Skip to main content
Scientific Reports logoLink to Scientific Reports
. 2019 Dec 10;9:18706. doi: 10.1038/s41598-019-55155-1

Genetic analysis of the invasive alga Didymosphenia geminata in Southern Argentina: Evidence of a Pleistocene origin of local lineages

Leandro R Jones 1,2,, Julieta M Manrique 1,2, Noelia M Uyua 1,2,4, Brian A Whitton 3
PMCID: PMC6904681  PMID: 31822736

Abstract

The diatom Didymosphenia geminata has gained notoriety due to the massive growths which have occurred in recent decades in temperate regions. Different explanations have been proposed for this phenomenon, including the emergence of new invasive strains, human dispersion and climate change. Despite the fact in Argentina nuisance growths began in about 2010, historical records suggest that the alga was already present before that date. In addition, preliminary genetic data revealed too high a diversity to be explained by a recent invasion. Here, we estimate the divergence times of strains from southern Argentina. We integrate new genetic data and secondary, fossil and geological calibrations into a Penalized Likelihood model used to infer 18,630 plausible chronograms. These indicate that radiation of the lineages in Argentina began during or before the Pleistocene, which is hard to reconcile with the hypothesis that a new variant is responsible for the local mass growths. Instead, this suggests that important features of present distribution could be the result of multiple recent colonizations or the expansion of formerly rare populations. The text explains how these two possibilities are compatible with the hypothesis that recent nuisance blooms may be a consequence of climate change.

Subject terms: Invasive species, Phylogenetics

Introduction

The colonial diatom Didymosphenia geminata (Lyngbye) Schmidt has been abundant in some rivers of the north temperate zone for many years. However, there are very few records before the last 30 years for other regions of the World1,2. In 1989 growths suddenly developed in rivers of the central region of Vancouver Island in Canada. Since then, many rivers from temperate regions worldwide have been studied carefully enough to be certain that there have also been major increases. Mass growths consist of epiphytic and epilithic accretions of thick mats mainly composed of branched stalks made of a matrix of polysaccharides, uronic acids and proteins3,4. The stalk mass greatly exceeds material inside the cell. D. geminata colonies can grow together with other benthic diatoms. In addition, organic debris and small organisms are often entangled in the mats. Mass growths are sometimes sufficient to cover not only the bed of a river, but also its vegetation. Although the alga is not considered harmful for human health, it is widely accepted that it has the potential of altering an ecosystem and producing negative impacts on human activities5,6. This has generated much concern and prompted control programs in some countries.

There is still no precise explanation for the behavior of the alga in recent decades. The temporal co-occurrence of mass growths along with increased sport fishing activity during the early Vancouver Island blooms7 fueled the hypothesis that the overgrowths could be due to dispersion by recreational fishermen. In addition, the facts that D. geminata rapidly invaded many New Zealand rivers and has been reported to be introduced species there8,9 have suggested that the nuisance growths elsewhere also were due to colonization of ecosystems in which the alga was formerly absent. That the overgrowths could be a consequence of the emergence of a new variant with increased growth and invasion capabilities has also been considered. These hypotheses were rapidly and widely accepted, strongly influencing management actions. Ecological, histochemical and experimental studies have reported a relationship between dissolved reactive phosphorus and D. geminata mass growths, which has led some authors to propose a link between the abnormal overgrowths and altered phosphate release regimes7,10,11. However, Ellwood and Whitton12 and Whitton et al.2 suggested it was increased concentrations of organic, rather than dissolved reactive phosphate, resulting from climate change which were responsible. Later on, parameters other than phosphorous (but that also can be affected by climate change), such as pH, hydrology (discharge and water movement) and irradiation, also have been suggested as possible bloom triggers, based on statistical correlations6,1315.

Since 2010, the presence of D. geminata has been reported in several rivers and lakes distributed from about parallel −35° to Tierra del Fuego island at the Southern extreme of South America (reviewed in reference16). The hypothesis of a new invasive species has had quite a lot of acceptance. However, there is a record of the alga in the Bosque Andino Patagónico ecoregion that date back to the 1960s17, that is more than 40 years before the nuisance overgrowths wave. Asprey et al.17 reported the presence of D. geminata only at two out of eight sites surveyed and rare compared to other algae. The collected material was seen by one of the authors of the present study (BAW), who could confirm it corresponded to D. geminata. However, the sampling procedure used by J. F. Asprey in the field was designed for large plankton17; the presence of the alga in its usual environment, attached to river bed and submerged vegetation, was not investigated. There is only one further mention of D. geminata before 2010, for the Mejillones commune in Chile18. Neither the exact collection date of the Mejillones material nor the corresponding sampling method are provided in reference18. However, based on other data mentioned therein, the specimens could have been collected sometime between the end of XIX century and the first half of century XX. Thus, benthic data before 2010 are insufficient to be certain that D. geminata was not already present in the region before the recent overgrowths. Moreover, molecular studies have uncovered an interesting and apparently complex scenario. Chloroplast intergenic sequences from New Zealand are much homogeneous than sequences from elsewhere, which has been interpreted as evidence that the species is new in New Zealand9. Conversely, preliminary 18S data from Argentina revealed a diversity too high to be explained by a recent introduction, especially if we consider that intergenic regions are expected to diverge faster than ribosomal genes16. This, together with the existence of historical records, suggests the possibility that D. geminata could be a formerly rare native (or anciently introduced) species.

In this work, we set out to contrast the alternative explanations for the nuisance growths in Argentina using genetic data. The incipience of molecular studies results in difficulties to generate sequence data because it requires using primers designed based on the few available D. geminata sequences, or primers targeting a wide range of taxa. The later procedure is not a straightforward solution, because other microorganisms and organic debris are usually entangled into D. geminata mats, the material usually chosen for sampling, which results in co-amplification of sequences from other taxa when using nonspecific primers. The possible solutions include cloning the sequences amplified by nonspecific primers (followed by selection of the clones harboring D. geminata sequences) or physically isolating cells prior to PCR amplification, which is the strategy used in the present study. Furthermore, D. geminata mats, and probably cells, are recalcitrant to DNA extraction and downstream molecular applications, hence some samples cannot be amplified despite the use of cell isolation and/or optimized protocols19. Here, we optimized the conditions to generate nuclear ribosomal DNA (rDNA; 18S, ITS1, 5.8S, ITS2 and 28S loci), mitochondrial cytochrome c-oxidase subunit 1 (COX-1) and plastid rbcl sequences. We then inferred the time that should have elapsed to generate the local diversity. We reasoned that, if the Argentine strains represent the descendants of a new, highly invasive variant, then the time to their most recent common ancestor (tMRCA) should be small, in the order of some tens of years. Otherwise, the tMRCA should be of a few My, based on the oldest fossils known for the species and related taxa worldwide.

Results

Molecular data generation

We obtained no, poor and/or non-specific amplification products despite previously published PCR conditions being implemented using either whole mat material (WBS-DNA) or isolated cells (IC-DNA) as template (not shown). This could, however, be improved by assessing several primer combinations and nesting schemes and carefully tuning the corresponding annealing temperatures. For each primer combination evaluated (Tables 1 and 2), the annealing temperature was optimized by a gradient PCR (50 to 65 °C in steps of ~1.5 °C) using WBS-DNA as template. Once optimal temperatures were determined, these were re-assessed using IC-DNA as template. The results of these experiments, including PCR performance and optimized temperatures, are outlined in Table 2. Out of 10 primer combinations evaluated, 8 were able to generate amplicons suitable for direct sequencing after PCR optimization (Table 2). All the samples could be amplified with primer pairs EUK528f-etts3rev and eits2dir-etts3rev (Experiment E in Table 2), but the obtained sequences corresponded to contaminant, environmental DNA. For one of the samples from the Futaleufú River (FTa), the amplified 28S sequences did not correspond to D. geminata and the rbcl PCR produced negative results. No data could be generated for five samples from four different rivers, because no DNA could be amplified (samples QQ, QM and TR and 18S, ITS1-2, 5.8S and rbcl loci from samples DVa and DVb) or because the amplified sequences didn’t correspond to D. geminata (28S amplicons from samples DVa and DVb).

