Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2020 Jun 15.
Published in final edited form as: Cancer Res. 2019 Oct 31;79(24):6204–6214. doi: 10.1158/0008-5472.CAN-19-1415

YAP1 mediates resistance to MEK1/2 inhibition in neuroblastomas with hyperactivated RAS signalling

Grace E Coggins 1,2, Alvin Farrel 1,3, Komal S Rathi 1,3, Colin M Hayes 1, Laura Scolaro 1, Jo Lynne Rokita 1,3,4, John M Maris 1,5,6
PMCID: PMC6911631  NIHMSID: NIHMS1541481  PMID: 31672841

Abstract

Relapsed neuroblastomas are enriched with activating mutations of the RAS-MAPK signaling pathway. The MEK1/2 inhibitor trametinib delays tumor growth but does not sustain regression in neuroblastoma preclinical models. Recent studies have implicated the Hippo pathway transcriptional coactivator protein YAP1 as an additional driver of relapsed neuroblastomas, as well as a mediator of trametinib resistance in other cancers. Here, we used a highly annotated set of high-risk neuroblastoma cellular models to modulate YAP1 expression and RAS pathway activation to test if increased YAP1 transcriptional activity is a mechanism of MEK1/2 inhibition resistance in RAS-driven neuroblastomas. In NLF (biallelic NF1 inactivation) and SK-N-AS (NRAS Q61K) cell lines, trametinib caused a near-complete translocation of YAP1 protein into the nucleus. YAP1 depletion sensitized neuroblastoma cells to trametinib, while overexpression of constitutively active YAP1 protein induced trametinib resistance. Mechanistically, significant enhancement of G1/S cell cycle arrest, mediated by depletion of MYC/MYCN and E2F transcriptional output sensitized RAS-driven neuroblastomas to trametinib following YAP1 deletion. These findings underscore the importance of YAP activity in response to trametinib in RAS-driven neuroblastomas, as well as the potential for targeting YAP in a trametinib combination.

Keywords: neuroblastoma, MAPK, MEK, YAP1, Hippo

INTRODUCTION

Neuroblastoma is a malignancy of the developing sympathetic nervous system (1–6). Half of all diagnosed neuroblastomas are classified as “high-risk”, for which cure rates remain low. Aggressive empiric multimodal therapy, including surgery, chemotherapy, radiation therapy and more recently immunotherapy have shown incremental improvements in survival rates at the cost of a host of chronic health comorbidities in survivors. Relapse after standard of care remains largely incurable (6,7). Thus, there is an urgent need for more effective and precise therapies.

The development of novel treatments has been hindered by the relative lack of molecularly targetable genomic lesions. Recurrent kinase domain gain-of-function mutations in the ALK oncogene occur in 8–15% of all newly-diagnosed neuroblastomas (4–8), but may be present in a much larger percentage of relapse specimens (9–12). Indeed, compared to matched primary tumors, relapsed neuroblastomas have a significantly higher mutational burden, with clonal enrichment in mutations in RAS-MAPK pathway genes beyond ALK such as NRAS, KRAS, BRAF, PTPN11 and NF1 (9,10,12). Neuroblastoma cellular models with these genetic aberrations have elevated levels of phosphorylated ERK1/2 and are extremely sensitive to the MEK1/2 noncompetitive inhibitor trametinib in vitro, with low nanomolar IC50s (9,13). However, single agent MEK inhibition is cytostatic and results only in tumor growth delay in neuroblastoma xenotransplantation models with RAS hyperactivation (9,14,15), similar to the experience in multiple preclinical and clinical settings with single agent inhibition of MAPK pathway mutated cancers (16–19). For this reason, combination strategies are being pursued to avoid tumor escape from therapy and improve long-term responses. Dual inhibition of MEK1/2 and rational targets, such as BRAF, PI3K/AKT, and CDK4/6, have shown promise in other tumor types, including neuroblastoma (13,14,16–20), but in the latter case all xenografts eventually escaped dual MEK and CDK4/6 inhibition (18).

The hippo signaling pathway is considered tumor suppressive through cytosolic sequestration of the transcriptional co-activator protein YAP1 (21–23). Activated YAP1 mediates diverse biologic functions such as organ size, cellular proliferation, and cell survival (24–30). YAP1 dephosphorylation allows translocation into the nucleus and interaction with TEAD family and other transcription factors to initiate transcription of a multiple gene targets (31–37). Several groups have reported that YAP1 may be involved in resistance to trametinib in RAS-driven cancers (38–42). Recently, increased YAP1 activity was reported as a hallmark of relapsed neuroblastoma after intensive chemoradiotherapy (12,26). In addition, inhibition of YAP1 signaling has also been shown to abrogate neuroblastoma metastasis in preclinical models (43). Paradoxically, the YAP1 gene is located on chromosome arm 11q, a region that shows frequent hemizygous deletion, particularly in high-risk neuroblastomas without MYCN amplification (44, 45). Here we explore the hypothesis that derepression of YAP1 is a critical mediator of resistance to MEK inhibition in neuroblastomas with hyperactivated MAPK signalling.

METHODS

Cell Culture and Chemicals

Human-derived neuroblastoma cell lines were obtained from the Children’s Hospital of Philadelphia cell line bank, the Children’s Oncology Group, and the ATCC (46). Cell lines used included: NLF (RRID:CVCL_E217), SKNAS (RRID:CVCL_1700), NB-EBc1 (RRID:CVCL_E218), and SKNFI (RRID:CVCL_1702). Cell line authentication to confirm genomic identify was performed using the GenePrint 24 System (Promega, Guardian Forensic Sciences) every two years. Cell lines were continually tested for mycoplasma contamination after each thaw using the MycoAlert kit (Cambrex) and were confirmed to be mycoplasma negative prior to experimentation. Cells were cultured in RPMI-1640 medium containing 10% FBS, 2 mM L-Glutamine at 37 °C under 5% CO2 and were maintained at low passage that did not exceed 20 passages. Trametinib dissolved in DMSO (Cellagen Technologies #C4112–5s) was used for in vitro assays, with 0.1% DMSO as a negative control treatment. All cell lines were derived from deidentified neuroblastoma patient tumor samples and the Children’s Hospital of Philadelphia Institutional Review Board agreed with the investigators that this work is not considered human subjects research.

Cell Viability Assays

Cells were seeded in 96-well cell culture plates at 2,500–4,000 cells per well depending on growth kinetics. Drug treatments were performed in triplicate 24 hours later over a six-log dose range (0.01–10,000 nM). IC50 values for trametinib were calculated using area under the curve at 72 hours post-treatment. Cell viability was assessed using CellTiter-Glo (Promega). Cell growth assays were performed using the IncuCyte Live Cell Analysis System (IncuCyte ZOOM, Essen Bioscience) with the 20x objective lens during a 72-hour treatment.

