Skip to main content
Journal of Animal Science logoLink to Journal of Animal Science
. 2019 Nov 7;97(12):5009–5015. doi: 10.1093/jas/skz346

Serotonin regulates maternal calcium homeostasis during the perinatal period of sheep

Lu Jin 1,b, Nameiriga 1,b, Haizhou Sun 1,, Sang Dan 1, Shengli Li 1, Chongzhi Zhang 1, Chunhua Zhang 1, Xiaoping Ren 1, Dan Shan 1, Shuli Ling 1
PMCID: PMC6915205  PMID: 31697833

Abstract

The goal of this experiment was to demonstrate the ability of an infusion of serotonin (5-HT; 5-hydroxytryptamine) precursors to increase 5-HT production during the transition from pregnancy to lactation and its effects on gene expression related to calcium (Ca) transporters in the mammary gland and bone resorption markers in the femur. Thirty pregnant Bamei mutton sheep were randomly assigned to 3 experimental groups. All groups received a daily intravenous infusion of saline (control group; n = 10), saline containing 0.178 mg of L-tryptophan/kg body weight (BW) (TRP group, n = 10) or 0.178 mg of 5-hydroxytryptophan/kg BW (5-HTP group, n = 10), beginning on day 7 of prepartum and continuing until delivery. Serum (pre- and postpartum), milk (postpartum), and femur and mammary gland tissue (day 9) were collected. Sheep infused with 5-HTP had a larger total serum Ca concentration on days 3, 6, 15, and 30 of lactation and total milk Ca concentration on days 3, 6, 12, and 15 of lactation compared with that of the control group. Sheep infused with 5-HTP and TRP increased blood and milk concentrations of 5-HT on days 3, 6, 9, and 30 of lactation and parathyroid hormone-related protein (PTHrP) on day 3 of prepartum and on days 3, 6, and 15 of lactation (P < 0.05). In addition, compared to that of the control group, the TRP or 5-HTP infusion upregulated PTHrP, a sodium/calcium exchanger, plasma membrane Ca2+ ATPase 2, secretory pathway Ca2+ ATPase 1, and calcium sensing receptor mRNA expression in mammary gland and receptor-activated nuclear factor kappa-B ligand mRNA expression in the femur, but had no effect on receptor-activated nuclear factor kappa-B and osteoprotegerin mRNA expression in the femur (P < 0.05). This suggests that 5-HT and PTHrP may be involved in regulating maternal Ca homeostasis during the transition from pregnancy to lactation in the sheep.

Keywords: calcium, parathyroid hormone-related protein, serotonin

Introduction

Adequate maternal circulating calcium (Ca) concentrations throughout the transition period from pregnancy to lactation are necessary for productive lactation, but large quantities of Ca are lost from maternal Ca pools to milk and colostrum. The increased Ca demand by the mammary glands for milk production at the onset of lactation draws Ca from the blood and the extracellular fluid pool faster than it can be replaced by the dam, thereby depleting the mother’s circulating Ca levels and leading to the development of periparturient subclinical or clinical hypocalcaemia in lactating dairy cows and other mammals (Goff, 2014). Subclinical or clinical hypocalcaemia is a gateway disease for the onset of a variety of other transition-related disorders (Martín-Tereso and Verstegen, 2011).

Several pathways exist to protect the lactating mother against hypocalcaemia. For example, intestinal calcitriol increases Ca absorption from the diet, and renal mechanisms reduce Ca elimination (Kovacs, 2011). Lieben et al. (2011) showed that calcitriol increased the efficiency of passive paracellular transport of Ca by increasing the expression of claudin-2 and claudin-12 in the gut. Hoenderop et al. (2005) showed that calcitriol regulated Ca reabsorption, which is mediated by active transcellular transport in the distal nephron in the kidney. However, the main homeostatic mechanism in the lactating mother is the mobilization of bone Ca. Parathyroid hormone-related protein (PTHrP), which is present in rat, human, goat, and bovine milk and in the serum of the lactating mother (Budayr et al., 1989), has been described as the molecule responsible for mobilization of Ca from bone that occurs at the onset of lactation in mammals (Wysolmerski, 2010; Mahadevan et al., 2012). It has been reported that the mRNA and protein concentrations of PTHrP are induced by suckling and rise over the first few days postpartum (Rakopoulos et al., 1992).