Table 1.

Oligonucleotides used in PCR assays.

Primer Sequence (5´ - 3´)a Reference
GazF1 GTAGGTGAACCTGCGGAAGGA 52
GazR2 GGATGACCAAARAACCAAAA 52
COI-F ATGATHGGDGCDCCWGAYATG 23
COI-R CCWCCHCCHGCDGGRTC 23
DPrbcL1 AAGGAGAAATHAATGTCT 54
DPrbcL7 AARCAACCTTGTGTAAGTCTC 54
rbcL-F ATGTCTCAATCTGTAWCAGAACGGACTC 23
rbcL-R TAARAAWCKYTCTCTCCAACGCA 23
D602F GTTGGATTTGTGATGGAATTTGAA 21,51
D1670R CACCAGTAAAGGCATTAGCTG 21,51
UNI17F ACCTGGTTGATCCTGCCAG 55
UNI1534R TGATCCTTCYGCAGGTTCAC 55
EUK528f CCGCGGTAATTCCAGCTC 53
eits2dir GTAGGTGAACCTGCGGAAGGA 53
etts3rev GGGGAATCCTTGTTAGTTTC 53
ITS-F CSMACAACGATGAAGRRCRCAGC 23
ITS-R TCCCDSTTCRBTCGCCVTTACT 23
D1R-F ACCCGCTGAATTTAAGCATA 56
D3B-R TCGGAGGGAACCAGCTACTA 56
D2C-R CCTTGGTCCGTGTTTCAAGA 56

aNon-DNA characters correspond to IUPAC codes.

Table 2.

PCR optimization outline.

Experiment Targeta PCR Round Forward Reverse WBS-DNAb IC-DNAb Annealingc
A COX-1 1 GazF1 GazR2 +/− ND 50.0
2 COI-F COX-R + + 59.9
B rbcL 1 DPrbcL1 DPrbcL7 +/N + 52.9
2 rbcL-F rbcL-R + + 55.0
C 18S 1 D602F D1670R +/N + 52.3
D ITS1-5.8S-ITS2 1 eits2dir etts3rev + ND 52.4
2 ITS-F ITS-R N N 63.8
E ITS1-5.8S-ITS2 1 EUK528f etts3rev +/N + 59.1
2 eits2dir etts3rev + + 55.5
F ITS1-5.8S-ITS2 1 602F etts3rev +/N + 52.4
2 eits2dir etts3rev + + 55.5
G ITS1-5.8S-ITS2 1 602F etts3rev +/N + 52.4
2 ITS-F etts3rev + + 55.5
H ITS1-5.8S-ITS2 1 602F ITS-R +/N + 52.4
2 eits2dir ITS-R + + 55.5
I ITS1-5.8S-ITS2 1 602F ITS-R +/N + 52.4
2 ITS-F ITS-R + + 55.5
J 28S 1 D1R-F D3B-R +/N ND 63.8
2 D1R-F D2C-Rb +/N + 52.9

aCoding/transcribed sequence.

bPCR performance using mat (WBS) or isolated cells (IC) DNA as template. ND not detectable; +/− presence of faint band of the expected size; + presence of a good quality band of the expected size; D/+ some samples negative; N nonspecific amplification, +/N presence of a good quality band of the expected size accompanied by nonspecific bands.

cOptimized annealing (this study); °C.

Phylogenetic inference

As a first step in the dating analyses, we placed the Argentine sequences phylogenetically in the context of other diatom groups. This was done to ensure including a representative sample of the diatom diversity for estimating our molecular clock rates. Overall, we could compile 18S, 28S and rbcl sequences from 76 diatom species encompassing the major groups2033. There were too few COX-1 sequences available for these taxa and the available ITS and 5.8S sequences could not be aligned confidently, so these loci were not used in the dating analyses. Previous studies have reported conflicting phylogenetic signals between different genes in some diatoms, which has been attributed to phenomena like differential retention of paralogs, horizontal gene transfer, heteroplasmic variation and deep coalescence24,31,34. Thus, we identified all the species or specimens having discordant relationships between the markers studied. The criterion implemented was that phylogenetic assignments between all the loci after both Maximum Likelihood and Parsimony analyses were to be compatible. The specimens that did not satisfy this criterion were dismissed from posterior analyses. The selected sequences are listed in Table 3. These sequences were aligned together with the Argentine D. geminata sequences and submitted to the evolutionary analyses described below.

Table 3.

Diatom and outgroup sequences used in evolutionary analyses.

Species 18S 28S rbcl Reference
Anomoeoneis sculpta KJ011611.1 KJ011556.1 KJ011794.1 30
Cymbella aspera KJ011617.1 KJ011560.1 KJ011799.1 30
Cymbella helvetica KJ011621.1 KJ011565.1 KJ011804.1 30
Cymbella mexicana KJ011624.1 KJ011568.1 KJ011807.1 30
Cymbella proxima KJ011625.1 KJ011569.1 KJ011808.1 30
Cymbella tumida KJ011629.1 KJ011573.1 KJ011812.1 30
Cymbopleura inaequalis KJ011631.1 KJ011575.1 KJ011814.1 30
Cymbopleura naviculiformis KJ011632.1 KJ011576.1 KJ011815.1 30
Didymosphenia dentata KJ011635.1 KJ011579.1 KJ011818.1 30
Didymosphenia siberica KJ011637.1 KJ011581.1 KJ011820.1 30
Gomphoneis minuta KJ011648.1 KJ011589.1 KJ011831.1 30
Gomphonema clevei KC736623.1 JQ354596.1 KC736598.1 26,27
Mayamaea atomus JN418600.1 JN418633.1 JN418670.1 32
Pinnularia acuminata JN418597.1 JN418630.1 JN418667.1 32
Pinnularia altiplanensis JN418573 JN418606 JN418643 32
Pinnularia grunowii JN418588 JN418621 JN418658 32
Pinnularia microstauron JN418568 JN418601.1 JN418638 32
Pinnularia nodosa JN418587 JN418620 JN418657 32
Pinnularia sp. JN418581.1 JN418614 JN418651 32
Pinnularia subcommutata JN418584 JN418617 JN418654 32
Pinnularia viridiforme JN418589.1 JN418622.1 JN418659.1 32
Pinnularia viridiformis JN418574 JN418607 JN418644 32
Sellaphora blackfordensis JN418599.1 JN418632.1 JN418669.1 32
Cocconeis_stauroneiformis AB430614.1 AB430654.1 AB430694.1 29
Cyclophora_tenuis AJ535142.1 AB430634.1 AB430673.1 29
Fragilaria bidens AB430599.1 AB430636.1 AB430676.1 29
Pteroncola inane AB430607.1 AB430647.1 AB430687.1 29
Nanofrustulum shiloi AM746971.1 AB430640.1 AB430680.1 29
Opephora sp. AB430604.1 AB430643.1 AB430683.1 29
Plagiostriata goreensis AB430605.1 AB430644.1 AB430684.1 29
Pseudostaurosira brevistriata AB430608.1 AB430648.1 AB430688.1 29
Licmophora paradoxa AB430601.1 AB430639.1 AB430679.1 29
Tabularia laevis AB430610.1 AB430650.1 AB430690.1 29
Pseudohimantidium pacificum AB430606.1 AB430645.1 AB430685.1 29
Grammatophora marina AB430600.1 AB430637.1 AB430677.1 29
Hyalosira delicatula AF525654.1 AB430638.1 AB430678.1 29
Hyalosira tropicalis B430612.1 AB430652.1 AB430692.1 29
Rhabdonema minutum AB430603.1 AB430642.1 AB430682.1 29
Diatoma moniliforme AB430597.1 AB430635.1 AB430674.1 29
Thalassiothrix longissima AB430611.1 AB430651.1 AB430691.1 29
Dimeregramma minor AB430598.1 AB425083.1 AB430675.1 29
Rhaphoneis sp. AB430602.1 AB430641.1 AB430681.1 29
Aulacoseira granulata AB430586.1 AB430619.1 AB430659.1 29
Stephanopyxis turris KJ671710.1 AB430623.1 KJ671818.1 23,29
Hyalodiscus scoticus AB430587.1 AB430620.1 AB430660.1 29
Eunotogramma laevis AB430593.1 AB430628.1 AB430668.1 29
Cymatosira belgica X85387.1 AB430627.1 AB430667.1 29
Odontella sinensis Y10570.1 AB430630.1 Z67753.1 28,29
Cyclotella meneghiniana AB430591.1 AB430625.1 AB430665.1 29
Stephanodiscus sp. AB430594.1 AB430631.1 AB430670.1 29
Skeletonema tropicum KJ671709.1 AB572824.1 KJ671817.1 23,33
Thalassiosira nordenskioeldii KJ671714.1 HM991680.1 KJ671822.1 23
Dictyota dichotoma AF350227.1 AF331152.1 AY422654.1 22,29
Heterosigma akashiwo LC214052.1 AF409124.1 AB176660.1 20