CRISPR-Cas9, Plasmids and Lentiviral Delivery

To produce YAP1-targeting CRISPR-Cas9 knockout cell lines, scrambled sgRNA CRISPR/Cas9 All-in-One Lentivirus (ABM #K011) and the YAP1 sgRNA CRISPR All-in-One Lentivirus Set (Human) (ABM #K2653115) targeting the YAP1 gene (Accession Number: NM_1006106.4) were used. Virus with sgRNA targeting sequence #1 (5’-GTGCACGATCTGATGCCCGG-3’) and sequence #2 (5’-CGCCGTCATGAACCCCAAGA-3’) of the YAP1 TEAD binding domain were selected for these experiments. To produce YAP1 knockout pools in SKNAS and NLF, cells were transduced with lentivirus for the sgRNA against sequence #1 according to the manufacturer’s protocol. For NLF isogenic cell lines, a second YAP1 knockout pool was produced using lentivirus targeting sequence #2. Two single-cell clones were selected from each YAP1 knockout pool and grown into stable isogenic cell lines. Antibiotic selection was performed using 1 μg puromycin (Sigma, #P9620).

The lentiviral YAP-5SA overexpressing plasmid was produced by inserting the YAP-5SA sequence from the MYC-YAP-5SA plasmid (26) (Addgene #33091) into a lentiviral CMV-puro DEST vector (47) (Addgene #39481) using the PCR Cloning System with Gateway™ Technology with pDONR™221 & OmniMAX™2 Competent Cells (Invitrogen #12535029) according to the manufacturer’s recommended protocol. For lentiviral production, the YAP-5SA lentiviral plasmid was transfected in combination with the pMD2.G VSV-G envelope expressing plasmid (Addgene #12260) and psPAX2 lentiviral packaging plasmid (Addgene #12259). Plasmids were transduced at equimolar concentrations of 3 uM into HEK-293T cells (ATCC, CRL-3216) using Lipofectamine 3000 (Thermo Fisher Scientific #L3000008). Viral supernatant was harvested at 48 hours and was filtered using a 0.45 um filter and added to cells with 3 μg polybrene. Antibiotic selection was performed using 1 ug puromycin.

Primers

Sequencing primers to detect mutations in both of the target sequences in the endogenous YAP1 protein TEAD binding domain were: YAP1_F (5’-TAAAGAGAAAGGGGAGGCGG-3’) and YAP1_R (5’-CCGGGAAGAAAGAAAGGAAGA-3’). Primers for Gateway cloning were designed according to the manufacturer’s recommendations to remove the YAP-5SA sequence from the MYC-YAP-5SA retroviral plasmid with flanking attB sites. Primer sequences were: YAP-5SA_F (5’-GGGG ACAAGTTTGTACAAAAAAGCAGGCTTCACCATGGAACAAAAACTCATCTCA-3’) and YAP-5SA_R (5’-GGGGACCACTTTGTACAAGAAAGCTGGGTCCTATAACCATGTAAGAAAGCTTTCTTT-3’).

Western Blotting

Protein was isolated from whole cell lysates using lysis buffer containing 1X Cell Lysis Buffer (10X from Cell Signaling, #9803), 2 mM PMSF (Cell Signaling, #8553S), in 100% isopropanol, and 1% phosphatase inhibitor cocktails 2 (Sigma, #P5726) and 3 (Sigma, #P0044). Protein concentration was determined using the Bradford protein assay (Bio-Rad). Approximately 20 μg of protein were run on 4–15% gradient Tris-Glycine gels (Bio-Rad, #5671085) and transferred using the Bio-Rad transfer system. Antibodies used for western blotting include (Cell Signaling, unless otherwise indicated): YAP1 (D8H1X) (1:1000, #14074), p-YAP1 (S127) (D9W2I) (1:500, #13008S), p-ERK (1:2000, #4370), ERK (1:2000, #4695), β-Actin (1:5000, #4967S), RB (1:2000, #9309), p-RB (S807–811) (1:1000, #9307), PARP (1:1000, #9532), cleaved PARP (1:1000, #5625S), MYCN (1:2000, #9405S), Caspase-3 (1:1000, #9662), TATA Box binding protein (TBP) (1:1000, Abcam #ab818). Western blots were visualized using SuperSignal West Femto Maximum sensitivity substrate (Thermo Fisher Scientific, #34095) and the FluorChem Q chemiluminescent imaging system and FluorChemQ software v3.4.0 (ProteinSimple).

RNA isolation and RT-qPCR

RNA was isolated using the Qiagen miRNEasy Mini Kit (Qiagen). Reverse transcription was performed using the iScript Select cDNA Synthesis Kit (Bio-Rad #1708897). Quantitative PCR was performed using the Taqman 2X Master Mix (Thermo Fisher #4304437) on 384-well plates using the 7900HT Fast Real-Time PCR instrument (Applied Biosystems) and the SDS v2.4 software (Applied Biosystems). Taqman probes (Thermo Fisher Scientific, #4331182) used included: YAP1 (Hs00902712_g1) HPRT1 (Hs02800695_m1), GAPDH (Hs03929097_g1), CTGF (Hs01026927_g1), CYR61 (Hs00155497_m1), CDK1 (Hs00938777_m1), MCM4 (Hs00907398_m1), MCM6 (Hs00195504_m1), POLA1 (Hs00213524_m1), CCNE1 (Hs01026536_m1), E2F1 (Hs00153451_m1).

Flow Cytometry

Samples for cell cycle analysis were collected after 72 hours of trametinib treatment at the IC50 concentration of NLF (20 nM) and SKNAS (10 nM). Cells were detached with versene (0.02% EDTA in HBSS), washed with PBS + 1% FBS, fixed for approximately 10 seconds by adding ice cold 70% ethanol dropwise with constant vortexing, and stored at −20°C. Cells were stained using 1 uL FxCycle Violet (Invitrogen #F10347) per 1 mL PBS and analyzed using the CytoFLEX LX with 6 lasers (Beckman Coulter). Data analysis was performed using the FlowJo v10 software as described previously (14).