Serotonin [5-hydroxytryptamine (5-HT)], derived from nonneuronal sources, is a monoamine synthesized from the essential amino acid L-tryptophan (TRP) in a 2-step reaction. The first step is the production of 5-hydroxytryptophan (5-HTP) via the rate-limiting enzyme, tryptophan hydroxylase (TPH). The second step is the conversion of 5-HTP to serotonin by aromatic amino acid decarboxylase (AADC), and serotonin exerts its actions via signaling through more than 15 receptors (Wang et al., 2002). TPH1 is the rate-limiting enzyme for serotonin production in nonneuronal tissues, whereas TPH2 is used to produce serotonin in neuronal tissues. Recent studies have indicated that 5-HT regulates mammary gland metabolism, including the regulation of Ca concentration in blood transferred from the bone (Hernandez et al., 2012). Hernandez et al. (2012) showed that 5-HT treatment of lactogen-treated mammary epithelial cells induced PTHrP expression. Laporta et al. (2013) showed that feeding rats with supplemental 5-HTP during the pregnancy to lactation transition increased PTHrP and Ca in circulation and milk. Pharmacologic inhibition of TPH1 prevents bone loss in rodents that have undergone ovariectomy, and 5-HT deficiency in rodents reduces mammary and circulating PTHrP concentrations (Wysolmerski, 2010). Considerable research has focused on mice, and there are few studies have investigated the effects of 5-HT on bone Ca mobilization during the transition from pregnancy to lactation in sheep. Thus, the objective of the present study was to determine whether increased endogenous peripheral (nonneuronal) 5-HT levels, via infusion of supplemental TRP or 5-HTP, 2 known precursors in 5-HT synthesis, would increase maternal bone turnover and Ca mobilization and maintain appropriate circulating maternal concentrations of ionized Ca, and clarify the downstream pathways that mobilize Ca from the bone in sheep around parturition.

Materials and Methods

Animals and Experimental Design

The use of animals was approved by the Animal Care and Use Committee of the Inner Mongolia Academy of Agriculture and Animal Sciences (Hohhot, Inner Mongolia, China). We used multiparity Bamei mutton sheep of known gestational age mated with a ram after estrus synchronization. Thirty pregnant Bamei mutton sheep (average age 4 to 4.5 years old, average lactation parity 3, and average body weight 50 ± 10 kg) were randomly assigned to 3 experimental groups. Groups received a daily intravenous infusion of 30 mL of saline (control group; n = 10), saline containing 3.34 mg of TRP/kg of body weight (BW) (TRP group, n = 10), or 3.34 mg of 5-HTP/kg of BW (5-HTP group, n = 10). Bamei mutton sheep were intravenously infused from the 7th day (−7) before the predicted parturition date until parturition, resulting in at least 4 d of infusion (7 ± 3 d of infusion). All sheep lambed within a 6-d period. Tryptophan (Catalog no. T0254) and 5-HTP (Catalog no. H9772) were purchased from the Sigma (St. Louis, MO). Immediately before use, the stock solution was diluted to the desired concentration with saline and subsequently sterile-filtered at room temperature. Diets were fed as total mixed rations. Ingredient and nutrient composition of the diets are presented in Table 1. Sheep were group-housed and kept in a free-stall housing system with free access to water.

Table 1.