The aligned data presented 3754 positions with 1872 patterns of which 1341 were parsimony informative. Phylogenetic analyses recovered the major diatom groups with good branch supports (Fig. 1). The few nodes that were inconsistent between the Maximum Likelihood and Parsimony topologies presented low (<80) or no (<50) bootstrap supports. Furthermore, most alternative resolutions of such nodes were coincident with the most frequent resolution in the alternative method. For example, Mediophyceae was the sister clade of Bacillariophyceae (i.e. same as in ML tree) in 30 parsimony bootstrap trees and it was the sister clade of Coscinodiscophyceae (i.e. same as in Parsimony analysis) in 30 ML bootstrap topologies. Likewise, Cocconeis stauroneiformis was placed as the sister clade of Naviculales in 23 ML bootstrap trees and displayed the same position as in the ML bootstrap tree among 18 Parsimony bootstrap trees. Cymbella mexicana, C. proxima and Didymosphenia were always recovered as a monophyletic group. Nonetheless, the positioning of C. mexicana was erratic among the Parsimony bootstrap trees, where it was recovered either as the sister species of Didymosphenia (Fig. 1), the sister of C. proxima (17 trees), forming a trichotomy with Didymosphenia and C. proxima (8 trees) or as the sister species of (Didymosphenia + C. proxima) (25 trees). Uncertainty was considerable regarding the phylogenetic placement of other Cymbellaceae (Fig. 1). Didymosphenia and D. geminata were strongly supported in both analyses. D. siberica was the sister of D. geminata in 75 Parsimony Bootstrap trees and in 83 ML ones (Fig. 2). The most frequent alternative resolutions were D. dentata and D. siberica monophyletic (8 Parsimony and 8 ML bootstrap trees), the three species forming a trichotomy (8 Parsimony bootstrap trees) and D. dentata and D. geminata monophyletic (8 ML bootstrap trees). Despite D. geminata was well supported and the Parsimony analysis resulted in only 6 optimal topologies, the supports within the D. geminata clade were low, indicating that the data support different plausible phylogenies for our sequences. To take into account this uncertainty as well as the minor differences between the relationships of major diatom groups, we performed the dating analyses using the ML and Parsimony trees and the full sets of Parsimony and ML bootstrap trees (detailed below).

Figure 1.

Figure 1

Maximum Likelihood (ML) and Parsimony (Pars) phylogenies of the sequences used in dating analyses. Black dots indicate clades that were collapsed for enhanced display (numbers of accrued terminals are given in parentheses in tip names). Colored dots on internal nodes indicate the clades that were recovered by both Parsimony and Maximum Likelihood analyses. Numbers close to branches correspond to bootstrap supports. Numbers in red indicate no (<50) or low (<80) support.

Figure 2.

Figure 2

Calibration points implemented in dating analyses. A cladogram (A) and a phylogram (B) are displayed, corresponding to the topology obtained by Maximum Likelihood. Closed circles on nodes correspond to calibration points (white numbers on circles in panel A coincide with node numbers in Table 4). All the calibrated nodes but the node labeled 3 were shared with the corresponding Parsimony phylogeny (please see Fig. 1 and main text for detailed comparisons). Some clades were collapsed for enhanced display (numbers of accrued sequences are given in parenthesis in the corresponding terminal names). Numbers close to branches correspond to bootstrap supports > 50. Numbers below the phylogram correspond to mid-ranges between the minimum and maximum bounds implemented in the clock model (see also Table 4). Each D. geminata terminal is representative of 50 individual cells.

Molecular clock parameters assessment

To assess the performance of different model parameter configurations, we implemented a cross-validation (CV) criterion (Materials and Methods). The smaller CV score (97.9) was obtained from one of our most parsimonious trees when it was analyzed using values of λ and k of 0.33 and 2, respectively. The ML tree resulted in the smaller CV when we set λ = 0 and k = 2. A few combinations of parameters resulted in very high CVs with some of our trees (Fig. 3). Nonetheless, these same configurations, in combination with other trees, produced average CVs. As instance, setting k = 4 and λ = 1 resulted in a very high CV when used with one of our most parsimonious trees. However, the same configuration produced relatively small CVs when used along the rest of our Parsimony and the ML trees. Furthermore, the majority of configurations and trees resulted in very similar CVs. In Fig. 4, where both the tMRCAs obtained from each reference tree and the corresponding CVs are shown, the majority of tMRCAs (points) are colored in intense green, meaning that the corresponding scores were small. In the same Figure, only a small fraction of the points is colored brown or red, which correspond to comparatively ‘bad’ (high) CVs. Moreover, it is easy to appreciate, by looking at Figs. 3 and 4 together, that these ‘bad’ CVs do not correspond to any combination of parameters. Thus, we integrated the results obtained under all the settings implemented.

Figure 3.

Figure 3

Cross-validation analyses. Each panel depicts the results obtained with a value of λ (0 to 1) combined with different numbers of rate categories (k; 2 to 10). ML Maximum Likelihood; Pars Parsimony.

Figure 4.

Figure 4

Time to the MRCA of the Argentine D. geminata strains inferred from optimum Maximum Likelihood (ML) and Parsimony (Pars) trees along all the λ and k combinations (Fig. 3). Points are colored according to the corresponding cross-validation scores (CV).