RNA Sequencing

Cells were plated in triplicate and treated with 20 nM trametinib for 72 hours prior to collection. Cells were lysed on the plate using the QIAzol lysis reagent (Qiagen #79306) and homogenized with Qiashredder tubes (Qiagen #79654). RNA was then isolated using the RNeasy Mini Kit (Qiagen #74104) according to the manufacturer’s protocol and quality was determined using the TapeStation 2200 (Agilent Technologies). All 18 samples were of optimal quality and achieved RIN scores of 10.0. RNA synthetic spike-ins were added to each sample (48), with Mix A added to the NLF sgCon samples and Mix B added to the NLF YAP1−/− #1 and #4 samples. Library preparation was done using 1 μg of RNA using the TruSeq Total mRNA Kit with Gold rRNA Removal Mix as recommended (Illumina #15031048). All 18 samples were sequenced using v2 chemistry, 2×150bp, and run on one high-output flow-cell of an Illumina NextSeq 500 instrument. Libraries were demultiplexed, Illumina adapters were trimmed, and FASTQ file generated using the Illumina NextSeq Control Software version 2.02.

Raw fastq files (n = 18) from RNA-sequencing data with an average sequencing depth of 22 million reads were aligned to human hg19 primary assembly reference genome using the STAR aligner v2.5.3a (49). Gene expression was quantified as Fragments Per Kilobase of transcript per Million mapped reads (FPKM) and transcript per million (TPM) using RSEM v1.2.28 normalization and Gencode v23 gene annotation (50). On an average, 88.05% reads were uniquely mapped to the reference genome. Normalization of RNA expression between samples was performed by analyzing the synthetic spike-in standards using Anaquin software toolkit distributed by Bioconductor (51).

Differential expression analysis was performed using the R package, DESeq2. Values were log2-transformed and biological replicates (N=3) were averaged within each cell line and treatment group. Differentially-expressed genes underwent Gene Ontology analysis using the ToppFun tool from the ToppGene Suite and the top 5 ontologies were chosen (52). GSEA was performed using the Molecular Signatures Database Hallmarks Gene Set collection and run for 1,000 iterations with a FWER p value cutoff of <0.01. All RNA-sequencing data have been deposited in the Gene Expression Omnibus under Accession Number GSE130401.

Statistics

Group comparisons were determined with a two-tailed t-test with a significance cutoff of p<0.05. Data analysis was performed using GraphPad Prism and R Studio.

RESULTS

Trametinib causes YAP1 nuclear translocation in RAS-MAPK activated neuroblastoma cell lines

We selected 16 of the 39 cell lines recently profiled and reported by our group based on YAP1 mRNA expression and mutation status (46) (Fig 1A). The majority, but certainly not all, of the lines with mutations in the canonical MAPK pathway showed YAP1 mRNA and protein expression, but only one of the seven ALK mutated lines, and this line (SKNSH) showed robust protein expression in the absence of detectable YAP1 mRNA. MYCN amplification and 11q copy number alterations for each cell line can be found in Supplemental Table S1. Given that phosphorylation status and subcellular location are inherent to YAP1 transcriptional activity, we investigated whether trametinib alters YAP1 nuclear localization in two high YAP1 expressing cell lines, NLF and SKNAS. Nuclear and cytoplasmic extracts of NLF and SKNAS were collected after 72 hours of exposure to trametinib. We observed a reduction in cytoplasmic phosphorylated YAP1 across the time course, and a concomitant enrichment of nuclear YAP1 (Fig. 1B and C). Together, these data suggest that trametinib treatment in YAP1-expressing and MAPK mutant neuroblastoma models causes depression of the hippo pathway resulting in rapid (days) translocation of YAP1 to the nucleus.

Figure 1. Trametinib causes nuclear accumulation of unphosphorylated YAP1 protein.

Figure 1.

(A) Expression of YAP1 mRNA (FPKM) across a panel of neuroblastoma cell lines with known RAS-MAPK pathway mutations indicated above. Below, YAP1 (70 kD) is expressed in a subset of RAS-driven neuroblastoma cell lines with a beta-actin (40 kD) loading control. (B-C) 72-hour trametinib treatment of NLF (20 nM) and SKNAS (10 nM) causes nuclear translocation of YAP1 (70 kD) protein compared to TATA Box-binding protein (TBP, 40 kD) (B), which was quantified using densitometry (C).

Loss of YAP1 expression sensitizes neuroblastoma cell lines to trametinib

To determine whether YAP1 plays a role in sensitivity to trametinib in neuroblastoma, we selected two neuroblastoma cell lines, NLF (biallelic NF1 inactivation) and SKNAS (NRAS Q61K), which both harbor endogenous hemizygous deletions of 11q and thus YAP1 (46). We employed lentiviral CRISPR-Cas9 gene editing to produce pools of YAP1 null NLF and SKNAS cells. Lentivirus containing sgRNA targeted to the YAP1 TEAD binding domain or a scrambled control (sgCon) were used to transduce cells (Supplementary Fig. S1A). We observed incomplete reduction of YAP1 mRNA and protein expression in both NLF and SKNAS sgYAP1 pools (Supplementary Fig. S1B and C). Despite this modest reduction in expression, we next showed that the canonical YAP1 target genes CTGF and CYR61 (24) were significantly downregulated in NLF and SKNAS YAP1-depleted cells (Supplementary Fig. S1D), suggesting a significant impact on YAP1-mediated transcription. We next sought to determine the impact of trametinib exposure on cell viability in the isogenic pairs differing in YAP1 transcriptional activity. We observed that the response of these cell lines to trametinib treatment was directly related to the degree of modulation of YAP1 target genes (Supplementary Fig. S1E). Sensitivity to trametinib shifted in both NLF and SKNAS upon YAP1 depletion, with IC50s in SKNAS shifting from 6.57 nM in sgCon) to 0.81 nM in sgYAP1 (p=0.0255), as well as in NLF, with IC50s shifting from 15.98 nM in sgCon to 7.76 nM in sgYAP1 (p=0.0019) (Supplementary Fig. S1E). The growth curves for the sgCon and sgYAP1 lines plateau at 35% viability for both NLF and SKNAS, which is expected for the control lines due to the cytostatic nature of trametinib. However, it is clear that the modest reduction of YAP1 expression was not sufficient to reduce viability at the highest dose of trametinib in neither NLF nor SKNAS sgYAP1 lines (Supplementary Fig. S1E).