Composition and nutrient levels of experiment diet (dry matter basis)

Items Content
Guinea grass 28.00
Alfalfa 35.00
Soybean meal 10.20
Corn 7.50
Wheat bran 5.50
Maize germ meal (expeller) 9.70
Corn oil 2.10
Premix 1.50
Salt 0.50
Total 100.00
Nutrient levels1
Metabolizable energy, MJ/kg DM 9.94
Dry matter, % 90.34
Crude protein, %DM 15.02
Calcium, %DM 0.63
Phosphorous, %DM 0.29
aNDFom, g2 785.74
Nonfibrous carbohydrates, g 457.60
Nonfibrous carbohydrates: neutral detergent fiber 0.58

1Determined from the laboratory analyses.

2aNDFom assayed with a heat stable amylase and expressed exclusive of residual ash.

Blood and Milk Analysis

At day 0, 30, and 60 of the lactation period, morning (0700 h) and afternoon (1600 h) samples of milk were taken by hand from each sheep, pooled on a yield basis, and subsequently stored at −20 °C until analysis for the content of Ca and 5-HT.

Blood samples were collected on the morning of day 3 before the first infusion. After parturition, blood samples were taken every 3 d until day 15, and a final sample was collected on day 30. Blood samples were taken from the jugular vein of all sheep and placed into separate tubes for serum collection and plasma collection, the latter containing 3K-EDTA. During the prepartum period, blood samples were always collected before the infusion of either the control or experimental solution. Blood was stored either on wet ice (plasma tubes) or at room temperature (serum tubes) until centrifugation at 3,000 rpm for 25 min at 4 °C to obtain either plasma or serum, which was stored at −20 °C until analyses. Blood total Ca was measured using commercial colorimetric assay kits (No. C004-2-1, Nanjing Jiancheng Bioengineering Institute, Nanjing, China) according to the manufacturer’s instructions. The absorbance was measured by a spectrophotometer at specific wavelengths (UN2CO-WFT2100, Shanghai, China). Serum 5-HT concentrations were analyzed by enzyme-linked immunosorbent assay (ELISA) kits (No. tw043062, NeoScientific, NEO Group, Inc., Shanghai, China) according to the manufacturer’s protocol. The inter- and intra-assay coefficient of variation (CV) were less than 10% and 10%, respectively. Plasma PTHrP concentrations were measured by ELISA (Sheep parathyroid hormone-related protein ELISA kit; No. CSB-EL018991SH, Wuhan Cusabio Biotech Co., Ltd., China) according to the manufacturer’s instructions. The inter- and intra-assay CV were less than 10% and 8%, respectively. The absorbance of each well was measured using a STAT FAX 2100 microplate reader (Awareness Technology Inc.).

RNA Isolation and Reverse Transcriptase

On day 9 of lactation, 6 sheep in each group were euthanized under halothane anesthesia. The femur (including cortical bone and trabecular bone) was removed, the attached muscles and connective tissues were removed, a sample of the femur was crushed with sterilized pliers, and it was placed into an Eppendorf tube. Then, the femur and mammary gland tissue were frozen in liquid nitrogen and stored at −80 °C until RNA extraction. Total RNA was extracted using TRIzol solution (No. 9108, TaKaRa, Inc., Dalian, China) according to the manufacturer’s instructions. Femur or mammary gland tissue (100 µg) was placed in a frozen mortar, 1 mL of TRIzol regent was added, and the tissue was quickly homogenized in an ice bath and fully crushed. Next, cDNA was synthesized in 10 μL reactions containing 2 μL of 5× Prime Script Buffer, 0.5 μL of Prime Script RT Enzyme Mix I, 0.5 μL of Oligo dT Primer (50 μM), 0.5 μL of Random 6-mers (100 μM), and 6.5 μL of RNA reverse transcriptase (RT; No. RR036A, TaKaRa, Inc., Dalian, China). It was held at 37 °C for 15 min, and then 85 °C for 5 s. The RT product (cDNA) was stored at −20 °C for quantitative PCR assay.