Divergence times estimation

The tMRCAs obtained with the parameters that produced the lowest CVs were 10.41 My (Parsimony analysis) and 3.74 My (Maximum Likelihood analysis). The analyses of the optimal Maximum Likelihood tree along all the k and λ configurations (n = 90) produced tMRCAs of the Argentine D. geminata strains ranging from ~0.5 to ~26 My (Q1 = 1.48, Q3 = 4.81; Fig. 4), whereas the tMRCAs obtained using the six most parsimonious trees (n = 540) ranged from 1.19 to 19 My (Q1 = 5.36; Q3 = 13.72; Fig. 4). As mentioned above, to further weigh the effect of phylogenetic uncertainty, we also inferred chronograms from the bootstrap trees obtained by both ML and Parsimony. We used the full range of parameters’ combinations on each bootstrap tree, thus obtaining a total of 18,000 chronograms. The central 75% of the tMRCAs obtained from the ML and Parsimony chronograms combined fell in a time span running from 1.4 to 7.5 Ma. Individually, the ML bootstrap trees produced tMRCAs ranging from 0.06 to 74.75 My (Q1 = 1.17; Q3 = 3.09), whereas the corresponding Parsimony trees generated estimates ranging from 0.02 to 69.57 My (Q1 = 1.46; Q3 = 12). The whole analysis is summarized and compared to previous geological data and a fossil-based diatom biochronology in Fig. 5. Remarkably, many of the tMRCAs estimated here fell in a period of time roughly coinciding with the Great Patagonian Glaciation (GPA) between 1.17 and 1 Ma35. Moreover, the large majority of the obtained tMRCAs were coincident with a period of intense diatom turnover and diversification in the northern hemisphere36.

Figure 5.

Figure 5

D. geminata chronology in Southern Argentina. The histogram summarizes the tMRCAs of the Argentine strains, inferred from 100 Maximum Likelihood (ML) and 100 Parsimony (Pars) bootstrap trees. Each tree was analyzed with 90 different λ and k combinations, giving a total of 18,000 chronograms. The color bars below the histogram represent the age ranges obtained using optimal ML and Pars trees (details in Fig. 4). The upper part of the figure shows the relative diversity of five diatom genera in the Neogene and Quaternary of USA; based on reference36. GPG Great Patagonian Glaciation (~1.17–1 Ma); BPG Beginning of Patagonian Glaciations (~7–5 Ma); MMCO Mid-Miocene Climatic Optimum (~15–17 Ma).

Discussion

Here, we used genetic data to evaluate alternative explanations for the nuisance D. geminata overgrowths which have occurred in recent times in Argentina. Data from seven loci were generated, including nuclear (18S, ITS-1, 5.8S, ITS-2 and 28S), mitochondrial (COX-1) and plastidic (rbcl) markers, and homologous sequences were searched among other groups of diatoms. The search resulted in a selection of sequences from 3 genes (18S, 28S, and rbcl) that were well represented in the major diatom groups. These sequences were combined with geological, fossil and secondary calibrations to set a molecular clock that allowed us to infer a chronology for the strains present in Argentina. As discussed in detail below, the chronology suggests that the alga has recently become abundant or that several ancient D. geminata lineages have been recently introduced.

Generating D. geminata molecular data is difficult19. No 28S and COX-1 data have been reported before for this species. There is a single ribosomal 18S sequence from the old world, obtained in the context of a broad study of other diatom groups26, and another from New Zealand21. The previous data from the American continent includes 28 molecular clone sequences of the 18S gene from eastern rivers of the USA25, a single 18S sequence from Colorado (USA) and 15 18S sequences from southern Argentina and Chile16,24. Sequence data have also been reported for the ribulose-1,5-biphosphate carboxylase/oxygenase large subunit (rbcl) gene of 9 samples from Chile24. The amplification of the ITS1, 5.8S and ITS2 loci resulted to be particularly challenging. All the primers combinations tested produced nonspecific or multiband amplifications except the ones including one didymo-specific primer in the first PCR rounds, which we attribute to an enhanced variability of these markers. On the other hand, the use of D. geminata-specific primers in the 18S amplifications allowed us to generate good DNA amounts in a single PCR round using both IC-DNA and WBS-DNA as template. This can be helpful when molecular cloning or cell isolation cannot be afforded, as for example when analyzing large amounts of samples. Despite using optimized DNA extraction and PCR conditions, no data could be generated for five samples and two loci from a sixth. This might reflect the persistence of enzymatic inhibitors19. However, the amplification of environmental DNA in several experiments suggests that in some cases the absence of D. geminata amplicons might respond to sequence variability, which requires further study.

The chronology inferred for the strains from Argentina is summarized in Fig. 5. Overall, our results indicate that the common ancestor of the Argentine sequences probably lived during the Pleistocene or before. The younger tMRCA inferred from our 18,630 chronograms was 26,134 years and only about 10% (1911) of these chronograms supported tMRCAs shorter than 1 My. This makes it very unlikely that the nuisance growths from Argentina be caused by a novel variant of the species (in which case the actual tMRCA should be much smaller; maybe some tens of years). Taking into account the divergence times inferred in this work, in order for the ‘new variant’ hypothesis to be valid it would be necessary to assume that a mutant strain has emerged somewhere, and that this mutant was recently brought to the region and the mutation was transferred to ancient strains by sexual reproduction. We have observed populations with different average cell sizes, suggesting that cycles of cell size reduction and restitution may occur (unpublished results). However, to the best of our knowledge, there is no yet confirmation that size restitution is accompanied by sexual reproduction in D. geminata.

If it is assumed that the presence of D. geminata in South America is recent, a hypothesis based on our results is that the corresponding colonization was carried out by multiple ancient lineages. This idea (high propagule pressure) has been used to explain the high genetic diversity observed in two rivers in Maryland, USA25. A high propagule pressure could be a consequence, for example, of anglers spreading propagules consisting of many cells. As already explained, the concept that the recent nuisance behavior of the alga is associated with its dispersion along with fishing equipment is entrenched in some areas. However, previous studies indicate that D. geminata cells are easily killed by physical stress such as drying, salt and freezing37, which raises doubts about this explanation. The sensitivity of D. geminata cells to environmental stressors suggests that long-distance dispersion events are rare and probably achieved by very few cells. This concept is compatible with the genetic homogeneity observed in New Zealand9, where the species is likely a recent invader. A plausible way in which multiple D. geminata lineages could have arrived to South America is along with fish stocks brought to the region. P. J. Macchi and collaborators conducted a survey whereby they determined that between 1 and 8 foreign species were introduced into 28 basins between 1904 and 196538. For example, more than 4 million exemplars of Salvelinus fontinalis were released in the Negro River basin in 1904 and about 3 million exemplars of Onchorhynchus mykiss in 192439. However, it is not known if the conditions in man-made fish stocks permit D. geminata to survive.

Another possible explanation for the present results is that D. geminata may has been present in the region since ancient times but in very low abundance. There are previous fossil and extant taxa data that are compatible with this. Fossils of Didymosphenia spp. and Cymbella mexicana, the sister species of the genus Didymosphenia according to previous studies30 and our own results (Figs. 1 and 2), have been described in sedimentary rocks of the Miocene of North America and Japan40,41. This indicates that in that period there were already stem Didymosphenia species. In addition, the presence of D. geminata fossils has been reported in Pliocene sediments from China42. Thus, the species of the genus Didymosphenia likely have had plenty of time to disperse. By the other side, the cooling after the Mid-Miocene Climatic Optimum (MMCO) has allowed the establishment of temperate species in latitudes that formerly were too warm43. A nice example of this phenomenon is the diatoms biochronology studied by W. N. Krebs et al.36 (depicted in the upper panel of Fig. 5), which reflects the expansion and diversification of three diatom genera as a consequence of climate cooling in a region now corresponding to North America. The cooling after the MMCO also played a significant role in the configuration of the South American biota. Sérsic et al.44 and Hazzi et al.45 synthesized the available information for various groups of plants and animals. Hence, the species of the genus Didymosphenia have probably had the possibility of colonizing the land masses that now correspond to southern South America since the middle to late Neogene. This, together with the tMRCAs inferred here and the 20th century sporadic records, support the new hypothesis that D. geminata may has been present in the region since ancient times. The genetic diversity we observed could be consequence of the geoclimatic events occurred in the pre-Quaternary/Quaternary. For example, the Patagonian glacial cycles could have driven the establishment of various D. geminata lineages through phenomena like extinction/recolonization cycles (multiple introductions) and/or niche contraction/expansion (local diversification), as observed for other taxa from South America and elsewhere44,46,47. The divergence times inferred in this study are close to the divergence times of taxa believed to have been affected by Patagonian glaciations, which, in addition to the cooling and heating cycles, produced changes in the patterns of water courses and lakes, and the position of the continental divide. Our hypothesis predicts that D. geminata genotypes should have a more or less structured geographic distribution. Previous molecular studies revealed the existence of cryptic variation and a geographical structure between Gomphonema parvulum demes48,49, suggesting that it may also happen in D. geminata. Our hypothesis also predicts that there should be ancient D. geminata fossils in South American, but rare. Future research should aim to deepen genetic studies and investigate the fossil record, which will allow further insight on the possibility that D. geminata is an ancient, formerly rare species.