We next selected for clonal YAP1 null NLF cell lines after serial dilution of CRISPR/Cas9 edited cells and isolated four isogenic clones. Indel mutations were confirmed by Sanger sequencing of genomic DNA, with single nucleotide insertions present in NLF YAP1−/− lines #1 and #2, and a single nucleotide deletion in NLF YAP1−/− line #4 (Supplementary Fig. S2). Conversely, NLF YAP1−/− line #3 showed a mixed population flanking the PAM site. We investigated the effect of YAP1 loss on cellular growth and observed a modest growth delay of 20% in the NLF sgYAP1 line compared to the sgCon line (Supplementary Fig. S3). NLF YAP1−/− #2 and #3 mixed clone had comparable growth rates, but the mixed clone reached a similar confluence as sgYAP1. NLF YAP1−/− #1 and #4 cells grew at the slowest rate and only reached to 30–40% of sgCon confluence. All four NLF YAP−/− cell lines showed reduced mRNA expression, and three showed no detectable protein by immunoblotting (Fig. 2A–B). The NLF YAP1−/− #3 mixed clone showed reduced, but detectable, YAP1 protein expression but displayed increased phospho-ERK expression. Based on the Sanger sequencing results and protein expression, the NLF YAP1−/− #3 mixed clone was excluded from subsequent assays. After confirming repression of CTGF and CYR61 mRNA (Fig. 2C), we determined trametinib IC50 values in the isogenic YAP1−/− cell lines. All three YAP1−/− lines were significantly more sensitive to trametinib than NLF sgCon or NLF sgYAP1 pool, with IC50 values reduced from a median of 0.79 – 2.18 nM for the three YAP1−/− (p<0.0001 ) versus 7.62 nM for the pooled sgYAP1 (p<0.0038) compared to 15.58 nM for the sgCon (Fig. 2D and E).

Figure 2. YAP1 knockout sensitizes neuroblastoma cell lines to trametinib.

Figure 2.

A) Four isogenic lines were established from the NLF sgYAP1 CRISPR pooled cell line. YAP1 expression is shown for NLF sgCon, sgYAP1 pool, and YAP1−/− #1–4 (N=3). B) Immunoblots of NLF sgCon, sgYAP1 pool, and YAP1−/− #1–4 for YAP, p-YAP, p-ERK, ERK, and beta-actin. C) Expression of YAP1 target genes, CTGF and CYR61, in NLF sgCon, sgYAP1 pool, and YAP1−/− #1–4. D-E) IC50 curves for trametinib in NLF sgCon, sgYAP1 pool, and YAP1−/− #1–4 over a 6-log dose range (D) and a graphical representation of IC50 values (E) of trametinib (N=3). Student’s t-test, * = P < 0.05, ** = P < 0.01, *** = P < 0.001, **** = P < 0.0001.

Constitutively active YAP1 overexpression induces resistance to trametinib in MAPK pathway activated neuroblastoma cells

The YAP1 protein contains five HXRXXS motifs that are recognized and phosphorylated by LATS1/2 (26). Of these five sites, phosphorylation of S127 on YAP1 promotes binding with 14–3-3 which causes cytoplasmic retention of YAP1. Mutating all five serine residues to alanine ablates the LATS1/2 phosphorylation sites and yields a constitutively-active YAP-5SA protein (26). In order to observe the effect of increased YAP activity in response to trametinib, we overexpressed YAP-5SA cDNA in NB-EBc1 (KRAS G12D) and SKNFI (NF1 homozygous inactivation), which are both de novo YAP1 protein null cell lines (Fig. 1A, Fig. 3A). Forced high overexpression of YAP-5SA protein resulted in variable changes in these cells with different genotypes, in terms of a slight increase in p-YAP1 in the NB-EBc1, and p-ERK in SKNFI. We next confirmed the upregulation of CTGF and CYR61 in both lines (Fig. 3B and 3C). YAP-5SA overexpression induced resistance to trametinib, in which cell viability did not reach 50% in either YAP-5SA overexpressing line compared to the control IC50s in both NB-EBc1 (73.03 nM, p<0.001), and SKNFI (16.94 nM, p<0.0001) (Fig. 3D and E). We then forced YAP-5SA overexpression in NLF YAP1−/− #1 and #4 cell lines, despite the known limitation that the YAP-5SA construct would be recognized and cut by the CRISPR-Cas9 machinery. Despite this, we were able to obtain modest overexpression of constitutively active YAP1, and a likewise (albeit subtler) induction of relative resistance to trametinib, partially rescuing the YAP1−/− phenotype (Supplementary Fig. S4A–C).

Figure 3. YAP-5SA overexpression induces trametinib resistance in low YAP-expressing neuroblastoma cell lines.

Figure 3.

A) Immunoblots of NB-EBc1 and SKNFI empty vector and YAP-5SA-overexpressing cells. Immunoblots were probed for p-YAP1 S127 (70 kD), total YAP1 (70 kD), phospho-ERK (42, 44 kD), total ERK (42, 44 kD), and beta-actin (40kD). B-C) YAP1, CTGF, and CYR61 expression in NB-EBc1 (B) and SKNFI (C) empty vector- and YAP-5SA-overexpressing cells. Relative mRNA expression is represented on a log scale (N=3). Student’s t-test, * = P < 0.05, ** = P < 0.01, *** = P < 0.001, **** = P < 0.0001. D-E) IC50 curves for trametinib between empty vector and YAP-5SA overexpressing NB-EBc1 (P < 0.001) (D) and SKNFI (P < 0.0001) (D) cells (N=3). One-way ANOVA (F(3,74) = 18.69, P < 0.0001) with Sidak multiple comparisons test.

YAP1 mediates resistance to trametinib in neuroblastoma cells with hyperactivated MAPK signalling through transcriptional activation of E2F and MYC(N)

To better understand how YAP1 plays a role in trametinib sensitivity, we performed RNA sequencing of NLF sgCon and two isogenic cell lines, NLF YAP1−/− #1 and #4. All three cell lines were treated in triplicate with 20 nM trametinib or DMSO for 72 hours, at which time total RNA was isolated (Fig. 4A). After total mRNA sequencing, we confirmed that the biological replicates clustered together by principal component analysis (Supplementary Fig. S5A). We next confirmed that YAP1 and downstream transcriptional targets CTGF, and CYR61 mRNA expression was suppressed as predicted in the RNA sequencing data (Supplementary Fig. S5B). Of note, expression of WWTR1, the gene encoding the YAP1 paralog TAZ, follows the same trend as YAP1 and its target genes, which confirms that TAZ expression is not being upregulated to compensate for YAP1 loss (Supplementary Fig. S5B).

Figure 4. Increased trametinib sensitivity upon YAP1 loss is due to loss of E2F and MYC target gene expression.

Figure 4.

