α in response to lipopolysaccharide (LPS).17 Mice deficient in the serine protease Cathepsin L are much more susceptible to lethal Staphylococcus aureus infection than wild‐type mice.18 Whether arthropod‐derived serpins regulate host immune responses via their protease inhibitory functions has not been discussed in the previous studies.

The hard tick H. longicornis is widely distributed in the middle areas of China and considered as the vector of many important tick‐borne pathogens, such as Anaplasma spp., Rickettsia spp., Babesia spp. and Severe Fever with Thrombocytopaenia Syndrome Virus.19, 20 In this study, we reported the cloning and functional characterizations of two novel serpin genes, HlSerpin‐a (abbreviated as SA in the figures) and HlSerpin‐b (SB), from H. longicornis isolated from Zhejiang province of China. HlSerpin‐a and HlSerpin‐b displayed immunosuppressive properties and significantly relieve the inflammation in a murine arthritis model.

Materials and methods

Ethics statements

Animal experiments were conducted according to the Guide for the Care and Use of Medical Laboratory Animals (Ministry of Health, People's Republic of China), and were approved by the Animal Care and Use Committee as well as the Ethical Committee of Soochow University (ECSU‐201800091).

Cloning and expression of HlSerpin‐a and HlSerpin‐b

Total mRNAs extracted from whole adult H. longicornis were subjected to high‐throughput RNA sequencing by Illumina sequencing facility as described previously.21 The Unigene sequences were annotated and screened for novel Serpin‐like genes by BLAST analyses against the NCBI NR database (https://blast.ncbi.nlm.nih.gov/Blast.cgi).

The ORFs of HlSerpin‐a and HlSerpin‐b were amplified from the H. longicornis cDNA library using the gene‐specific primers (Table S1). Then the ORFs were cloned into the prokaryotic expression vector pGEX‐6p2 and transformed into Escherichia coli strain BL21 (DE3) for protein expression. The E. coli cultures (OD 0·6 ~ 0·8) were induced with 0·1 mm isopropyl‐β‐d‐thiogalactoside (IPTG) at 30° for 4 hr. Then, the soluble recombinant GST‐tagged fusion proteins were purified using GST affinity agarose (GE Healthcare, Sweden) and the GST tag was removed by on‐column enzyme digestion of Prescission Protease (Sigma, St. Louis, MO, USA). LPS contamination in purified recombinant proteins was removed by endotoxin‐adsorbing medium (Thermo, Waltham, MA, USA). (The recombinant protein of RA‐deleting RCL was also prepared as described above.)

Peptide preparation

The minimum active fragment (SA‐RCL) containing the reaction centre loop (RCL) and the RCL hinge region of HlSerpin‐a was predicted by homology modelling (https://swissmodel.expasy.org/) based on the 3D structure of tick IRS‐2 protein. A cell‐penetrating peptide‐HIV‐TAT: GRKRRQRRRPPQ22 was fused to the N‐terminal of SA‐RCL (GTEAAAATSVVAVNRIGSEP), and the fusion peptide was synthesized and purified by high‐performance liquid chromatography (GL Biochem, Shanghai, China).

Protease inhibition assays

The protease inhibition assays of HlSerpin‐a and HlSerpin‐b were performed according to the protocols described previously.23, 24 Briefly, indicated dosages of recombinant SA, SB or SA‐RCL were added into the enzyme reaction system of multiple mammalian proteases, including Cathepsin G, Cathepsin B, Cathepsin L, papain, FXa, kallikrein and Thrombin. The enzyme activities of Cathepsins G, B and L were analysed by using the InnoZyme Cathepsin Activity kits (Millipore, St. Louis, MO, USA) according to the manufacturer's instructions. The chromogenic substrates for FXa (S‐2765, Z‐D‐Arg‐Gly‐Arg‐pNA·2HCl), kallikrein (S‐2302, H‐D‐Pro‐Phe‐Arg‐pNA) and Thrombin (S‐2238, H‐D‐Phe‐Pip‐Arg‐pNA·2HCl) were obtained from Aglyco (Beijing, China) and Diapharma (Louisville, KY, USA). The casein substrate for papain was purchased from Sigma‐Aldrich (Cat. 11610).

Generation of bone marrow‐derived dendritic cells and bone marrow‐derived macrophages

Mouse bone‐marrow‐derived dendritic cells (BMDCs) and bone‐marrow‐derived macrophages (BMDMs) were generated as described previously.25, 26 Briefly, mice were anaesthetized, and the intact femurs and tibias were dissected. The bone marrow was harvested by repeated flushing with RPMI media (Hyclone) supplemented with 10% FCS. For the generation of BMDMs, bone marrow cells were induced with RPMI + 10% fetal bovine serum (FBS) + 10% L929‐cell conditioned medium for 7 days. Alternatively, the bone marrow cells were cultured with GM‐CSF (20 ng/ml, PeproTech) for 7 days and then differentiated into BMDCs.

Measurement of cytokine production by quantitative reverse transcriptase‐polymerase chain reaction and enzyme‐linked immunosorbent assay

The BMDMs or BMDCs were seeded on 48‐well plates for 24 hr, and then pre‐incubated with recombinant SA or SB (or SA‐RCL peptide) (1 μm) for 2 hr. Then, the cells were stimulated with LPS (100 ng/ml, Sigma) for 4 hr. Cells were harvested and the total RNA was extracted using the total RNA kit (OMEGA, Norcross, GA, USA). The mRNA expressions of IL‐1β, IL‐6 and TNF‐α were analysed with quantitative reverse transcriptase‐polymerase chain reaction (qRT‐PCR). Briefly, the total RNA was reverse‐transcribed using the PrimeScript Master Mix kit (TaKaRa, Japan), and qRT‐PCR was performed using a SYBR Green‐based method with gene‐specific primers. The expression levels of selected genes were normalized to mouse Gapdh gene. (Oligo‐primer sequences for qRT‐PCR were shown in Table S1.)