In summary, the results presented here are compatible with three possible scenarios: (i) that the recent overgrowths are due to the recent introduction of multiple lineages; (ii) that the species was already present and that for some reason it became more abundant; (iii) that a mutant lineage was recently introduced and dispersed new genes conferring an exacerbated invasiveness. The first two hypotheses, which are the ones we prefer for requiring less ad-hoc hypotheses, are compatible with the idea that an ecological factor may have been altered (or reached a threshold) recently, affecting (broadening?) the niche of the alga. Maybe a factor altered by climate change. Whitton et al.2 and Watson et al.6 reviewed the evidence suggesting that climate change has influenced some environmental factors and hence the competitive success of D. geminata elsewhere. If this is what happened in Argentina, we could be witnessing a conspicuous effect of climatic change and an example of its unpredictable consequences on worldwide distributed aquatic ecosystems.

Materials and Methods

Samples

D. geminata mats were collected at eight rivers distributed along about 1600 km in western Argentinean Patagonia and Tierra del Fuego. Sixteen samples (Table S1) were selected based on presence, abundance and integrity of cell content, complexity (i.e. proportion of didymo cells relative to debris and other microorganisms in the samples), river bed coverage (>50 m2), and geographic origin. The studied samples are from the Yelcho (samples FTa, FTb, FTc, FTd, FTe, FTf and RI; Futaleufú and Rivadavia Rivers), Puelo (samples AZa, AZb and QM; Azul and Quemquemtreu rivers), Chubut (sample CH; Chubut river), Santa Cruz (samples DVa, DVb and TR; De las Vueltas and Toro rivers), Valdivia (sample QQ; Quilaquina river) and Grande (sample GD; Grande River) basins. All the sampling sites are located in the Andean Patagonian Forest (Bosque Andino Patagónico, BAP) ecoregion except for Chubut River and Grande, which are close to the BAP/Patagonian Steppe ecotone. Details on sampling procedures and DNA extraction methods have been described elsewhere16,19,50.

PCR amplification and sequencing

PCR amplifications were optimized using DNA templates (1 µl volume of purified DNA suspensions) obtained from both whole benthic samples (i.e. whole mat material; WBS) and didymo cells (50 per sample) isolated from the mats by mouth pipeting (IC). PCRs were made using oligonucleotides described in previous studies21,23,5156, which are detailed in Table 1. All the reactions were carried out in a MyCycler Thermal Cycler (BioRad) applying programs consisting of an initial denaturation step at 95 °C for 1 min, followed by 30 cycles of 95 °C for 30s, an annealing step of 30s and an extension step at 72 °C for 1 min/Kb, and a final extension step of 72 °C for 1 min. PCR products were analyzed by electrophoresis in agarose gels (1.8% in 1X Tris-Acetate-EDTA buffer) stained with Redgel (Biotum) and visualization under UV light. A molecular weight marker, 1 Kb Plus DNA Ladder (Invitrogen), was included in parallel in each gel. For sequencing, three independent PCRs were purified using QIAquick PCR Purification Kit (QIAGEN) according to manufacturer instructions, and the obtained products were re-analyzed by electrophoresis, as mentioned before, but including a mass ruler (Low DNA Mass Ladder; Invitrogen) to quantify the DNA by densitometric analysis using the program Image J57. The purifications were also checked by photometric analysis using a Nano spectrophotometer Nano Vue plus (GE Health Science) and finally sequenced by Sanger chemistry using amplification oligos. Chromatogram data processing and sequence assemble were performed with the newer version of BioEdit58. Polymorphic sites (double peaks) were coded using IUPAC codes. The obtained sequences were deposited in GenBank under accession numbers KY007192-KY007220 and MK291483-MK291492 (Table S1).

Sequence alignment

Sequences were aligned by the program MAFFT using the linsi iterative refinement method59. The obtained alignments were visually inspected using Jalview software60. For phylogenetic analyses, the different markers analyzed were aligned separately and then concatenated.

Phylogenetic inference

Maximum Likelihood trees were inferred by the program RAxML next generation (RAxML-ng, DOI:10.5281/zenodo.593079) under evolutionary models inferred by jModelTest 261 based on the Bayesian information criterion. The inferred models were very similar to each other. All included invariant sites and among-sites rate heterogeneity. The rbcl data was better explained by the GTR substitution scheme whereas for the rDNA sequences (18S and 28S) the algorithm suggested one rate for A/C and C/G substitutions, a second one for A/T and G/T and 3 different rates for the remaining substitutions (the TIM3 model in RAxML-ng). Tree searches consisted in 20 initial Parsimony trees that were rearranged by tree bisection and reconnection (TBR). Parsimony analyses were made in TNT software62. Tree searches consisted in Wagner (WAG) initial trees that were subsequently rearranged by TBR. The number of WAG trees required to obtain a stable consensus tree (sensu Goloboff63 and references therein) was 100. Holding one tree during tree swapping was enough both to target optimal trees and obtain a stable consensus implementing 100 replications. Targeting all shortest trees (n = 6) required about 600 replications. Branch supports were calculated with the bootstrap routines implemented in RAxML-ng and TNT. Tree comparisons were performed with the cophyloplot function of the R package Ape64, Dendroscope65 and ad-hoc R scripts available from the authors on request.

Penalized Likelihood (PL) dating

Penalized Likelihood analyses were performed with the chronos function from the R package ape64. We deemed the most realistic clock model for this dataset, the discrete one, in which different branches are characterized by discrete rate categories. This better reflects that our dataset included several diatom taxa (Table 3; details in Results). Implementing a discrete clock requires using a predefined number of rate categories (k) and a parameter, λ, which governs the magnitude of the penalty applied to rate changes across the phylogeny. The performance of different k and λ settings was explored by a cross-validation criterion. We implemented a one-by-one terminal removal approach as in reference66. We define a score (CV) based on the cross-validation implementation of Ape’s chronopl function, aiming to weigh the impact of parameters’ variation on tMRCA estimates. For each k and λ combination (varied from 2 to 10 in increments of 1 and 0 to 1 in increments of 1/9, respectively), the height of the D. geminata crown node (OCH, for Observed Crown Height) was obtained from the full tree (reference tree, RT) and from each of a set of M trees generated by deleting one RT terminal at a time. Then, we calculated a score for each combination of k and λ values by the equation:

CV=1M(OCHPCH)2OCH,

where OCH is the observed D. geminata crown node height, that is the height in the RT, and PCHs (Predictor Crown Heights) are the heights in the deleted trees.