Real-Time Polymerase Chain Reaction Analysis

All primers (see Table 2) were designed using Oligo software (National Biosciences, Plymouth, MN) and custom-synthesized (Sangon Biological Technologies, Shanghai, China). Real-time polymerase chain reaction (RT-PCR) analysis was performed using a Bio-Rad iCycler IQ5 detector system (Perkin Elmer-Applied Biosystems, Foster City, CA). Real-time polymerase chain reaction products were analyzed by generating a melting curve. The melting curve of a product is sequence-specific and can be used to distinguish nonspecific from specific PCR products. Every melting curve after amplification showed a single melting peak, indicating a specific product. The amplification efficiency curves were obtained by amplification of a dilution series of cDNA. All amplification efficiency tended to 1 (E = 0.8 to 1.2).

Table 2.

Primer sequence

Genes1 Primer sequences (5′-3′) Length, bp GenBank no.
CasR F: TGCCACTCAAAAGCATTGCC 119 XM_012162995.2
R: GCAGCTAGGAAGTGCCAGAA
NCX F: GAAGGGCTGCTAAGGAGGG 166 XM_012173073.2
R: CAACTGTCCCAACCGGGG
PMCA2 F: GGATGCCTTCAGCTACCAG 138 XM_015102465.1
R: GCGTCTTGCTGTTTGGCTTT
SPCA1 F: TTCATGTGGTTGCTGACAGG 170 XM_018051409.1
R: GTGCAACCTGTTCTTCCTCTCT
SPCA2 F: CCTTCCACGTGTGTCCATCTT 98 XM_015100397.1
R: CGGTCATAGCCACAATTGCC
PTHrP F: CGCCCGGCAAGAAAAAGAAA 171 NM_001285753.1
R: AATGCCTCCGTGAGTTGAGC
OPG F: GAGTGCTACACCCAGGAACC 97 XM_004011767.2
R: CTACAGGGCGCTTTGGATGA
RANKL F: AAGACGGCTTCTACTACCT 154 XM_018056784.1
R: GTGCTTCCTCCTTTCATC
RANK F: TCTGGCGTCCACAGTCAA 111 XM_018039366.1
R: ATAACGGGAGGTCAAAGG
CTSK F: GGGGGACATGACCAGTGAAG 192 XM_004002465.2
R: AAAGCCCAACAGGAACCACA
GAPDH F: GGCGTGAACCACGAGAAGTA 141 NM_001190390.1
R: GGCGTGGACAGTGGTCATAA

1CaSR, calcium sensing receptor; NCX, sodium/calcium exchanger; PMCA, plasma membrane Ca2+ ATPase; SPCA, secretory pathway Ca2+ ATPase; PTHrP, parathyroid hormone-related protein; OPG, osteoprotegerin; RANKL receptor-activated nuclear factor kappa-B ligand; RANK, receptor-activated nuclear factor kappa-B; CTSK, cathepsin K; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.

Relative levels of specific gene mRNA were quantified using SYBR Prime Script RT-PCR Kit (No. RR820A, TaKaRa, Inc., Dalian, China) following the manufacturer’s instructions. In brief, the PCR reaction system (20 μL) contained 10 μL of 2× SYBR Premix Ex Taq, 0.4 μL (10 μM) of forward and reverse specific primers, 2 μL of cDNA template, and 7.2 μL of RNA-free H2O. The reaction mixture was then heated to 95 °C for 30 s and subjected to 40 cycles (95 °C for 5 s, 60 °C for 30 s, and 72 °C for 30 s) of PCR. Detection of the fluorescent product was conducted at the end of the melting curve program (70 to 95 °C with a heating rate of 0.5 °C/s and continuous fluorescence measurement). We used the stability of Ct value to verify the appropriateness of the reference control. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as a housekeeping gene. It was stably expressed in the tissues, and did not change under the infusion condition in this experiment. The Ct value of each treatment was 19.79, 19.44, and 19.60, respectively. The mRNA expression of a target gene was normalized to that of GAPDH. Relative mRNA expression levels were calculated using the 2−ΔΔCT method (Livak and Schmittgen, 2001). The PCR products were analyzed by electrophoresis on 2% agarose gels and stained by nucleic acid dye.