A) Workflow of RNA sequencing experiment. NLF sgCon, YAP1−/− #1 and #4 were treated in triplicate with either DMSO or 20 nM trametinib for 72 hours and total RNA was isolated. B) Venn diagram showing shared genes among three differential expression analyses: 1) Trametinib-specific: sgCon DMSO vs. sgCon Tram, 2) YAP1−/− #4-specific: sgCon + DMSO vs. YAP1−/− #4 + DMSO, and 3) YAP1−/− #4 + trametinib: sgCon + DMSO vs. YAP1−/− #4 + trametinib. C) Top 5 gene ontologies represented among the 1,474 unique trametinib-treated YAP1−/− #4 genes. D) Gene set enrichment analysis of the 1,474 unique trametinib-treated YAP1−/− #4 genes with a FWER p value cutoff of <0.01. E) Heatmaps of FPKM values normalized by row for each gene represented in the E2F and MYC target gene sets. F) Gene set enrichment analysis of the 1,474 unique trametinib-treated YAP1−/− #4 genes against the WEI_MYCN_TARGETS_WITH_E_BOX gene set. G) FPKM values among all 6 groups for a subset of E2F and MYC target genes.

We next performed three distinct differential expression analyses using the R package DESeq2 (Fig. 4B; Supplementary Tables S2–4). Differentially-expressed genes were identified between three distinct sets: 1) sgCon treated with either DMSO or trametinib (Trametinib-specific), 2) sgCon and NLF YAP1−/− #4 treated with DMSO (YAP1−/− specific), 3) sgCon + DMSO and NLF YAP1−/− #4 + trametinib (Combination of YAP1 loss and MEK inhibition). Differentially expressed genes in the Trametinib-specific and YAP1−/−-specific groups were subtracted from the trametinib-treated YAP1−/− gene list (Supplementary Table S5). This final dataset represented the 1,474 differentially expressed genes that were unique to the combination of trametinib treatment in a YAP1−/− model. Gene ontology analysis of the transcripts downregulated within this dataset revealed cell cycle and DNA repair pathways as most significantly enriched (Fig. 4C). Gene set enrichment analysis (GSEA) of the 1,474 genes produced only two significantly enriched gene sets with a family-wise error rate of <0.01: E2F and MYC targets (Fig. 4D). Heatmaps of E2F and MYC target genes show reduced expression of target genes in NLF YAP1−/− #1 and #4 compared to sgCon (Fig. 4E). The most striking decrease in expression occurred with trametinib treatment, particularly in the NLF YAP1−/− #4 cell line (Fig. 4E). Importantly, NLF neuroblastoma cells do not express MYC but do express MYCN, suggesting that this gene set actually refers to MYCN gene targets. To test this, we performed an additional GSEA using the WEI_MYCN_TARGETS_WITH_E_BOX gene set (53) (Fig. 4F). We confirmed that MYCN gene targets are significantly enriched in the list of differentially expressed genes, with a family-wise error rate of <0.01 and a normalized enrichment score of −3.22. Expression of relevant cell cycle and DNA replication and repair genes follow a pattern similar to the E2F and MYC heatmaps (Fig. 4G). Changes in expression of E2F1 were more modest, but MYCN expression increases upon YAP1 loss in control-treated NLF YAP1−/− #1 and #4. In response to trametinib, expression in NLF YAP1−/− #1 and #4 decreases to similar levels of control- and trametinib-treated NLF sgCon samples. We also confirmed the change in MYCN protein expression, which follows a similar pattern observed in the differential expression results in response to YAP1 loss and trametinib treatment (Supplementary Fig. S5C). In an effort to connect the changes in MYCN expression to YAP-TEAD signaling, we identified the conserved DNA-binding motif CATTCC which is shared by all four TEAD1–4 transcription factors using the online JASPER tool (7th release, 2018 version) (Supplementary Fig. S6A). We queried the region surrounding the MYCN gene locus using Integrated Genomics Viewer (IGV) and identified CATTCC sense sequences in the MYCN promoter and the first intron, as well as an antisense CATTCC sequence in the MYCN promoter (Supplementary Fig. S6B). This observation confirms that the TEADs are able to bind at the MYCN locus and the loss of YAP-TEAD transcriptional activity upon YAP1 knockout may account for these changes in MYCN expression.

In order to validate these RNA sequencing results, we performed RT-qPCR of five gene targets from Fig. 4G and expression follows the expected pattern (Fig. 5A). We also tested this using the SKNAS sgCon and sgYAP1 pooled lines treated with trametinib (or DMSO), which followed a similar pattern (Fig. 5B). The reduction of target gene expression was less robust than in the NLF YAP1−/− isogenic lines likely due to the mosaic YAP1 expression in the pooled CRISPR line. Since many of the E2F and MYC target genes are involved in the cell cycle and DNA replication, we performed flow cytometry to examine DNA content after 72 hours of trametinib treatment. In response to trametinib, the NLF sgCon cells displayed a minor increase in G1 arrest (Fig. 5C). Loss of YAP1 expression caused a further increase in G1 arrest and an even greater increase in G1 arrest upon trametinib treatment. In the NLF YAP1−/− #4, which had the most significant decrease in YAP1 target gene expression, we observed that 90% of the cells were arrested at G1 in response to trametinib (Fig. 5C). These data were verified in the SKNAS pooled cells, but to a lesser degree as expected (Fig. 5D). We further investigated whether or not the combination of YAP1 loss and trametinib treatment causes apoptosis. We did not observe increases in cleaved PARP or cleaved caspase 3 in the YAP1−/− cell lines treated with or without trametinib (Supplementary Fig. S5C). From these data, we propose that trametinib induces a change in cellular signaling that causes a reduction in YAP1 protein phosphorylation and induces YAP1 nuclear translocation, where it can promote the transcription of E2F and MYCN target genes. In the absence of nuclear YAP1, trametinib treatment induces a significant reduction in E2F and M YCN target gene expression. As a consequence, we have shown G0/G1 cell cycle arrest, thus impairing the proliferative capacity of neuroblastoma cell lines (Fig. 5E).

Figure 5. Trametinib treatment of YAP1−/− cells causes G1 cell cycle arrest.

Figure 5.

(A-B) Expression of CDK1, MCM4, MCM6, POLA1, and CCNE1 in NLF sgCon and YAP1−/− #1 and 4 (N=3) (A) and SKNAS sgCon and sgYAP1 (N=3)(B). Cells were treated with DMSO or trametinib (NLF 20 nM, SKNAS: 10 nM). (C-D) Cell cycle analysis of NLF sgCon and YAP1−/− #1–4 (N=3) (C) and SKNAS sgCon and sgYAP1 (N=3) (D) treated with DMSO or trametinib (NLF: 20 nM, SKNAS: 10 nM) for 72 hours. Flow cytometry was performed to detect the proportion of cells present in G1, S, and G2. (E) Proposed mechanism of inhibiting MEK1/2 signaling and YAP1 activity in RAS-driven neuroblastoma. Dot = phosphorylation. Student’s t-test, * = p<0.05, ** = p<0.01, *** = p<0.001, **** = p<0.0001.

