We report the draft genome sequences of five novel Bacillus strains isolated from temperate soils in Annandale-on-Hudson, NY. Strains RM1(2019), RM9(2019), and RM15(2019) were identified as Bacillus toyonensis, while RM11(2019) was identified as Bacillus thuringiensis. The draft genome of strain RM2(2019) was unclassified and likely represents a new species.
ABSTRACT
We report the draft genome sequences of five novel Bacillus strains isolated from temperate soils in Annandale-on-Hudson, NY. Strains RM1(2019), RM9(2019), and RM15(2019) were identified as Bacillus toyonensis, while RM11(2019) was identified as Bacillus thuringiensis. The draft genome of strain RM2(2019) was unclassified and likely represents a new species.
ANNOUNCEMENT
Bacillus is a genetically and metabolically diverse genus of bacteria that have been used for environmental, medicinal, and nutritional purposes (1). The characterization of novel Bacillus strains thus remains a priority for understanding the evolutionary history of the genus as well as for the development of novel biotechnological applications (2).
To investigate the genetic diversity of environmental Bacillus spp. in the Hudson River Valley in New York, we collected 1 g of soil from five different locations on the Bard College campus located in Annandale-on-Hudson, NY. The soil samples were mixed with 9 ml of sterile water and incubated at 42°C in a shaking incubator for 1 hour (3). Following incubation at room temperature for 2 h, we plated the samples on 0.1% tryptic soy broth (TSB) agar for 24 to 48 h at 30°C (3). For each sample, we selected one white irregularly shaped colony and confirmed that the colonies were Gram positive via Gram straining. We then extracted genomic DNA using the DNeasy UltraClean microbial kit (Qiagen, Hilden, Germany). After confirming the genus identification of strains RM1(2019), RM2(2019), RM9(2019), RM11(2019), and RM15(2019) (Table 1) via 16S rRNA sequencing using the universal primers 27F (AGAGTTTGATCMTGGCTCAG) and 1492R (CCAGACTCCTACGGGAGGCAGC), whole-genome sequencing was conducted at the Microbial Genome Sequencing Center, LLC (Pittsburgh, PA) using the 151-bp paired-end read libraries designed for the Illumina MiSeq platform. We obtained a total of 1,933,616 pairs of raw reads for RM1(2019), 1,767,769 pairs of raw reads for RM(2019), 1,998,924 pairs of raw reads for RM9(2019), 2,786,858 pairs of raw reads for RM11(2019), and 3,148,200 pairs of raw reads for RM15(2019).
TABLE 1.
Summary of the draft genome sequences for environmental Bacillus sp. strains isolated from soil in Annandale-on-Hudson, NY, and described in this study
| Isolate | Location of isolation (GPS coordinates)a | Closest species match (DDH %) | No. of contigs | Genome size (bp) | G+C content (%) | N50 (bp) | Median coverage (fold) | GenBank accession no./SRA accession no. |
|---|---|---|---|---|---|---|---|---|
| RM1(2019) | 42°1′12″N, 73°54′28″W | Bacillus toyonensis NCIMB 14858 (98.7) | 52 | 5,820,521 | 34.94 | 308,271 | 77 | WBOR00000000/SRR10120510 |
| RM2(2019) | 42°1′49″N, 73°54′17″W | Bacillus thuringiensis ATCC 10792 (69.5) | 80 | 5,968,737 | 34.80 | 239,180 | 68 | WBOQ00000000/SRR10120509 |
| RM9(2019) | 42°1′47″N, 73°54′16″W | Bacillus toyonensis NCIMB 14858 (94.8) | 38 | 5,627,226 | 35.11 | 719,831 | 73 | WBOP00000000/SRR10120508 |
| RM11(2019) | 42°1′12″N, 73°54′28″W | Bacillus thuringiensis ATCC 10792 (81.7) | 65 | 5,928,652 | 34.79 | 326,972 | 107 | WBOO00000000/SRR10120507 |
| RM15(2019) | 42°1′26″N, 73°54′23″W | Bacillus toyonensis NCIMB 14858 (94.6) | 56 | 5,819,922 | 34.98 | 390,194 | 125 | WBON00000000/SRR10120506 |
GPS, global positioning system.
We assembled the genomes using the bioinformatic pipeline described by Shrestha et al. (4). Briefly, raw reads were trimmed using Trimmomatic v0.36 with the following parameters: SLIDINGWINDOW, 4:15; LEADING, 3; TRAILING, 3; MINLEN length, 50 (5). The trimmed reads were then assembled using SPAdes de novo v3.11 testing assemblies, with k-mer lengths of 21, 33, 55, 77, 99, and 127 (6). Contigs smaller than 500 bp or with low coverage (<2-fold) were filtered out. Assembly statistics were estimated using QUAST v4.5 and BBMap, and the species identity was estimated for each strain using the Genome BLAST Distance Phylogeny approach (7), as implemented on the Type (Strain) Genome Server (TYGS), using default settings (8).