Cell‐free culture supernatants were harvested at 24 hr after stimulation and used to analyse the protein expression of IL‐6 and TNF‐α by enzyme‐linked immunosorbent assay (ELISA; Biolegend, San Diego, CA, USA) according to the manufacturer's instructions.

Generation of Cathepsin knockout cell line

Cathepsin B and Cathepsin G knockout Raw264.7 macrophage cell lines were constructed via the standard methods of CRISPR‐Cas9. The gRNA sequences (Cathepsin B: 5′‐CACCGATCTACAAAAACGGCCCCG‐3′; Cathepsin G: 5′‐CACCGAATCGAAACGTGAACCCAG‐3′) were cloned into CRISPER‐Cas9 vector pX462. The constructs were then transfected into Raw264.7 cells by electroporation. The knockout cell lines were selected by puromycin selection for at least 2 weeks.

The type II collagen‐induced arthritis model

The collagen‐induced arthritis (CIA) mouse model is prepared according to the standard protocols described previously.27 Six ~ 8‐week‐old male DBA/1 mice were grouped and immunized with bovine Collagen II (CII) (100 μg/each; Chondrex, Redmond, WA, USA) emulsified in complete Freund's adjuvant (Sigma‐Aldrich). At day 21, the mice were re‐immunized with CII emulsified in incomplete Freund's adjuvant for developing arthritis. At day 7, 14, 21, 28 and 35, mice were injected intramuscularly with phosphate‐buffered saline (PBS), SA, SB or SA‐RCL (20 μg) every 7 days. The size of the mouse ankle joint was measured at indicated time points, and orbital blood samples were used to analyse the collagen‐specific antibody titres by ELISA. At day 42, mice were killed, and the joints were dissected for pathological analysis. Serial sections of the entire joint were stained with haematoxylin and eosin. The knee and tibiotarsal joints were scored for arthritis severity on a scale of 0 (negative) to 3 (severe) in a blinded fashion as described previously.28

Collagen‐specific splenocyte proliferation assay was performed as described previously.29 Briefly, collagens (50 µg/ml) were coated in 96‐well plates, and the splenocytes isolated from mice groups with different treatments were seeded in the wells. After incubation for 72 hr, the cell proliferations were analysed by alamarBlue Cell Viability Reagent (Thermo). To test the cytokine production, the splenocytes were treated with collagen for 72 hr and then the cytokine expressions were examined by ELISA as described above.

Statistical analysis

prism 7 software (graphpad Software) was used for charts and statistical analyses. Statistical differences were analysed by Student's t‐test and anova. A value of P < 0·05 was considered statistically significant.

Results

HlSerpin‐a and HlSerpin‐b are secreted tick saliva proteins with protease inhibitory activity

Two novel cDNA clones encoding putative tick Serpin genes were obtained from H. longicornis cDNA library and named as HlSerpin‐a and HlSerpin‐b, respectively. The full‐length cDNA sequences were submitted into the Genbank database under the accession numbers of MK886492 (HlSerpin‐a) and MK886493 (HlSerpin‐b). Sequence analysis indicated that HlSerpin‐a ORF was 1197 bp long, encoding a 399‐amino‐acid protein. A putative signal peptide cleavage site at amino acid position 21 was also found in HlSerpin‐a (as analysed by signalp4.1 software; http://www.cbs.dtu.dk/services/SignalP/; Fig. 1a). HlSerpin‐b ORF was 1137 bp long, encoding a 379‐amino‐acid protein. There is no predicated signal peptide in HlSerpin‐b protein sequence (Fig. 1a). Sequence similarity analysis results suggested that HlSerpin‐a and HlSerpin‐b share 60% ~ 70% similarity to the reported Serpins from other hard ticks such as Rhipicephalus microplus (AHC98669.1, AHC98657.1), I. scapularis (AID54718.1) and I. ricinus (3NDA_A). In addition, HlSerpin‐a shows 58% sequence similarity to human Serpin B4 (NP_002965.1), and HlSerpin‐b shares 54% similarity to human Serpin B9 (NP_004146.1).

Figure 1.

Figure 1

Open in a new tab

HlSerpin‐a and HlSerpin‐b from Haemaphysalis longicornis are secreted tick saliva proteins with protease inhibitory activity. (a) A sketch map for the cDNA and protein structures of HlSerpin‐a (SA) and HlSerpin‐b (SB). The predicted ORFs and deduced proteins were indicated. The Signal peptide of HlSerpin‐a was shown in the orange box. The predicted serpin domain was indicated in blue. (b) The purification of recombinant SA and SB after cleavage of GST tags. (c) Tick immune mouse serum recognizes recombinant SA and SB (*P < 0·05, ***P < 0·001, t‐test). (d) The protease inhibitory activities of HlSerpin‐a and HlSerpin‐b against Cathepsin G, Cathepsin B, FXa and Papain. Results are expressed as mean ± SEM [*P < 0·05, **P < 0·01 and ***P < 0·001 compared with protease alone (Ctrl), t‐test]. The data shown are representative of at least three independent experiments. (e) The protease inhibitory profile of SA and SB (‘+’: inhibited; ‘−’: non‐inhibited).