Tree calibration

Didymosphenia sp. fossils have been described from the Messinian period41, suggesting that Didymosphenia radiation started along the Neogene. Thus, we set the beginning of the Messinian as the minimum bound for the crown node of the genus. Previous studies30 and the analyses performed here (please see the Results) indicated that the most basal taxon inside the Didymosphenia clade is D. dentata, which is one of the endemic species of the genus in Lake Baikal. The Baikal formation begun in the Late Cretaceous and it is estimated that the older Baikal taxa appeared about 70 Ma67,68, so we used this to set the maximum bound for the whole Didymosphenia clade. The age of the diatoms stem node was bounded between 190 and 396 Ma based on fossil evidence69 and previous molecular clock analyses involving an extensive sample of eukaryotic taxa70, respectively. The diatom crown node, the Bacillariophyceae crown node, the core araphids/raphids split and the raphid pennates crown minimum and maximum bounds were set according to references71 and29. The Mediophyceae stem node was assigned a minimum age of 110 My based on fossil records72,73. The corresponding maximum age was equalized to the minimum age of the diatom crown node. We also set minimum and maximum bounds for the Pinnularia stem node, based on fossil data and molecular clock analyses from32. The full set of calibration points implemented in the present study are summarized in Table 4 and Fig. 2.

Table 4.

Time constrains (My) used in dating analyses.

Calibration pointa Min.b Max.b Evidence Reference
Diatoms stem node (1) 397 Secondary 70
Diatoms stem node (1) 190 Fossil 69
Diatoms crown node (2) 160 267 Secondary 29,71
Mediophyceae stem node (3) 267
Mediophyceae stem node (3) 110 Fossil 72,73
Bacillariophyceae crown node (4) 96.5 204 Secondary 29,71
Core araphids/raphids split (5) 93.8 185 Secondary 29,71
Raphid pennates crown (6) 70 165 Secondary 29,71
Pinnularia stem node (7) 100 Secondary 32
Pinnularia stem node (7) 40 Fossil 32
Didymosphenia crown node (8) 70 Geological 67,68
Didymosphenia crown node (8) 7.3 Fossil 41

aNumbers in parentheses refer to nodes in Fig. 2.

bMillion years.

Supplementary information

Acknowledgements

This study was supported by grant PICT 2014-3345. We would like to thank the helpful comments provided by three anonymous reviewers.

Author contributions

Author contributions were as follows: L.R.J., J.M.M. and B.A.W. conceived the study; J.M.M. and L.R.J. generated and analyzed the molecular data; L.R.J. and N.M.U. designed and implemented the micromanipulation methods used for cell isolation; L.R.J. and J.M.M. prepared the first manuscript draft; L.R.J., J.M.M. and B.A.W. finished the manuscript version sent to the journal.

Competing interests

The authors declare no competing interests.

Footnotes

Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary information

is available for this paper at 10.1038/s41598-019-55155-1.