DISCUSSION

Relapsed neuroblastomas remain largely incurable, but recent insight into relapse-specific mutations provide an opportunity to develop targeted therapies (9,12). Hyperactivation of the RAS pathway is a common finding in relapsed neuroblastomas, suggesting this contributes to resistance to standard up front chemoradiotherapy. MEK inhibition shows cytostasis and eventual tumor outgrowth in neuroblastoma preclinical models, highlighting the need to identify combination therapies for this subset of patients.

Here, we identify enhanced activation of Hippo pathway protein YAP1 as a cellular adaptation to MEK1/2 inhibition in RAS-driven neuroblastomas. We show that while only a subset of RAS-driven neuroblastoma cell lines express detectable YAP1 protein, short-term exposure to trametinib induces the translocation of unphosphorylated “active” YAP1 into the nucleus. The exact mechanism causing the reduction in YAP1 protein phosphorylation, as well as the mechanism for nuclear translocation, remains to be defined. The latter may be a result of reduced phosphorylated YAP1, although actin stress fiber formation has been reported to cause nuclear translocation in response to BRAF inhibitor resistance (54). Therefore, there may be multiple mechanisms involved in the YAP1 protein dynamics in response to MEK inhibition. In the YAP1-expressing neuroblastoma cell lines, we discovered that YAP1 protein expression levels were directly related to trametinib sensitivity. In YAP1 expressing cell lines, genetic depletion of YAP1 expression sensitized to trametinib, while overexpression of constitutively active YAP1 induced trametinib resistance in neuroblastoma cell lines with undetectable YAP1. This observation may be clinically useful, as YAP1 transcriptional activity may explain the cytostatic effects of MEK inhibition in RAS-driven neuroblastoma. This finding also supports the purported clinical relevance of YAP1 in this disease, as neuroblastomas have been shown to acquire increased YAP1 transcriptional activity upon relapse (12).

Our findings show that in cells with YAP1 edited out, E2F and MYCN target gene sets were downregulated when MEK1/2 was inhibited. This result provides additional biological value to the importance of the hippo pathway in conferring resistance to RAS-MAPK pathway inhibition. Due to the low MYC expression in NLF cells, we demonstrated that MYCN gene targets were differentially expressed and that MYCN expression increased in response to YAP1 loss but decreased when combined with MEK inhibition. TEAD4 has been reported to bind to a consensus site in the MYCN promoter and function in a YAP1-independent manner in neuroblastoma cells (55). It is possible that the absence of YAP1 may allow the TEAD proteins to initiate an alternate gene expression program. However, we observed that this effect is lost when combined with MEK inhibition. Alternatively, MYCN has been shown to be regulated by E2F proteins in neuroblastoma (56), which may indicate E2F1 target gene expression as the primary cause of the gene expression changes causing the observed G1 cell cycle arrest. The exact mechanism causing E2F gene target expression to decrease remains unclear. YAP and TEAD have been reported to cooperate with E2F by ChIP analyses to coordinate cell cycle gene expression (38). The loss of both MEK-activated and YAP-activated E2F-related gene expression may contribute to the differential gene expression observed in response to MEK1/2 inhibition and YAP1 depletion. Recent literature has also shown that BRAF-inhibitor resistance can induce YAP activated E2F-related cell cycle gene expression in an actin-dependent manner (54). Here, we present data suggesting a similar effect may occur in the context of MEK inhibition in neuroblastomas with RAS activation.

This study has important clinical implications because combinatorial inhibition of MEK1/2 and YAP1 signaling could be an effective combination to circumvent cellular reprogramming. While no hippo pathway modulating drugs are currently be tested in the clinic, there is increasing interest within academia and industry to develop inhibitors of YAP1 activity (57). It is important to note that the clinical relevance of the combination of YAP1 and MEK inhibition in neuroblastoma would be limited to tumors that both harbor RAS-MAPK pathway mutations and express YAP1 (de novo and/or induced by MEK inhibition). As inhibitors of YAP1 activity are developed, our data support the development of combined MEK1/2 and YAP1 inhibition for neuroblastomas with hyperactivated MAPK signalling.

Supplementary Material

1
2
3
4
5
6
7
8

Significance.

High-risk neuroblastomas with hyperactivated RAS signaling, escape the selective pressure of MEK inhibition via YAP1-mediated transcriptional reprogramming, and may be sensitive to combination therapies targeting both YAP1 and MEK.

ACKNOWLEDGEMENTS

This work was supported in part by NIH grants R35 CA220500 and P01CA217959 (JMM), 1F31CA220844-01A1 (GEC) and T32GM008076 (GEC), grants from Cookies for Kids Cancer (GEC, JMM), the Press On Foundation (JMM), the Giulio D’Angio Endowed Chair (JMM), and an Alex’s Lemonade Stand Foundation Young Investigator Award (JLR). We are grateful to Tim Mercer for providing RNA sequins for RNA sequencing and to the Jefferson Cancer Genomics Laboratory for library preparation and next-generation sequencing. pQCXIH-Myc-YAP-5SA was a gift from Kunliang Guan (Addgene plasmid # 33093; http://n2t.net/addgene:33093; RRID:Addgene_33093). pLenti CMV Puro DEST (w118-1) was a gift from Eric Campeau & Paul Kaufman (Addgene plasmid # 17452; http://n2t.net/addgene:17452; RRID:Addgene_17452).

Abbreviations Key

MAPK

mitogen-activated protein kinase

MEK

mitogen-activated extracellular signal-regulated kinase

YAP1

Yes-associated protein

NRAS

neuroblastoma RAS viral oncogene homolog

KRAS

Kirsten rat sarcoma viral oncogene homolog

NF1

neurofibromin 1

Footnotes

The authors declare no potential conflicts of interest.