Tick serpins were reported as secreted saliva proteins that play multiple roles in the interface of tick and mammalian host, such as anti‐inflammation, anti‐coagulation and enhancing tick feedings.9 To test whether HlSerpin‐a and HlSerpin‐b are secreted proteins, tick immune mouse serum was probed by recombinant HlSerpin‐a and HlSerpin‐b (Fig. 1b,c). The ELISA result suggested that both HlSerpin‐a and HlSerpin‐b can react with tick immune mouse serum, but not the clean control mouse serum (Fig. 1c). This suggested that HlSerpin‐a and HlSerpin‐b may be secreted into host blood during tick feeding so that mice generate antibodies against these tick antigens.

Serpins are typical inhibitors against multiple host proteases, especially those serine proteases. Because HlSerpin‐a and HlSerpin‐b share high similarity to human Serpins and can be secreted into host tissues, we suspected that HlSerpin‐a and HlSerpin‐b may inhibit the host protease activities. A total of seven different host proteases were employed in the enzymatic assay, including Cathepsin G, Cathepsin B, Cathepsin L, papain, FXa, kallikrein and Thrombin (Figs 1d,e, and S1). The results suggested that HlSerpin‐a inhibited the activities of Cathepsin G, Cathepsin B, papain and FXa. HlSerpin‐b inhibited the enzymatic activities of Cathepsin G, papain and FXa (Fig. 1d,e). None of them inhibited the activities of kallikrein and Thrombin (Fig. S1). These data suggested that both HlSerpin‐a and HlSerpin‐b are functional protease inhibitors and may play some roles in the tick−host interface.

HlSerpin‐a and HlSerpin‐b suppress the cytokine expression from LPS‐stimulated BMDMs and BMDCs

Tick serpins were reported to suppress the activation of distinct immune cells.8, 9 To test whether HlSerpin‐a and HlSerpin‐b also interfere with the activation of host immune response, murine BMDMs and BMDCs were incubated with recombinant HlSerpin‐a and HlSerpin‐b for 2 hr and then stimulated with LPS for 4 hr. In BMDMs, LPS‐induced mRNA transcriptions of TNF‐α, IL‐6 and IL‐1β were significantly inhibited by HlSerpin‐a and HlSerpin‐b (Fig. 2a). Consistently, HlSerpin‐a and HlSerpin‐b also suppressed LPS‐induced TNF‐α and IL‐6 protein expression (Fig. 2b). Similar results were obtained in LPS‐stimulated BMDCs: HlSerpin‐a and HlSerpin‐b obviously impaired TNF‐α, IL‐6 and IL‐1β mRNA expression (Fig. 2c), as well as TNF‐α and IL‐6 protein expression (Fig. 2d). These results suggested that HlSerpin‐a and HlSerpin‐b are two functional tick serpins that suppress host immune cell activation.

Figure 2.

Figure 2

Open in a new tab

HlSerpin‐a (SA) and HlSerpin‐b (SB) suppress the cytokine expression from lipopolysaccharide (LPS)‐stimulated bone‐marrow‐derived macrophages (BMDMs) and bone‐marrow‐derived dendritic cells (BMDCs). (a) SA and SB inhibited LPS‐induced mRNA expression of TNF‐α, interleukin (IL‐6) and IL‐1β in BMDMs. (b) SA and SB influenced the protein expression of TNF‐α and IL‐6 in LPS‐stimulated BMDMs. (c) SA and SB suppressed LPS‐induced mRNA expression of TNF‐α, IL‐6 and IL‐1β in BMDCs. (d) SA and SB inhibited the protein expression of TNF‐α and IL‐6 in LPS‐stimulated BMDCs. Results are expressed as mean ± SEM [*P < 0·05, **P < 0·01 and ***P < 0·001 compared with the phosphate‐buffered saline (PBS) group, t‐test]. The data shown are representative of at least three independent experiments.

The RCL of HlSerpin‐a is the minimal functionally active region

A previous study suggested that the structure of serpins would present a loop to interact with the protease active site cleft of serine proteases.5 This loop was typically 20–24 residues long and called as ‘reactive centre loops’ (RCL).12 The conserved domain Blast analysis suggested that HlSerpin‐a has an intact serpin domain with an RCL motif at its C terminal (Fig. 3a). To dissect the structure and functions of HlSerpin‐a RCL, sequence alignment and homology modelling were performed with HlSerpin‐a and another tick serpin IRS‐2,23 which has a crystal structure information in protein database [(PDB) code 3nda.1]. The sequence alignment results suggested that the potential RCL and RCL hinge region of HlSerpin‐a shares 50% identity with those of IRS‐2 (Fig. 3b). Three‐dimensional homology modelling suggested that the RCL is located near the C terminal of HlSerpin‐a (350‐369 aa) and displayed as a stable helix separated away from the major part of the N‐terminal helical domain (Fig. 3c).

Figure 3.

Figure 3

Open in a new tab

The reactive centre loop (RCL) of HlSerpin‐a (SA‐RCL) displayed protease inhibitory and immunosuppressive activity. (a) Conserved domain search indicated that SA has a RCL motif. (b) Sequences of RCL and RCL hinge region of SA and tick serpin IRS‐2. (c) 3D homology modelling of SA based on the protein structure of IRS‐2 [http://www.pdb.org; (PDB) code 3nda.1]. The predicted RCL and hinge region were indicated in orange. (d) SA‐RCL displayed protease inhibitory activity against Cathepsin G. (e) Both SA and SA‐RCL inhibited LPS‐induced expression of TNF‐α, IL‐6 and IL‐1β in bone‐marrow‐derived macrophages (BMDMs). Results are expressed as mean ± SEM [*P < 0·05, **P < 0·01 and ***P < 0·001 compared with the phosphate‐buffered saline (PBS) group, t‐test]. The data shown are representative of at least three independent experiments.