References

  • 1.Bothwell ML, Taylor BW, Kilroy C. The Didymo story: the role of low dissolved phosphorus in the formation of Didymosphenia geminata blooms. Diatom Research. 2014;29:229–236. doi: 10.1080/0269249X.2014.889041. [DOI] [Google Scholar]
  • 2.Whitton BA, Ellwood NTW, Kawecka B. Biology of the freshwater diatom Didymosphenia: a review. Hydrobiologia. 2009;630:1–37. doi: 10.1007/s10750-009-9753-5. [DOI] [Google Scholar]
  • 3.Aboal M, Marco S, Chaves E, Mulero I, García-Ayala A. Ultrastructure and function of stalks of the diatom Didymosphenia geminata. Hydrobiologia. 2012;695:17–24. doi: 10.1007/s10750-012-1193-y. [DOI] [Google Scholar]
  • 4.Gretz, M. R. In Proceedings of the 2007 International Workshop on Didymosphenia geminata. (eds M. L. Bothwell & S. A. Spaulding) 21.
  • 5.Ladrera R, Goma J, Prat N. Effects of Didymosphenia geminata massive growth on stream communities: Smaller organisms and simplified food web structure. PLoS One. 2018;13:e0193545. doi: 10.1371/journal.pone.0193545. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Watson, S. B. et al. Harmful algal blooms. 2nd edn, (Academic Press, 2015).
  • 7.Bothwell ML, Lynch DR, Wright H, Deniseger J. On the Boots of Fishermen: The History of Didymo Blooms on Vancouver Island, British Columbia. Fisheries. 2009;34:382–388. doi: 10.1577/1548-8446-34.8.382. [DOI] [Google Scholar]
  • 8.Kilroy C, Bothwell ML. Enviromental control of stalk length in the bloom-forming, freshwater benthic diatom Didymosphenia geminata (Bacillariopyceae) J. Phycol. 2011;47:981–989. doi: 10.1111/j.1529-8817.2011.01029.x. [DOI] [PubMed] [Google Scholar]
  • 9.Kilroy C, Novis P. Is Didymosphenia geminata an introduced species in New Zealand? Evidence from trends in water chemistry, and chloroplast DNA. Ecol Evol. 2018;8:904–919. doi: 10.1002/ece3.3572. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Bothwell ML, Kilroy C. Phosphorus limitation of the freshwater benthic diatom Didymosphenia geminata determined by the frequency of dividing cells. Freshwater Biology. 2011;56:565–578. doi: 10.1111/j.1365-2427.2010.02524.x. [DOI] [Google Scholar]
  • 11.Taylor BW, Bothwell ML. The Origin of Invasive Microorganisms Matters for Science, Policy, and Management: The Case of Didymosphenia geminata. BioScience. 2014;64:531–538. doi: 10.1093/biosci/biu060. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Ellwood NTW, Whitton BA. Importance of organic phosphate hydrolyzed in stalks of the lotic diatom Didymosphenia geminata and the possible impact of climatic and atmospheric changes. Hydrobiologia. 2007;592:121–133. doi: 10.1007/s10750-007-0728-0. [DOI] [Google Scholar]
  • 13.Gillis Carole-Anne, Dugdale Stephen J., Bergeron Normand E. Effect of discharge and habitat type on the occurrence and severity ofDidymosphenia geminatamats in the Restigouche River, eastern Canada. Ecohydrology. 2018;11(5):e1959. doi: 10.1002/eco.1959. [DOI] [Google Scholar]
  • 14.Jackson LJ, Corbett L, Scrimgeour G. Environmental constraints on Didymosphenia geminata occurrence and bloom formation in Canadian Rocky Mountain lotic systems. Can J Fish Aquat Sci. 2016;73:964–972. doi: 10.1139/cjfas-2015-0361. [DOI] [Google Scholar]
  • 15.Montecino V, et al. Spatio temporal population dynamics of the invasive diatom Didymosphenia geminata in central-southern Chilean rivers. Sci Total Environ. 2016;568:1135–1145. doi: 10.1016/j.scitotenv.2016.03.080. [DOI] [PubMed] [Google Scholar]
  • 16.Manrique JM, et al. Nuisance Didymosphenia geminata blooms in the Argentinean Patagonia: Status and current research trends. Aquat Ecosyst Health Manag. 2017;20:361–368. [Google Scholar]
  • 17.Asprey JF, Benson-Evans K, Furet JE. A contribution to the study of South American freshwater phytoplankton. Gayana: Botánica. 1964;10:1–18. [Google Scholar]
  • 18.Rivera P, Gebauer M. Diatomeas chilenas en las Colecciones de Boyer, Cleve & Moeller, Schulze y Smith, depositadas en la Academia de Ciencias Naturales de Filadelfia, Estados Unidos. Gayana Botanica. 1989;46:89–116. [Google Scholar]
  • 19.Jones LR, Uyua NM, Manrique JM. The peril of PCR inhibitors in environmental samples: the case of Didymosphenia geminata. Biodivers Conserv. 2015;24:1541–1548. doi: 10.1007/s10531-014-0849-5. [DOI] [Google Scholar]
  • 20.Ben Ali A, De Baere R, Gert Van der Auwera G, De Wachter R, Van de Peer Y. Phylogenetic relationships among algae based on complete large-subunit rRNA sequences. International Journal of Systematic and Evolutionary Microbiology. 2001;51:737–749. doi: 10.1099/00207713-51-3-737. [DOI] [PubMed] [Google Scholar]
  • 21.Cary SC, et al. Development and validation of a quantitative PCR assay for the early detection and monitoring of the invasive diatom Didymosphenia geminata. Harmful Algae. 2014;36:63–70. doi: 10.1016/j.hal.2014.04.003. [DOI] [Google Scholar]
  • 22.Cho GY, Lee SH, Boo SM. A new brown algal order, Ishigeales (Phaeophyceae), established on the basis of plastid protein-coding rbcL, psaA, and psbA region comparisons. J. Phycol. 2004;5:921–936. doi: 10.1111/j.1529-8817.2004.03160.x. [DOI] [Google Scholar]
  • 23.Guo L, Sui Z, Zhang S, Ren Y, Liu Y. Comparison of potential diatom ‘barcode’ genes (the 18S rRNA gene and ITS, COI, rbcL) and their effectiveness in discriminating and determining species taxonomy in the Bacillariophyta. Int J Syst Evol Microbiol. 2015;65:1369–1380. doi: 10.1099/ijs.0.000076. [DOI] [PubMed] [Google Scholar]
  • 24.Jaramillo A, Osman D, Caputo L, Cardenas L. Molecular evidence of a Didymosphenia geminata (Bacillariophyceae) invasion in Chilean freshwater systems. Harmful Algae. 2015;49:117–123. doi: 10.1016/j.hal.2015.09.004. [DOI] [Google Scholar]
  • 25.Keller SR, Hilderbrand RH, Shank MK, Potapova M. Environmental DNA genetic monitoring of the nuisance freshwater diatom, Didymosphenia geminata, in eastern North American streams. Diversity Distrib. 2017;23:381–393. doi: 10.1111/ddi.12536. [DOI] [Google Scholar]
  • 26.Kermarrec L, Ector L, Bouchez A, Rimet F, Hoffmann L. A preliminary phylogenetic analysis of the Cymbellales based on 18S rDNA gene sequencing. Diatom Research. 2011;26:305–315. doi: 10.1080/0269249X.2011.633255. [DOI] [Google Scholar]
  • 27.Kermarrec L, et al. Next-generation sequencing to inventory taxonomic diversity in eukaryotic communities: a test for freshwater diatoms. Mol Ecol Resour. 2013;13:607–619. doi: 10.1111/1755-0998.12105. [DOI] [PubMed] [Google Scholar]
  • 28.Kowallik KV, Stoebe B, Schaffran I, Kroth-Pancic P, Freier U. The Chloroplast Genome of a chlorophyll a+c- containing Alga, Odontella sinensis. Plant Mol Biol Rep. 1995;13:336–342. doi: 10.1007/BF02669188. [DOI] [Google Scholar]
  • 29.Medlin LK. A time scale for diatom evolution based on four molecular markers: Reassessment of ghost lineages and major steps defining diatom evolution. Vie Milieu. 2015;65:219–238. [Google Scholar]
  • 30.Nakov T, Ruck EC, Galachyants Y, Spaulding SA, Theriot EC. Molecular phylogeny of the Cymbellales (Bacillariophyceae, Heterokontophyta) with a comparison of models for accommodating rate variation across sites. Phycologia. 2014;53:359–373. doi: 10.2216/14-002.1. [DOI] [Google Scholar]
  • 31.Ruck EC, Nakov T, Jansen RK, Theriot EC, Alverson AJ. Serial gene losses and foreign DNA underlie size and sequence variation in the plastid genomes of diatoms. Genome Biol Evol. 2014;6:644–654. doi: 10.1093/gbe/. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Souffreau C, et al. A time-calibrated multi-gene phylogeny of the diatom genus Pinnularia. Mol Phylogenet Evol. 2011;61:866–879. doi: 10.1016/j.ympev.2011.08.031. [DOI] [PubMed] [Google Scholar]
  • 33.Yamada M, et al. Species diversity of the genus Skeletonema (Bacillariophyceae) in the industrial harbor Dokai Bay, Japan. J Oceanogr. 2010;66:755–771. doi: 10.1007/s10872-010-0062-4. [DOI] [Google Scholar]
  • 34.Casteleyn G, et al. Natural hybrids in the marine diatom Pseudo-nitzschia pungens (Bacillariophyceae): genetic and morphological evidence. Protist. 2009;160:343–354. doi: 10.1016/j.protis.2008.11.002. [DOI] [PubMed] [Google Scholar]
  • 35.Rabassa J, Coronato AM, Salemme M. Chronology of the Late Cenozoic Patagonian glaciations and their correlation with biostratigraphic units of the Pampean region (Argentina) Journal of South American Earth Sciences. 2005;20:81–103. doi: 10.1016/j.jsames.2005.07.004. [DOI] [Google Scholar]
  • 36.Krebs WN, Bradbury JP, Theriot E. Neogene and Quaternary Lacustrine Diatom Biochronology, Western USA. Palaios. 1987;2:505–513. doi: 10.2307/3514621. [DOI] [Google Scholar]