Statistical Analysis

Data were evaluated with an analysis of variance and Duncan’s multiple range test using SAS software (SAS Version 9.0, SAS Institute, Cary, NC, 2003). Differences of P < 0.05 were considered significant, whereas differences of 0.05 < P < 0.10 were regarded as a statistical trend.

Results

Change in Concentration of Ca, 5-HT, and PTHrP in Perinatal Ewes

The effect of serotonin on Ca concentration in perinatal ewes is presented in Table 3. Tryptophan infusion increased total serum Ca concentration on days 15 and 30 of lactation and total milk Ca concentration on days 3, 6, and 15 of lactation (P < 0.05). Sheep infused with 5-HTP had increased total serum Ca concentration on days 3, 6, 15, and 30 of lactation and total milk Ca concentration on days 3, 6, 12, and 15 of lactation compared with that of the control group (P < 0.05). The largest serum concentration of Ca was observed on day 30 after parturition.

Table 3.

Effect of serotonin on Ca concentration in perinatal ewes1

Group2
Index Time Control TRP 5-HTP SEM P-value
Ca concentration in blood, mmol/L −3 d 2.65 2.79 2.90 0.12 0.302
3 d 2.31b 2.62ab 2.74a 0.18 0.035
6 d 2.51b 2.71ab 2.92a 0.31 0.046
9 d 1.81b 2.38ab 2.58a 0.18 0.008
15 d 1.75b 2.60a 2.90a 0.31 0.001
30 d 2.96b 3.23a 3.24a 0.07 0.029
Ca concentration in milk, mmol/L 3 d 2.79b 3.60a 3.75a 0.67 0.017
6 d 2.18b 3.23a 3.48a 0.36 0.007
9 d 3.34 3.64 3.61 0.32 0.997
12 d 3.23b 3.57ab 4.51a 0.54 0.048
15 d 3.31b 4.03a 4.23a 0.45 0.026
30 d 3.15 3.47 3.83 0.32 0.616

1In the same row, values with adjacent small letter superscripts mean significant difference (P < 0.05), and with interphase small letter superscripts mean significant difference (P < 0.01).

2TRP, tryptophan; 5-HTP, 5-hydroxytryptophan.

As shown in Tables 4 and 5, treatment of sheep with 5-HTP and TRP elevated the blood and milk concentrations of 5-HT on days 3, 6, 9, and 30 during lactation and PTHrP on day 3 of prepartum and on days 3, 6, and 15 during lactation (P < 0.05). The 5-HTP group showed a much greater value.

Table 4.

The change of concentration of serotonin in perinatal ewes1

Group2
Index Time Control TRP 5-HTP SEM P-value
5-serotonin concentration in blood, ng/L −3 d 1,329.54b 1,469.41ab 1,538.45a 146.75 0.048
3 d 1,373.47b 1,623.63ab 1,694.46a 91.31 0.035
6 d 1,394.39b 1,600.32a 1,651.42a 151.62 0.005
9 d 1,328.64b 1,579.69b 1,636.18a 268.39 0.011
15 d 1,176.81 1,356.14 1,374.07 143.39 0.391
30 d 1,403.96b 1,574.31b 1,698.94a 88.36 0.009
5-serotonin concentration in milk, ng/L 3 d 1,189.96 1,258.11 1,381.25 157.93 0.336
6 d 967.01b 1,511.74ab 1,562.71a 153.79 0.009
9 d 1,449.53b 1,596.47ab 1,616.32a 123.15 0.032
12 d 1,050.41 1,250.96 1,421.73 74.64 0.021
15 d 1,098.07ab 1,382.02b 1,523.00a 293.94 0.037
30 d 1,159.62b 1,423.71a 1,594.48a 122.15 0.025

1In the same row, values with adjacent small letter superscripts mean significant difference (P < 0.05), and with interphase small letter superscripts mean significant difference (P < 0.01).