To test whether the RCL of HlSerpin‐a has biological function, we designed and synthesized a fusion peptide containing the whole RCL and RCL hinge region of HlSerpin‐a (GTEAAAATSVVAVNRIGSEP, 350‐369aa) coupled with a cell‐penetrating peptide‐HIV‐TAT: GRKRRQRRRPPQ. Purified recombinant HlSerpin‐a deleting RCL was used as a control. Enzymatic assay suggested that SA‐RCL displayed the inhibitory effect against protease Cathepsin G activity, but SA deleting RCL did not (Fig. 3d). In terms of the immunosuppressive assay, full‐length SA and SA‐RCL, but not SA deleting RCL, significantly impaired the cytokine production in LPS‐stimulated BMDMs (Fig. 3e). This suggested that the RCL region alone displays enzymatic inhibitory activity as well as immunosuppressive properties.

The immunosuppressive function of HlSerpin‐a depends on its protease inhibitory activity

Cathepsins were reported to have critical roles in immune activation. A previous study suggested that cells lacking in Cathepsin K and L had an impaired cytokine production during S. aureus infection.18 Because our data suggested that HlSerpin‐a inhibited the enzymatic activities of Cathepsin B and Cathepsin G, we wondered whether Cathepsins B and G also contribute to LPS‐induced cytokine production in immune cells, and whether the immunosuppressive function of HlSerpin‐a relies on its enzymatic inhibitory activities. To test this hypothesis, Cathepsin B and Cathepsin G knockout mouse macrophage RAW264.7 cells were generated via a CRISPR‐Cas9 technique (Fig. 4a). Firstly, the overall cytokine expressions in Cathepsin B or Cathepsin G knockout RAW264.7 cells were dramatically decreased upon LPS stimulation when compared with those in wild‐type cells (Fig. 4b,c). Secondly, both HlSerpin‐a and SA‐RCL suppressed the mRNA expression of TNF‐α, IL‐6 and IL‐1β in wild‐type RAW264.7 cells, but these suppressions were unobvious in Cathepsin B or Cathepsin G knockout RAW264.7 cells (Fig. 4b,c). These data suggested that Cathepsin B and Cathepsin G play a role in macrophage activation, and the immunosuppressive function of HlSerpin‐a depends on its protease inhibitory activities.

Figure 4.

Figure 4

Open in a new tab

The immunosuppressive function of HlSerpin‐a (SA) depends on its protease inhibitory activity. (a) Construction of Cathepsin B and Cathepsin G knockout Raw264.7 cells. The expression of Cathepsins B or G in knockout and wild‐type cell lines were confirmed by Western blots. (b) SA and SA‐reaction centre loop (RCL) inhibited lipopolysaccharide (LPS)‐induced mRNA expression of TNF‐α, interleukin (IL)‐6 and IL‐1β in wild‐type RAW264.7 cells, but not in Cathepsin B knockout cells. (c) SA and SA‐RCL inhibited LPS‐induced mRNA expression of TNF‐α, IL‐6 and IL‐1β in wild‐type RAW264.7 cells, but not in Cathepsin G knockout cells. Results are expressed as mean ± SEM [*P < 0·05, **P < 0·01 and ***P < 0·001, compared with the phosphate‐buffered saline (PBS) group, t‐test]. The data shown are representative of at least three independent experiments.

HlSerpin‐a and HlSerpin‐b relieve the joint inflammation in a murine arthritis model

Because HlSerpin‐a and HlSerpin‐b displayed immunosuppressive activity, we explore whether they could be employed in the treatment of inflammatory diseases. The CIA model has been widely used in the study of inflammatory and autoimmune diseases.27 The arthritis is characterized by swelling, immune cell infiltration and damage to the joint. DBA mice were immunized with bovine type II collagen (CII) twice at day 1 and day 21, and develop typical arthritis after the antigen boost. The mice received endotoxin‐free HlSerpin‐a and HlSerpin‐b (20 µg in 100 µl PBS) every 7 days, and the control mice received the same volume of PBS. First, a persistent inhibition of ankle joints swelling in HlSerpin‐a‐ and HlSerpin‐b‐treated mice was observed compared with controls (Fig. 5a,b). Histological analysis demonstrated that HlSerpin‐a and HlSerpin‐b treatments reduced joint inflammation in the CII‐induced mouse arthritis model compared with controls (Fig. 5c,d). H&E staining revealed increased immune cell infiltration, cartilage destruction, bone erosion, and a hypertrophy of synovial tissue in PBS control mice when compared with HlSerpin‐a‐ and HlSerpin‐b‐treated mice (Fig. 5c,d).

Figure 5.