  • 37.Kilroy, C., Lagerstedt, M. A. & Robinson, K. (NIWA Client Report 2006-095. For Biosecurity New Zealand., 2007).
  • 38.Macchi PJ, Vigliano PH. Salmonid introduction in Patagonia: the ghost of past, present and future management. Ecología Austral. 2014;24:162–172. [Google Scholar]
  • 39.Macchi PJ, Vigliano PH. American Fisheries Society Symposium. 2008. Historical Policy Goals for Fish Management in Northern Continental Patagonia Argentina: A Structuring Force of Actual Fish Assemblages? pp. 331–348. [Google Scholar]
  • 40.Stewart, J. H., Sarna-Wojcicki, A., Meyer, C. E., Starratt, S. W. & Wan, E. Stratigraphy, tephrochronology, and structural setting of Miocene sedimentary rocks in the Middlegate area, west-central Nevada. Report No. Open-File Report 99–350, (U.S. Geological Survey, 1999).
  • 41.Tanaka H, Suzuki H, Nagumo T. Fossil freshwater diatoms from the Ningyotoge Formation (Late Miocene - Pliocene) at the Okayama and Tottori Prefecture boundary. Japan. Diatom. 2008;24:51–62. [Google Scholar]
  • 42.Blanco S, Ector L. Nova Hedwigia. 2009. Distribution, ecology and nuisance effects of the freshwater invasive diatom Didymosphenia geminata (Lyngbye) M. Schmidt: a literature review; pp. 347–422. [Google Scholar]
  • 43.Zachos J, Pagani M, Sloan L, Thomas E, Billups K. Trends, rhythms, and aberrations in global climate 65 Ma to present. Science. 2001;292:686–693. doi: 10.1126/science.1059412. [DOI] [PubMed] [Google Scholar]
  • 44.Sérsic AN, et al. Emerging phylogeographical patterns of plants and terrestrial vertebrates from Patagonia. Biological Journal of the Linnean Society. 2011;103:475–494. doi: 10.1111/j.1095-8312.2011.01656.x. [DOI] [Google Scholar]
  • 45.Hazzi NA, Moreno JS, Ortiz-Movliav C, Palacio RD. Biogeographic regions and events of isolation and diversification of the endemic biota of the tropical Andes. Proceedings of the National Academy of Sciences. 2018;115:7985–7990. doi: 10.1073/pnas.1803908115. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Hewitt GM. Genetic consequences of climatic oscillations in the Quaternary. Philos Trans R Soc Lond B Biol Sci. 2004;359(183–195):discussion 195. doi: 10.1098/rstb.2003.1388. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Liu J, et al. Diversification and historical demography of the rapid racerunner (Eremias velox) in relation to geological history and Pleistocene climatic oscillations in arid Central Asia. Mol Phylogenet Evol. 2019;130:244–258. doi: 10.1016/j.ympev.2018.10.029. [DOI] [PubMed] [Google Scholar]
  • 48.Abarca N, Jahn R, Zimmermann J, Enke N. Does the Cosmopolitan Diatom Gomphonema parvulum (Kützing) Kützing Have a Biogeography? PLoS One. 2014;9:e86885. doi: 10.1371/journal.pone.0086885. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Kermarrec L, Bouchez A, Rimet F, Humbert J-F. First Evidence of the Existence of Semi-Cryptic Species and of a Phylogeographic Structure in the Gomphonema parvulum (Kützing) Kützing Complex (Bacillariophyta) Protist. 2013;164:686–705. doi: 10.1016/j.protis.2013.07.005. [DOI] [PubMed] [Google Scholar]
  • 50.Uyua NM, Manrique JM, Jones LR. An optimized DNA extraction protocol for benthic Didymosphenia geminata. J Microbiol Methods. 2014;104C:12–18. doi: 10.1016/j.mimet.2014.06.007. [DOI] [PubMed] [Google Scholar]
  • 51.Cary, S. C., Hicks, B. J., Crawfod, N. J. & Coyne, C. A sensitive genetic based detection capability for Didymosphenia geminata. (Centre for Biodiversity and Ecology Research, The University of Waikato, 2006).
  • 52.Evans KM, Wortley AH, Mann DG. An assessment of potential diatom “barcode” genes (cox1, rbcL, 18S and ITS rDNA) and their effectiveness in determining relationships in Sellaphora (Bacillariophyta) Protist. 2007;158:349–364. doi: 10.1016/j.protis.2007.04.001. [DOI] [PubMed] [Google Scholar]
  • 53.Guillou L, et al. Diversity of picoplanktonic prasinophytes assessed by direct nuclear SSU rDNA sequencing of environmental samples and novel isolates retrieved from oceanic and coastal marine ecosystems. Protist. 2004;155:193–214. doi: 10.1078/143446104774199592. [DOI] [PubMed] [Google Scholar]
  • 54.Jones HM, Simpson GE, Stickle AJ, Mann DG. Life history and systematics of Petroneis (Bacillariophyta), with special reference to British waters. Eur J Phycol. 2005;40:61–87. doi: 10.1080/09670260400024675. [DOI] [Google Scholar]
  • 55.Moon-van der Staay SY, De Wachter R, Vaulot D. Oceanic 18S rDNA sequences from picoplankton reveal unsuspected eukaryotic diversity. Nature. 2001;409:607–610. doi: 10.1038/35054541. [DOI] [PubMed] [Google Scholar]
  • 56.Scholin CA, Herzog M, Sogin M, Anderson DM. Identification of group- and group-specific genetic markers for globally distributed Alexandrium (Dinophyceae). II. Sequence analysis of a gragment of the LSU rRNA gen 1. J. Phycol. 1994;30:999–1011. doi: 10.1111/j.0022-3646.1994.00999.x. [DOI] [Google Scholar]
  • 57.Rueden CT, et al. ImageJ2: ImageJ for the next generation of scientific image data. BMC Bioinformatics. 2017;18:529. doi: 10.1186/s12859-017-1934-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Hall TA. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucl Acids Symp Ser. 1999;41:95–98. [Google Scholar]
  • 59.Katoh K, Standley DM. MAFFT: iterative refinement and additional methods. Methods Mol Biol. 2014;1079:131–146. doi: 10.1007/978-1-62703-646-7_8. [DOI] [PubMed] [Google Scholar]
  • 60.Waterhouse AM, Procter JB, Martin DM, Clamp M, Barton GJ. Jalview Version 2—a multiple sequence alignment editor and analysis workbench. Bioinformatics. 2009;25:1189–1191. doi: 10.1093/bioinformatics/btp033. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61.Darriba D, Taboada GL, Doallo R, Posada D. jModelTest 2: more models, new heuristics and parallel computing. Nat Methods. 2012;9:772. doi: 10.1038/nmeth.2109. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62.Goloboff P, Catalano S. TNT version 1.5, including a full implementation of phylogenetic morphometrics. Cladistics. 2016;32:221–238. doi: 10.1111/cla.12160. [DOI] [PubMed] [Google Scholar]
  • 63.Goloboff P. Analyzing Large Data Sets in Reasonable Times: Solutions for Composite Optima. Cladistics. 1999;15:415–428. doi: 10.1111/j.1096-0031.1999.tb00278.x. [DOI] [PubMed] [Google Scholar]
  • 64.Paradis E, Schliep K. ape 5.0: an environment for modern phylogenetics and evolutionary analyses in R. Bioinformatics. 2019;35:526–528. doi: 10.1093/bioinformatics/bty633. [DOI] [PubMed] [Google Scholar]
  • 65.Huson DH, Scornavacca C. Dendroscope 3: an interactive tool for rooted phylogenetic trees and networks. Syst Biol. 2012;61:1061–1067. doi: 10.1093/sysbio/sys062. [DOI] [PubMed] [Google Scholar]
  • 66.Sanderson MJ. Estimating absolute rates of molecular evolution and divergence times: a penalized likelihood approach. Mol Biol Evol. 2002;19:101–109. doi: 10.1093/oxfordjournals.molbev.a003974. [DOI] [PubMed] [Google Scholar]
  • 67.Mats VD, Perepelova TI. A new perspective on evolution of the Baikal Rift. Geoscience Frontiers. 2011;2:349–365. doi: 10.1016/j.gsf.2011.06.002. [DOI] [Google Scholar]
  • 68.Mats VD, Shcherbakovb DY, Efimovac IM. Late Cretaceous–Cenozoic History of the Lake Baikal Depression and Formation of Its Unique Biodiversity. Stratigraphy and Geological Correlation. 2011;19:404–423. doi: 10.1134/S0869593811040058. [DOI] [Google Scholar]
  • 69.Sims P, Mann DG, Medlin LK. Evolution of the diatoms: insights from fossil, biological and molecular data. Phycologia. 2006;45:361–402. doi: 10.2216/05-22.1. [DOI] [Google Scholar]
  • 70.Parfrey LW, Lahr DJ, Knoll AH, Katz LA. Estimating the timing of early eukaryotic diversification with multigene molecular clocks. Proc Natl Acad Sci USA. 2011;108:13624–13629. doi: 10.1073/pnas.1110633108. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 71.Sorhannus U. A nuclear-encoded small-subunit ribosomal RNA timescale for diatom evolution. Marine Micropaleontology. 2007;65:1–12. doi: 10.1016/j.marmicro.2007.05.002. [DOI] [Google Scholar]
  • 72.Gersonde R, Harwood DM. Lower Cretaceous diatoms from ODP Leg 113 site 693 Weddell Sea Part 1 Vegetative cells. Proc Ocn Drill Prog Sci Res. 1990;113:365–402. [Google Scholar]
  • 73.Harwood DM, Gersonde R. Lower Cretaceous diatoms from ODP Leg113 Site 693 Weddell Sea Part 2 Resting spores chrysophycean cysts an endoskeletal dinoflagellate and notes on the origin of diatoms. Proc Ocn Drill Prog Sci Res. 1990;113:403–425. [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials


Articles from Scientific Reports are provided here courtesy of Nature Publishing Group

RESOURCES