2TRP, tryptophan; 5-HTP, 5-hydroxytryptophan.

Table 5.

The effect of serotonin on the concentration of parathyroid hormone related-protein in perinatal ewes1

Group2
Time Control TRP 5-HTP SEM P-value
−3 d 358.5b 407.68b 530.07a 33.451 0.003
3 d 384.4b 440.72a 439.96a 32.328 0.039
6 d 397.17b 444.09a 477.6a 35.106 0.025
9 d 343.1 345.26 411.15 31.625 0.399
15 d 314.57b 459.86a 473.38a 50.364 0.044
30 d 409.32 418.64 430.11 32.262 0.897

1In the same row, values with adjacent small letter superscripts mean significant difference (P < 0.05), and with interphase small letter superscripts mean significant difference (P < 0.01).

2TRP, tryptophan; 5-HTP, 5-hydroxytryptophan.

mRNA Expression of the Ca Transporter-Related Gene in Ewe Mammary Gland

Table 6 shows that the effect of serotonin on the expression of the Ca transporter-related gene mRNA in the ewe mammary gland. Compared with that of the control group, infusion of TRP or 5-HTP upregulated PTHrP, the sodium/Ca exchanger (NCX), plasma membrane Ca2+ ATPase 2 (PMCA2), secretory pathway Ca2+ ATPase 1 (SPCA1), and Ca sensing receptor (CaSR) mRNA expression in the mammary gland (P < 0.05).

Table 6.

The mRNA expression of Ca transporter-related gene in ewe’s mammary gland1

Group3
Gene2 Control TRP 5-HTP SEM P-value
PTHrP 1.008b 1.708a 2.082a 0.152 0.028
NCX1 1.017b 1.351ab 1.969a 0.251 0.035
PMCA2 1.922c 4.938b 8.161a 0.681 0.011
SPCA1 1.051 0.912 1.447 0.216 0.497
SPCA2 1.048c 5.077b 6.774a 0.775 0.034
CaSR 1.186b 2.210a 2.248a 0.294 0.045

1In the same row, values with adjacent small letter superscripts mean significant difference (P < 0.05), and with interphase small letter superscripts mean significant difference (P < 0.01).

2PTHrP, parathyroid hormone-related protein; NCX, sodium/Ca exchanger; PMCA, plasma membrane Ca2+ ATPase; SPCA, secretory pathway Ca2+ ATPase; CaSR, Ca sensing receptor.

3TRP, tryptophan; 5-HTP, 5-hydroxytryptophan.

mRNA Expression of Bone Resorption Marker-Related Gene in the Femur

As shown in Table 7, sheep infused with TRP or 5-HTP had increased receptor-activated nuclear factor kappa-B ligand (RANKL) and cathepsin K (CTSK) mRNA expression in the femur (P < 0.05). However, there was no significant difference in receptor-activated nuclear factor kappa-B (RANK) and osteoprotegerin (OPG) mRNA expression (P > 0.10).

Table 7.

The mRNA expression of bone resorption marker-related gene in femur1

Group3
Gene2 Control TRP 5-HTP SEM P-value
RANKL 1.019b 2.279a 2.520a 0.276 0.040
RANK 1.001 0.752 0.999 0.129 0.697
OPG 1.255 0.798 0.774 0.245 0.574
CTSK 1.003b 2.253a 5.417a 0.112 0.006

1In the same row, values with adjacent small letter superscripts mean significant difference (P < 0.05), and with interphase small letter superscripts mean significant difference (P < 0.01).

2RANKL, receptor-activated nuclear factor kappa-B ligand; RANK, receptor-activated nuclear factor kappa-B; OPG, osteoprotegerin; CTSK, cathepsin K.

3TRP, tryptophan; 5-HTP, 5-hydroxytryptophan.