Figure 5

Open in a new tab

HlSerpin‐a (SA) and HlSerpin‐b (SB) relieve the inflammation in a murine arthritis model. (a) The swelling of ankle joints of mice from non‐immunized (NC) and immunized mice. SA and SB treatments significantly relieve the joint swelling compared with phosphate‐buffered saline (PBS) controls. (Joints from non‐immunized mice served as negative control.) (b) The ankle joint size of mice from different treatment groups. The number of animals per group is five in each experiment. Results are expressed as the mean ± SEM of ankle joint thickness (*P < 0·05 compared with the PBS group, anova test). The representative results from three independent experiments are shown. (c) Histopathological analysis of joint sections from immunized or non‐immunized (NC) mice at day 42. The black arrows indicated the immune cell infiltration, cartilage destruction and bone erosion in the positive control group. Magnification 40 (4 × objective lens) and 100 (10 ×); scale bars: 100 μm. (d) Arthritis score of collagen‐immunized mice treated with SA, SB or PBS control (***P < 0·001 compared with PBS group, t‐test). (e) Reduced spleen sizes from mice treated with SA or SB, compared with PBS controls. (f) SA or SB inhibited collagen‐specific splenocyte proliferation (*P < 0·05 and **P < 0·01 compared with PBS group, anova test). (g) Impaired IL‐6 and TNF‐α expression in SA‐ or SB‐treated splenocytes stimulated with collagen. (h) Reduced collagen‐specific antibody titres in SA‐ or SB‐treated mice compared with PBS groups. Results are expressed as mean ± SEM (*P < 0·05, **P < 0·01 and ***P < 0·001 compared with the PBS group, t‐test). The data shown are representative of at least three independent experiments.

To analyse whether HlSerpin‐a and HlSerpin‐b suppress the CII‐induced immune reaction, spleen organs from negative control or CII‐immunized mice were dissected. The results suggested that HlSerpin‐a‐ and HlSerpin‐b‐treated groups have smaller spleen size compared with the PBS‐positive control group (Fig. 5e). The collagen‐specific splenocyte proliferation assay suggested that HlSerpin‐a‐ and HlSerpin‐b‐treated mice have impaired antigen‐specific cell proliferation when compared with the PBS control group (Fig. 5f). Consistently, the IL‐6 and TNF‐α cytokine production (Fig. 5g) as well as the CII‐specific antibody production (Fig. 5h) were also suppressed in HlSerpin‐a‐ or HlSerpin‐b‐treated groups. This suggested that HlSerpin‐a and HlSerpin‐b have immunosuppressive functions in vivo and can be potentially used in the treatment of inflammatory diseases.

SA‐RCL displays a therapeutic effect in the murine arthritis model

Full‐length serpins contain ~400 amino acids and will have significant disadvantages for direct application in drug development. Because our data above indicated that the minimal reactive region of HlSerpin‐a, SA‐RCL, has similar biological activity to the full‐length HlSerpin‐a, we next tested whether SA‐RCL could suppress immune response in vivo too. The CII‐induced arthritis model was generated as described above, and the mice were treated with SA‐RCL instead of full‐length HlSerpin‐a. The results suggested that SA‐RCL also significantly suppressed joint swelling (Fig. 6a,b) and pathological destroys (Fig. 6c,d) in CII‐immunized mice when compared with PBS‐treated positive controls. The spleen sizes of the SA‐RCL group were slightly decreased (Fig. 6e) and the antigen‐specific cell proliferation impaired (Fig. 6f). The cytokine (Fig. 6g) and antibody responses (Fig. 6h) were also decreased in SA‐RCL‐treated groups when compared with the positive controls. These data suggested that tick serpin‐derived minimal reactive peptide SA‐RCL has immunosuppressive activity in vivo and can be utilized as a target to develop the anti‐inflammation reagent.

Figure 6.

Figure 6

Open in a new tab

H1Serpin‐a (SA)‐reaction centre loop (RCL) displays a therapeutic effect in murine arthritis model. (a) SA‐RCL relieved the joint swelling of collagen‐immunized mice. (b) The ankle joint size of mice from negative control (NC), SA‐RCL of phosphate‐buffered saline (PBS)‐treated mice (joints from non‐immunized mice served as NC; *P < 0·05 compared with the PBS group, anova test). (c) Histopathological analysis of joint sections from immunized (PBS, SA‐RCL) or non‐immunized (NC) mice at day 42. The black arrows indicated the immune cell infiltration, cartilage destruction and bone erosion in the positive control group. Magnification 40 (4 × objective lens) and 100 (10 ×); scale bars: 100 μm. (d) Arthritis score of collagen‐immunized mice treated with SA‐RCL or PBS control (**P < 0·01 compared with the PBS group, t‐test). (e) Reduced spleen sizes from mice treated with SA‐RCL compared with PBS controls. (f) SA‐RCL inhibited collagen‐specific proliferation of mouse splenocytes (*P < 0·05 compared with the PBS group, anova test). (g) Cytokine (IL‐6 and TNF‐α) expressions are reduced in splenocytes from SA‐RCL‐treated mice. (h) Reduced collagen‐specific antibody production in SA‐RCL‐treated mice. Results are expressed as mean ± SEM (*P < 0·05, **P < 0·01 and ***P < 0·001 compared with the PBS group, t‐test). The data shown are representative of at least three independent experiments.

Discussion

Serpin is a distinct protein superfamily that has over 1500 sequences identified in the genomes of all kinds of organisms.5, 12 Although they have poor sequence similarities between family members, serpins share a highly conserved core structure that is critical for their functions as protease inhibitors.12, 30 Most of the serpins are indeed serine protease inhibitors, but several have additional cross‐class inhibition functions and inhibit other proteases such as cysteine protease family members caspases and cathepsins.12 For example, a human serpin squamous cell carcinoma antigen SCCA1 is a potent cross‐class inhibitor of the archetypal lysosomal cysteine proteinases Cathepsins K, L and S.31 A Cowpox virus encoded serpin crmA is a specific inhibitor of the IL‐1β converting enzyme (Caspase 1).32 In this study, we showed that both HlSerpin‐a and HlSerpin‐b displayed typical serine protease inhibitory activity that inhibited the enzymatic activity of Cathepsin G and FXa. HlSerpin‐a also shows cross‐class inhibition against the activities of cysteine protease papain and Cathepsin B. HlSerpin‐b has inhibitory activity toward papain, but not Cathepsin B. These data suggested that serpins from arthropods may have distinct inhibitory profiles toward mammal proteases.