REFERENCES

  • 1.Hoehner JC, Gestblom C, Hedborg F, Sandstedt B, Olsen L, Pahlman S. A developmental model of neuroblastoma: differentiating stroma-poor tumors’ progress along an extra-adrenal chromaffin lineage. Lab Invest 1996;75:659–75 [PubMed] [Google Scholar]
  • 2.Park JR, Eggert A, Caron H. Neuroblastoma: biology, prognosis, and treatment. Hematol Oncol Clin North Am 2010;24:65–86 [DOI] [PubMed] [Google Scholar]
  • 3.Maris JM, Matthay KK. Molecular biology of neuroblastoma. J Clin Oncol 1999;17:2264–79 [DOI] [PubMed] [Google Scholar]
  • 4.Maris JM, Hogarty MD, Bagatell R, Cohn SL. Neuroblastoma. Lancet 2007;369:2106–20 [DOI] [PubMed] [Google Scholar]
  • 5.Park JR, Bagatell R, London WB, Maris JM, Cohn SL, Mattay KK, et al. Children’s Oncology Group’s 2013 blueprint for research: neuroblastoma. Pediatr Blood Cancer 2013;60:985–93 [DOI] [PubMed] [Google Scholar]
  • 6.Maris JM. Recent advances in neuroblastoma. N Engl J Med 2010;362:2202–11 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Cohn SL, Pearson AD, London WB, Monclair T, Ambros PF, Brodeur GM, et al. The International Neuroblastoma Risk Group (INRG) classification system: an INRG Task Force report. J Clin Oncol 2009;27:289–97 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Mosse YP, Laudenslager M, Longo L, Cole KA, Wood A, Attiyeh EF, et al. Identification of ALK as a major familial neuroblastoma predisposition gene. Nature 2008;455:930–5 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Eleveld TF, Oldridge DA, Bernard V, Koster J, Colmet Daage L, Diskin SJ, et al. Relapsed neuroblastomas show frequent RAS-MAPK pathway mutations. Nat Genet 2015;47:864–71 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Padovan-Merhar OM, Raman P, Ostrovnaya I, Kalletla K, Rubnitz KR, Sanford EM, et al. Enrichment of Targetable Mutations in the Relapsed Neuroblastoma Genome. PLoS Genet 2016;12:e1006501. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Schleiermacher G, Javanmardi N, Bernard V, Leroy Q, Cappo J, Rio Frio T, et al. Emergence of new ALK mutations at relapse of neuroblastoma. J Clin Oncol 2014;32:2727–34 [DOI] [PubMed] [Google Scholar]
  • 12.Schramm A, Koster J, Assenov Y, Althoff K, Peifer M, Mahlow E, et al. Mutational dynamics between primary and relapse neuroblastomas. Nat Genet 2015;47:872–7 [DOI] [PubMed] [Google Scholar]
  • 13.Rader J, Russell MR, Hart LS, Nakazawa MS, Belcastro LT, Martinez D, et al. Dual CDK4/CDK6 inhibition induces cell-cycle arrest and senescence in neuroblastoma. Clin Cancer Res 2013;19:6173–82 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Hart LS, Rader J, Raman P, Batra V, Russell MR, Tsang M, et al. Preclinical Therapeutic Synergy of MEK1/2 and CDK4/6 Inhibition in Neuroblastoma. Clin Cancer Res 2017;23:1785–96 [DOI] [PubMed] [Google Scholar]
  • 15.Umapathy G, Guan J, Gustafsson DE, Javanmardi N, Cervantes-Madrid D, Djos A, et al. MEK inhibitor trametinib does not prevent the growth of anaplastic lymphoma kinase (ALK)-addicted neuroblastomas. Sci Signal 2017;10 [DOI] [PubMed] [Google Scholar]
  • 16.Lugowska I, Kosela-Paterczyk H, Kozak K, Rutkowski P. Trametinib: a MEK inhibitor for management of metastatic melanoma. Onco Targets Ther 2015;8:2251–9 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Lito P, Saborowski A, Yue J, Solomon M, Joseph E, Gadal S, et al. Disruption of CRAF-mediated MEK activation is required for effective MEK inhibition in KRAS mutant tumors. Cancer Cell 2014;25:697–710 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Lito P, Rosen N, Solit DB. Tumor adaptation and resistance to RAF inhibitors. Nat Med 2013;19:1401–9 [DOI] [PubMed] [Google Scholar]
  • 19.Zhao Y, Adjei AA. The clinical development of MEK inhibitors. Nat Rev Clin Oncol 2014;11:385–400 [DOI] [PubMed] [Google Scholar]
  • 20.Yao Z, Torres NM, Tao A, Gao Y, Luo L, Li Q, et al. BRAF Mutants Evade ERK-Dependent Feedback by Different Mechanisms that Determine Their Sensitivity to Pharmacologic Inhibition. Cancer Cell 2015;28:370–83 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Huang J, Wu S, Barrera J, Matthews K, Pan D. The Hippo signaling pathway coordinately regulates cell proliferation and apoptosis by inactivating Yorkie, the Drosophila Homolog of YAP. Cell 2005;122:421–34 [DOI] [PubMed] [Google Scholar]
  • 22.Dong J, Feldmann G, Huang J, Wu S, Zhang N, Comerford SA, et al. Elucidation of a universal size-control mechanism in Drosophila and mammals. Cell 2007;130:1120–33 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Overholtzer M, Zhang J, Smolen GA, Muir B, Li W, Sgroi DC, et al. Transforming properties of YAP, a candidate oncogene on the chromosome 11q22 amplicon. Proc Natl Acad Sci U S A 2006;103:12405–10 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Chan SW, Lim CJ, Chen L, Chong YF, Huang C, Song H, et al. The Hippo pathway in biological control and cancer development. J Cell Physiol 2011;226:928–39 [DOI] [PubMed] [Google Scholar]
  • 25.Chen Q, Zhang N, Xie R, Wang W, Cai J, Choi KS, et al. Homeostatic control of Hippo signaling activity revealed by an endogenous activating mutation in YAP. Genes Dev 2015;29:1285–97 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Zhao B, Wei X, Li W, Udan RS, Yang Q, Kim J, et al. Inactivation of YAP oncoprotein by the Hippo pathway is involved in cell contact inhibition and tissue growth control. Genes Dev 2007;21:2747–61 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Pan D The hippo signaling pathway in development and cancer. Dev Cell 2010;19:491–505 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Yu FX, Zhao B, Panupinthu N, Jewell JL, Lian I, Wang LH, et al. Regulation of the Hippo-YAP pathway by G-protein-coupled receptor signaling. Cell 2012;150:780–91 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Wu S, Huang J, Dong J, Pan D. hippo encodes a Ste-20 family protein kinase that restricts cell proliferation and promotes apoptosis in conjunction with salvador and warts. Cell 2003;114:445–56 [DOI] [PubMed] [Google Scholar]