Discussion

Maintenance of adequate blood Ca concentrations at the onset of lactation is a challenging event for most mammalian species and is largely governed by the animal’s ability to mobilize Ca from bones. Approximately 30% to 50% of high-producing cows may suffer from clinical and subclinical hypocalcaemia during the transition from pregnancy to lactation. In recent years, factors such as 5-HT have been manipulated to develop novel and potentially more efficient strategies to prevent hypocalcaemia in parturient dams (Hernández-Castellano et al., 2019). Laporta et al. (2013) studied the mechanism by which 5-HT regulates Ca homeostasis during the perinatal period in TPH1-deficient mice. The results showed that 5-HT produced by a nonneuronal pathway was essential for maintaining maternal circulating Ca in the early postpartum period, and was essential to the induction of PTHrP from the breast, which plays a key role in stimulating Ca mobilization from bone. In this study, we demonstrated that the sheep supplemented with the precursors of 5-HT (5-HTP or TRP) during the transition from pregnancy to lactation increased Ca mobilization from bone and were protected against the normal depletion of circulating Ca during lactation.

The role of serotonin in the mammary gland is activated by 5-HT2b (Hernandez et al., 2009). One of the functions of 5-HT is to induce the synthesis of PTHrP through mammary epithelial cells (MEC). This induction can directly initiate signal transduction by stimulating the 5-HT2b receptor on the basolateral side of MEC, increase the mRNA expression of Orai1 and CaSR, and promote the entry of Ca into the mammary gland. The concentration of Ca in circulation was decreased, and the change in CaSR on the basal lateral surface of the breast epithelium was induced, and the secretion of MEC was stimulated to produce PTHrP. Hernandez et al. (2012) demonstrated that 5-HT regulates the induction of PTHrP in primary BMEC and that lactating mice deficient in the rate-limiting enzyme in nonneuronal 5-HT synthesis (TPH1) exhibited reduced mammary and circulating PTHrP concentrations. TPH1 catalyzes the conversion of L-TRP to 5-HTP, which is converted to 5-HT by AADC. Laporta et al. (2014) demonstrated that after injecting 5-HTP into TPH1 knockout mice, the concentration of Ca was positively correlated with the concentration of 5-HT in the blood and milk. The results of our study showed that the Ca and 5-HT concentrations in blood and milk increased in sheep infusion with both TRP and 5-HTP, as well as blood PTHrP concentration, with the greatest effect in 5-HTP infusion dams. It is likely that the TRP group took more time to increase the circulating 5-HT, in contrast that of 5-HTP, which was exclusively converted to 5-HT, and TRP was utilized for synthesis of 5-HT, as well as numerous other compounds (Wang et al., 2002; Le Floc’h et al., 2011). Therefore, we speculate that perfusion with TRP and 5-HTP can promote the secretion of PTHrP by increasing the concentration of 5-HT, and further promote bone Ca mobilization to maintain the appropriate circulating Ca concentration in sheep during lactation. Hernández-Castellano et al. (2017) observed that when Holstein dairy cows received a daily intravenous infusion of 1.0 mg/kg of 5-HTP from day −10 before the predicted parturition until parturition, the concentration of 5-HT and Ca in the blood increased. A similar trend was observed in the present study.