Serpins rely on the RCLs to interact with the protease active site cleft.30, 33 The RCL region is also critical for the inhibitory activity of certain serpins to cysteine proteinases.31 By sequence alignment and homology modelling with the 3D structure of tick serpin IRS‐2, we identified the RCL region in HlSerpin‐a and analysed the biological activity of HlSerpin‐a specific RCL. Full‐length serpins usually contain ~350−400 amino acids with high molecular weight and not suitable for direct use as drug candidates. Our data suggested that the minimal reactive region of a tick serpin SA‐RCL displays similar enzymatic inhibitory activity and immunosuppressive properties. Reports by Ambadapadi and colleagues also suggested that peptides derived from Myxomavirus Serp‐1 RCL display independent coagulation and immune modulating activities.34 In a murine vasculitis model, a 14‐amino‐acid peptide (S7) from Serp‐1 RCL significantly improved mouse survival.34 Our current data also suggested that a 20‐amino‐acid RCL peptide from tick serpin can significantly impair cytokine production from immune cells and relieve joint swelling and tissue inflammation in a mouse arthritis model. These results suggested that the RCL region of a functional tick serpin can be designed as an immunotherapy reagent as it has a lack of immunogenicity and is easy for preparation.

Although multiple tick serpins have been reported to regulate the host immune process, including blood coagulation and immune cell activation,35, 36 the underling mechanisms, especially how tick serpins suppress cytokine production from immune cells, remain obscure. Tick serpin Ipis‐1 was reported to inhibit the proliferations of PBMCs and T‐cells by direct binding to these cells.38 IRS‐2 suppresses the production of IL‐6 from dendritic cells, thereby interfering with the IL‐6‐dependent JAK/STAT3 signalling pathway, and impairs Th17 cell maturation.39 Two other serpin genes were previously identified in the same tick species (H. longicornis), and both of them were suggested as potential candidates for anti‐tick vaccines. Tick feedings were significantly impaired in these HlSerpin‐immunized hosts; however, the underlying mechanisms remained unclear.40, 41 Host proteases, for example, cathepsins are reported to participate in immune regulation in a variety of ways. It is not clear whether tick serpins rely on their protease inhibitory activities to regulate the host immune response or not. Muller and colleagues reported that Cathepsins L and K are critical for cytokine production from S. aureus‐infected macrophages.18 Our data also suggested that Cathepsins B and G are required for sufficient activation of mouse macrophage by LPS stimulation. We also found that immunosuppressive properties of HlSerpin‐a and SA‐RCL are impaired in cells lacking Cathepsin B or Cathepsin G expression. This suggested that tick serpins rely on their protease inhibitory activities to suppress the host immune cell activation. This also explains why the minimal reactive region of HlSerpin‐a, SA‐RCL, has immunosuppressive function and could relieve mouse arthritis.

Taken together, our study identified two novel tick serpins from H. longicornis. Both serpins have immunosuppressive activity, and the minimal reactive region of tick serpin RCL displays the immunosuppressive function and relieves the inflammation in vivo. Thereby, the RCL peptide from tick serpin can be designed as an effective anti‐inflammatory reagent for the treatment of inflammatory diseases.

Disclosures

The authors have declared that no conflict of interest exists.

Authors' contributions

F.W., X.N. and J.D. designed the projects and prepared the manuscript. F.W., Z.S., X.Z. and Q.W. performed all the experiments and analysed the data. All authors read and approved the final manuscript.

Supporting information

Figure S1. HlSerpin‐a and HlSerpin‐b did not inhibit the activities of selected host proteases. (a) SB did not inhibit Cathepsin B activity. (b) Both SA and SB have no inhibitory effect on kallikrein. (c and d) SA (c) and SB (d) did not suppress Thrombin activity. (e and f) SA (e) and SB (f) did not inhibit Cathepsin L activity. The data shown are representative of at least three independent experiments.

Click here for additional data file. (692.9KB, tif)

Table S1. Sequences of oligo‐primers used in this study

Click here for additional data file. (39KB, doc)

Acknowledgements

The authors would like to thank Hui Wang, Xiujuan Wang, Chenxiao Huang, Tingting Feng, Kezhen Wang and Wen Pan for technical assistance. This work was supported by a Project funded by the Priority Academic Program Development of Jiangsu Higher Education Institutions, Program for Changjiang Scholars and Innovative Research Team in University (PCSIRT), National Natural Science Foundation of China [31770933, 81971917 (J.D.) and 81872103 (N.X.)], Natural Science Foundation of Colleges in Jiangsu Province [17KJA310005 (J.D.)], Open Project Fund from Key Laboratory of Reproduction Regulation of NHC [No. KF2018‐01 (J.D.)] and Science and Technology Climbing Fund of SIPPR [No.PD2017‐2 (N.X.)]. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Contributor Information

Xiaohua Ni, Email: xhni_sippr@163.com.

Jianfeng Dai, Email: daijianfeng@suda.edu.cn.