  • 30.Wei X, Shimizu T, Lai ZC. Mob as tumor suppressor is activated by Hippo kinase for growth inhibition in Drosophila. EMBO J 2007;26:1772–81 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Lei QY, Zhang H, Zhao B, Zha ZY, Bai F, Pei XH, et al. TAZ promotes cell proliferation and epithelial-mesenchymal transition and is inhibited by the hippo pathway. Mol Cell Biol 2008;28:2426–36 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Steinhardt AA, Gayyed MF, Klein AP, Dong J, Maitra A, Pan D, et al. Expression of Yes-associated protein in common solid tumors. Hum Pathol 2008;39:1582–9 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Chen L, Chan SW, Zhang X, Walsh M, Lim CJ, Hong W, et al. Structural basis of YAP recognition by TEAD4 in the hippo pathway. Genes Dev 2010;24:290–300 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Liu-Chittenden Y, Huang B, Shim JS, Chen Q, Lee SJ, Anders RA, et al. Genetic and pharmacological disruption of the TEAD-YAP complex suppresses the oncogenic activity of YAP. Genes Dev 2012;26:1300–5 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Cottini F, Hideshima T, Xu C, Sattler M, Dori M, Agnelli L, et al. Rescue of Hippo coactivator YAP1 triggers DNA damage-induced apoptosis in hematological cancers. Nat Med 2014;20:599–606 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Adler JJ, Johnson DE, Heller BL, Bringman LR, Ranahan WP, Conwell MD, et al. Serum deprivation inhibits the transcriptional co-activator YAP and cell growth via phosphorylation of the 130-kDa isoform of Angiomotin by the LATS1/2 protein kinases. Proc Natl Acad Sci U S A 2013;110:17368–73 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Rayego-Mateos S, Rodrigues-Diez R, Morgado-Pascual JL, Rodrigues Diez RR, Mas S, Lavoz C, et al. Connective tissue growth factor is a new ligand of epidermal growth factor receptor. J Mol Cell Biol 2013;5:323–35 [DOI] [PubMed] [Google Scholar]
  • 38.Kapoor A, Yao W, Ying H, Hua S, Liewen A, Wang Q, et al. Yap1 activation enables bypass of oncogenic Kras addiction in pancreatic cancer. Cell 2014;158:185–97 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Lin L, Sabnis AJ, Chan E, Olivas V, Cade L, Pazarentzos E, et al. The Hippo effector YAP promotes resistance to RAF- and MEK-targeted cancer therapies. Nat Genet 2015;47:250–6 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Shao DD, Xue W, Krall EB, Bhutkar A, Piccioni F, Wang X, et al. KRAS and YAP1 converge to regulate EMT and tumor survival. Cell 2014;158:171–84 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Hong X, Nguyen HT, Chen Q, Zhang R, Hagman Z, Voorhoeve PM, et al. Opposing activities of the Ras and Hippo pathways converge on regulation of YAP protein turnover. EMBO J 2014;33:2447–57 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Slemmons KK, Crose LE, Rudzinski E, Bentley RC, Linardic CM. Role of the YAP Oncoprotein in Priming Ras-Driven Rhabdomyosarcoma. PLoS One 2015;10:e0140781. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Seong BK, Fathers KE, Hallett R, Yung CK, Stein LD, Mouaaz S, et al. A Metastatic Mouse Model Identifies Genes That Regulate Neuroblastoma Metastasis. Cancer Res 2017;77:696–706 [DOI] [PubMed] [Google Scholar]
  • 44.Attiyeh EF, London WB, Mossé YP, Wang Q, et al. Chromosome 1p and 11q deletions an doutcomes in neuroblastoma. N Engl J Med 2005;353:2243–53 [DOI] [PubMed] [Google Scholar]
  • 45.Mlakar V, Mlakar SJ, Lopez G, Maris JM, Ansari M, Gumy-Pause F 11q deletion in neuroblastoma: a review of biological and clinica implications. Mol Cancer 2017; 16:114. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Harenza JL, Diamond MA, Adams RN, Song MM, Davidson HL, Hart LS, et al. Transcriptomic profiling of 39 commonly-used neuroblastoma cell lines. Sci Data 2017;4:170033. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Campeau E, Ruhl VE, Rodier F, Smith CL, Rahmberg BL, Fuss JO, et al. A versatile viral system for expression and depletion of proteins in mammalian cells. PLoS One 2009;4:e6529. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Hardwick SA, Chen WY, Wong T, Deveson IW, Blackburn J, Andersen SB, et al. Spliced synthetic genes as internal controls in RNA sequencing experiments. Nat Methods 2016;13:792–8 [DOI] [PubMed] [Google Scholar]
  • 49.Dobin A, Davis CA, Schlesinger F, Drenkow J, Zaleski C, Jha S, et al. STAR: ultrafast universal RNA-seq aligner. Bioinformatics 2013;29:15–21 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Li B, Dewey CN. RSEM: accurate transcript quantification from RNA-Seq data with or without a reference genome. BMC Bioinformatics 2011;12:323. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Wong T, Deveson IW, Hardwick SA, Mercer TR. ANAQUIN: a software toolkit for the analysis of spike-in controls for next generation sequencing. Bioinformatics 2017;33:1723–4 [DOI] [PubMed] [Google Scholar]
  • 52.Chen J, Bardes EE, Aronow BJ, Jegga AG. ToppGene Suite for gene list enrichment analysis and candidate gene prioritization. Nucleic Acids Res 2009;37:W305–11 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Wei JS, Song YK, Durinck S, Chen QR, Cheuk AT, Tsang P, et al. The MYCN oncogene is a direct target of miR-34a. Oncogene 2008;27:5204–13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Kim MH, Kim J, Hong H, Lee SH, Lee JK, Jung E, et al. Actin remodeling confers BRAF inhibitor resistance to melanoma cells through YAP/TAZ activation. EMBO J 2016;35:462–78 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Rajbhandari P, Lopez G, Capdevila C, Salvatori B, Yu J, Rodriguez-Barrueco R, et al. Cross-cohort analysis identifies a TEAD4-MYCN positive feedback loop as the core regulatory element of high-risk neuroblastoma. Cancer Discovery 2018;8:582–99. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Strieder V, Lutz W. E2F proteins regulate MYCN expression in neuroblastomas. J Biol Chem 2003;278:2983–9 [DOI] [PubMed] [Google Scholar]
  • 57.Chan P, Han X, Zheng B, DeRan M, Yu J, Jarugumilli GK, et al. Autopalmitoylation of TEAD proteins regulates transcriptional output of the Hippo pathway. Nat Chem Biol 2016;12:282–9. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

1
2
3
4
5
6
7
8

RESOURCES