We found that the draft genomes of strains RM1(2019), RM9(2019), and RM15(2019) were most closely related to that of Bacillus toyonensis NCIMB 14858 (NCBI assembly number ASM49628v1), a nonpathogenic strain that was first isolated in Japan as strain BCT-7112 (9), with DNA-DNA hybridization (DDH) values of 98.7%, 94.8%, and 94.6%, respectively. The three draft genomes ranged in size from 5,627,226 bp to 5,820,521 bp, with an average G+C content of 35.01% and an average median coverage of 92-fold. We found that the draft genome of strain RM11(2019) was most closely related to that of Bacillus thuringiensis ATCC 10792 (NCBI assembly number ASM211944v1), with a G+C content of 34.74% and a median coverage of 107-fold. Finally, we found that the draft genome of strain RM2(2019) was most closely matched to those of B. thuringiensis ATCC 10792 and B. cereus strain ATCC 14579 (NBCI assembly number ASM782v1), with DDH values of 69.5% and 65.9%, respectively, indicating that the classification of RM2(2019) most likely falls into a new species within the Bacillus genus (10). Strain RM2(2019) harbors a smaller genome than that of B. thuringiensis but larger than that of B. cereus (5,968,737 bp versus 6,326,280 bp and 5,427,083 bp, respectively) and a smaller G+C content than those of both strains (34.80% versus 34.94% and 35.31%, respectively).
Data availability.
The draft genome and raw read sequences for each strain have been deposited in DDBJ/EMBL/GenBank under the accession numbers listed in Table 1.
REFERENCES
- 1.Liu Y, Lai Q, Göker M, Meier-Kolthoff JP, Wang M, Sun Y, Wang L, Shao Z. 2015. Genomic insights into the taxonomic status of the Bacillus cereus group. Sci Rep 5:14082. doi: 10.1038/srep14082. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Harwood CR. 1989. Introduction to the biotechnology of Bacillus, p 1–4. In Harwood CR. (ed), Bacillus. Springer US, Boston, MA. [Google Scholar]
- 3.Al-Humam NA. 2016. Heat-shock technique for isolation of soil Bacillus species with potential of antibiotics secretion in Saudi Arabia. Br Microbiol Res J 17:1–6. doi: 10.9734/BMRJ/2016/29126. [DOI] [Google Scholar]
- 4.Shrestha SD, Guttman DS, Perron GG. 2017. Draft genome sequences of 10 environmental Pseudomonas aeruginosa strains isolated from soils, sediments, and waters. Genome Announc 5:e00804-17. doi: 10.1128/genomeA.00804-17. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Bolger AM, Lohse M, Usadel B. 2014. Trimmomatic: a flexible trimmer for Illumina sequence data. Bioinformatics 30:2114–2120. doi: 10.1093/bioinformatics/btu170. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Bankevich A, Nurk S, Antipov D, Gurevich AA, Dvorkin M, Kulikov AS, Lesin VM, Nikolenko SI, Pham S, Prjibelski AD, Pyshkin AV, Sirotkin AV, Vyahhi N, Tesler G, Alekseyev MA, Pevzner PA. 2012. SPAdes: a new genome assembly algorithm and its applications to single-cell sequencing. J Comput Biol 19:455–477. doi: 10.1089/cmb.2012.0021. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Meier-Kolthoff JP, Auch AF, Klenk H-P, Göker M. 2013. Genome sequence-based species delimitation with confidence intervals and improved distance functions. BMC Bioinformatics 14:60. doi: 10.1186/1471-2105-14-60. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Meier-Kolthoff JP, Göker M. 2019. TYGS is an automated high-throughput platform for state-of-the-art genome-based taxonomy. Nat Commun 10:2182. doi: 10.1038/s41467-019-10210-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Jiménez G, Urdiain M, Cifuentes A, López-López A, Blanch AR, Tamames J, Kämpfer P, Kolstø A-B, Ramón D, Martínez JF, Codoñer FM, Rosselló-Móra R. 2013. Description of Bacillus toyonensis sp. nov., a novel species of the Bacillus cereus group, and pairwise genome comparisons of the species of the group by means of ANI calculations. Syst Appl Microbiol 36:383–391. doi: 10.1016/j.syapm.2013.04.008. [DOI] [PubMed] [Google Scholar]
- 10.Chun J, Rainey FA. 2014. Integrating genomics into the taxonomy and systematics of the Bacteria and Archaea. Int J Syst Evol Microbiol 64:316–324. doi: 10.1099/ijs.0.054171-0. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
The draft genome and raw read sequences for each strain have been deposited in DDBJ/EMBL/GenBank under the accession numbers listed in Table 1.