References

  • 1. de la Fuente J, Antunes S, Bonnet S, Cabezas‐Cruz A, Domingos AG, Estrada‐Pena A et al. Tick‐pathogen interactions and vector competence: identification of molecular drivers for tick‐borne diseases. Front Cell Infect Microbiol 2017; 7:114. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2. Fang LQ, Liu K, Li XL, Liang S, Yang Y, Yao HW et al. Emerging tick‐borne infections in mainland China: an increasing public health threat. Lancet Infect Dis 2015; 15:1467–79. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3. Simo L, Kazimirova M, Richardson J, Bonnet SI. The essential role of tick salivary glands and saliva in tick feeding and pathogen transmission. Front Cell Infect Microbiol 2017; 7:281. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4. Francischetti IM, Sa‐Nunes A, Mans BJ, Santos IM, Ribeiro JM. The role of saliva in tick feeding. Front Biosci (Landmark Ed) 2009; 14:2051–88. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5. Law RH, Zhang Q, McGowan S, Buckle AM, Silverman GA, Wong W et al. An overview of the serpin superfamily. Genome Biol 2006; 7:216. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6. Kanost MR. Serine proteinase inhibitors in arthropod immunity. Dev Comp Immunol 1999; 23:291–301. [DOI] [PubMed] [Google Scholar]
  • 7. Meekins DA, Kanost MR, Michel K. Serpins in arthropod biology. Semin Cell Dev Biol 2017; 62:105–19. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8. Chmelar J, Kotal J, Langhansova H, Kotsyfakis M. Protease inhibitors in tick saliva: the role of serpins and cystatins in tick‐host‐pathogen interaction. Front Cell Infect Microbiol 2017; 7:216. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9. Blisnick AA, Foulon T, Bonnet SI. Serine protease inhibitors in ticks: an overview of their role in tick biology and tick‐borne pathogen transmission. Front Cell Infect Microbiol 2017; 7:199. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10. Kim TK, Radulovic Z, Mulenga A. Target validation of highly conserved Amblyomma americanum tick saliva serine protease inhibitor 19. Ticks Tick Borne Dis 2016; 7:405–14. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11. Heutinck KM, ten Berge IJ, Hack CE, Hamann J, Rowshani AT. Serine proteases of the human immune system in health and disease. Mol Immunol 2010; 47:1943–55. [DOI] [PubMed] [Google Scholar]
  • 12. Huntington JA. Serpin structure, function and dysfunction. J Thromb Haemost 2011; 9(Suppl 1):26–34. [DOI] [PubMed] [Google Scholar]
  • 13. Conus S, Simon HU. Cathepsins and their involvement in immune responses. Swiss Med Wkly 2010; 140:w13042. [DOI] [PubMed] [Google Scholar]
  • 14. Asagiri M, Hirai T, Kunigami T, Kamano S, Gober HJ, Okamoto K et al. Cathepsin K‐dependent toll‐like receptor 9 signaling revealed in experimental arthritis. Science 2008; 319:624–7. [DOI] [PubMed] [Google Scholar]
  • 15. Matsumoto F, Saitoh S, Fukui R, Kobayashi T, Tanimura N, Konno K et al. Cathepsins are required for Toll‐like receptor 9 responses. Biochem Biophys Res Commun 2008; 367:693–9. [DOI] [PubMed] [Google Scholar]
  • 16. Padrines M, Wolf M, Walz A, Baggiolini M. Interleukin‐8 processing by neutrophil elastase, cathepsin G and proteinase‐3. FEBS Lett 1994; 352:231–5. [DOI] [PubMed] [Google Scholar]
  • 17. Ha SD, Martins A, Khazaie K, Han J, Chan BMC, Kim SO. Cathepsin B is involved in the trafficking of TNF‐ ‐containing vesicles to the plasma membrane in macrophages. J Immunol 2008; 181:690–7. [DOI] [PubMed] [Google Scholar]
  • 18. Muller S, Faulhaber A, Sieber C, Pfeifer D, Hochberg T, Gansz M et al. The endolysosomal cysteine cathepsins L and K are involved in macrophage‐mediated clearance of Staphylococcus aureus and the concomitant cytokine induction. FASEB J 2014; 28:162–75. [DOI] [PubMed] [Google Scholar]
  • 19. Luo LM, Zhao L, Wen HL, Zhang ZT, Liu JW, Fang LZ et al. Haemaphysalis longicornis ticks as reservoir and vector of severe fever with thrombocytopenia syndrome virus in China. Emerg Infect Dis 2015; 21:1770–6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20. Zhuang L, Du J, Cui XM, Li H, Tang F, Zhang PH et al. Identification of tick‐borne pathogen diversity by metagenomic analysis in Haemaphysalis longicornis from Xinyang, China. Infect Dis Poverty 2018; 7:45. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21. Karim S, Ribeiro JM. an insight into the sialome of the lone star tick, amblyomma americanum, with a glimpse on its time dependent gene expression. PLoS ONE 2015; 10:e0131292. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22. Guidotti G, Brambilla L, Rossi D. Cell‐penetrating peptides: from basic research to clinics. Trends Pharmacol Sci 2017; 38:406–24. [DOI] [PubMed] [Google Scholar]
  • 23. Chmelar J, Oliveira CJ, Rezacova P, Francischetti IM, Kovarova Z, Pejler G et al. A tick salivary protein targets cathepsin G and chymase and inhibits host inflammation and platelet aggregation. Blood 2011; 117:736–44. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24. Tirloni L, Kim TK, Coutinho ML, Ali A, Seixas A, Termignoni C et al. The putative role of Rhipicephalus microplus salivary serpins in the tick‐host relationship. Insect Biochem Mol Biol 2016; 71:12–28. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25. Weischenfeldt J, Bone Porse B. Marrow‐derived macrophages (BMM): isolation and applications. CSH Protoc 2008; 2008:pdb prot5080. [DOI] [PubMed] [Google Scholar]
  • 26. Sun T, Wang F, Pan W, Wu Q, Wang J, Dai J. An immunosuppressive tick salivary gland protein DsCystatin interferes with toll‐like receptor signaling by downregulating TRAF6. Front Immunol 2018; 9:1245. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27. Brand DD, Latham KA, Rosloniec EF. Collagen‐induced arthritis. Nat Protoc 2007; 2:1269–75. [DOI] [PubMed] [Google Scholar]
  • 28. Barthold SW, Feng S, Bockenstedt LK, Fikrig E, Feen K. Protective and arthritis‐resolving activity in sera of mice infected with Borrelia burgdorferi. Clin Infect Dis 1997; 25(Suppl 1):S9–17. [DOI] [PubMed] [Google Scholar]
  • 29. Song X, Shen J, Wen H, Zhong Z, Luo Q, Chu D et al. Impact of Schistosoma japonicum infection on collagen‐induced arthritis in DBA/1 mice: a murine model of human rheumatoid arthritis. PLoS ONE 2011; 6:e23453. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30. Huntington JA, Read RJ, Carrell RW. Structure of a serpin‐protease complex shows inhibition by deformation. Nature 2000; 407:923–6. [DOI] [PubMed] [Google Scholar]
  • 31. Schick C, Bromme D, Bartuski AJ, Uemura Y, Schechter NM, Silverman GA. The reactive site loop of the serpin SCCA1 is essential for cysteine proteinase inhibition. Proc Natl Acad Sci USA 1998; 95:13 465–70. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32. Komiyama T, Ray CA, Pickup DJ, Howard AD, Thornberry NA, Peterson EP et al. Inhibition of interleukin‐1 beta converting enzyme by the cowpox virus serpin CrmA. An example of cross‐class inhibition. J Biol Chem 1994; 269:19 331–7. [PubMed] [Google Scholar]
  • 33. Whisstock JC, Silverman GA, Bird PI, Bottomley SP, Kaiserman D, Luke CJ et al. Serpins flex their muscle: II. Structural insights into target peptidase recognition, polymerization, and transport functions. J Biol Chem 2010; 285:24 307–12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34. Ambadapadi S, Munuswamy‐Ramanujam G, Zheng D, Sullivan C, Dai E, Morshed S et al. Reactive Center Loop (RCL) peptides derived from serpins display independent coagulation and immune modulating activities. J Biol Chem 2016; 291:2874–87. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35. Leboulle G, Crippa M, Decrem Y, Mejri N, Brossard M, Bollen A et al. Characterization of a novel salivary immunosuppressive protein from Ixodes ricinus ticks. J Biol Chem 2002; 277:10 083–9. [DOI] [PubMed] [Google Scholar]
  • 36. Assumpcao TC, Ma D, Mizurini DM, Kini RM, Ribeiro JM, Kotsyfakis M et al. In vitro mode of action and anti‐thrombotic activity of boophilin, a multifunctional kunitz protease inhibitor from the midgut of a tick vector of babesiosis, Rhipicephalus microplus. PLoS Negl Trop Dis 2016; 10:e0004298. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37. Prevot PP, Beschin A, Lins L, Beaufays J, Grosjean A, Bruys L et al. Exosites mediate the anti‐inflammatory effects of a multifunctional serpin from the saliva of the tick Ixodes ricinus. FEBS J 2009; 276:3235–46. [DOI] [PubMed] [Google Scholar]
  • 38. Toyomane K, Konnai S, Niwa A, Githaka N, Isezaki M, Yamada S et al. Identification and the preliminary in vitro characterization of IRIS homologue from salivary glands of Ixodes persulcatus Schulze. Ticks Tick Borne Dis 2016; 7:119–25. [DOI] [PubMed] [Google Scholar]
  • 39. Palenikova J, Lieskovska J, Langhansova H, Kotsyfakis M, Chmelar J, Kopecky J. Ixodes ricinus salivary serpin IRS‐2 affects Th17 differentiation via inhibition of the interleukin‐6/STAT‐3 signaling pathway. Infect Immun 2015; 83:1949–56. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40. Sugino M, Imamura S, Mulenga A, Nakajima M, Tsuda A, Ohashi K et al. A serine proteinase inhibitor (serpin) from ixodid tick Haemaphysalis longicornis; cloning and preliminary assessment of its suitability as a candidate for a tick vaccine. Vaccine 2003; 21:2844–51. [DOI] [PubMed] [Google Scholar]
  • 41. Imamura S, da Silva Vaz Jr I, Sugino M, Ohashi K, Onuma M. A serine protease inhibitor (serpin) from Haemaphysalis longicornis as an anti‐tick vaccine. Vaccine 2005; 23:1301–11. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Figure S1. HlSerpin‐a and HlSerpin‐b did not inhibit the activities of selected host proteases. (a) SB did not inhibit Cathepsin B activity. (b) Both SA and SB have no inhibitory effect on kallikrein. (c and d) SA (c) and SB (d) did not suppress Thrombin activity. (e and f) SA (e) and SB (f) did not inhibit Cathepsin L activity. The data shown are representative of at least three independent experiments.

Click here for additional data file. (692.9KB, tif)

Table S1. Sequences of oligo‐primers used in this study

Click here for additional data file. (39KB, doc)

Articles from Immunology are provided here courtesy of British Society for Immunology

RESOURCES