The main mechanism of maintaining Ca homeostasis during lactation is bone Ca mobilization. The mammary gland has a network of transporters and pumps that enables the trafficking of Ca from the maternal circulation into the milk. During lactation, the CaSR on the basolateral side of MEC detects low blood Ca concentrations because of the increased transport of Ca into the MEC by Ca release-activated Ca channel protein 1 (ORAI1). Ca is either secreted into the milk through the apical PMCA2 or sequestered in the Golgi apparatus by SPCA2 or the endoplasmic reticulum by the sarcoplasmic reticulum Ca ATPase (SERCA) (Ross et al., 2013). Detection of decreased systemic Ca by CaSR results in PTHrP production. Pai and Horseman (2008) demonstrated that peripheral serotonin deficiency during lactation markedly decreased the expression of key Ca pumps and channels (CaSR, PMCA, and ORAI1) both at the protein and transcript level. These particular Ca transporters are important for Ca transfer within and out of MEC (Faddy et al., 2008), and their increase by the perfusion enriched in the precursor for 5-HT supports the overall increase in milk Ca concentration. In present study, we detected increased mRNA expression of PTHrP, NCX1, PMCA2, SPCA1, and CaSR in the mammary gland after administration of exogenous 5-HTP to sheep, supporting the hypothesis that 5-HT may positively affect Ca transport both directly, by increasing its transport and/or indirectly through the interaction of CaSR and PTHrP (VanHouten et al., 2004). Bone formation and resorption are controlled by both systemic and local factors (Datta and Abou-Sumra, 2009). Several studies have shown that peripheral circulating 5-HT can regulate bone mass in humans and rodents (Yadav et al., 2008; Modder et al., 2010). The 5-HT activates expression of various Ca pumps and transporters in the mammary gland to stimulate transport of Ca from blood to milk during sheep lactation. Mammary-derived PTHrP travels through systemic circulation and encounters the type 1 PTH/PTHrP receptor (PTH1R) in the osteoblast (OB) bone cells. The OB then secretes RANKL, which has receptors (RANK) in the osteoclasts (OC). Osteoclast cells subsequently induce Ca mobilization and liberation into circulation. We observed that the 5-HTP or TRP group in our study increased femur mRNA abundance of RANKL. This result coincides with a 5-HTP-induced increase in circulating 5-HT and PTHrP, and it suggests an increase in Ca mobilization from bone at this time.

In general, the process of bone resorption and Ca mobilization to secrete sufficient Ca while maintaining Ca stability in perinatal ewes requires the participation of multiple signaling systems. Therefore, further investigation is required to examine the exact mechanisms involved.

Conclusion

We demonstrated that the infusion of 5-HTP or TRP (0.178 mg/kg of BW) to perinatal sheep enhanced circulating 5-HT and PTHrP, their synthesis by the mammary gland, as well as the related gene expression for mammary gland Ca uptake and resorption of the bone. It is possible that through enhancing the serotonergic system, the induction of calcium mobilization from the bone of late-pregnant ewes could become a novel strategy to prevent subclinical and clinical hypocalcaemia.

Acknowledgments

The study was supported by National industrial technology system of Cashmere and wool (CARS-40-12), Agricultural and animal husbandry science and technology innovation fund project of Inner Mongolia (2018CXJJM04), Inner Mongolia Natural Science Foundation (2016BS(LH)0304) and Inner Mongolia key laboratory of herbivores nutrition of China. The authors thank N. for her help with the laboratory analyses and the crew of the Wulateqianqi livestock improvement workstation for their help with animal care.

Conflict of Interest

None declared.

Literature Cited

  1. Budayr A. A., Halloran B. P., King J. C., Diep D., Nissenson R. A., and Strewler G. J.. . 1989. High levels of a parathyroid hormone-like protein in milk. Proc. Natl. Acad. Sci. USA 86:7183–7185. doi: 10.1073/pnas.86.18.7183 [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Datta N. S., and Abou-Samra A. B.. . 2009. PTH and PTHrP signaling in osteoblasts. Cell. Signal. 21:1245–1254. doi: 10.1016/j.cellsig.2009.02.012 [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Faddy H. M., Smart C. E., Xu R., Lee G. Y., Kenny P. A., Feng M., Rao R., Brown M. A., Bissell M. J., Roberts-Thomson S. J., . et al. 2008. Localization of plasma membrane and secretory calcium pumps in the mammary gland. Biochem. Biophys. Res. Commun. 369:977–981. doi: 10.1016/j.bbrc.2008.03.003 [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Goff J. P. 2014. Calcium and magnesium disorders. Vet. Clin. North Am. Food Anim. Pract. 30:359–381. doi: 10.1016/j.cvfa.2014.04.003 [DOI] [PubMed] [Google Scholar]
  5. Hernandez L. L., Gregerson K. A., and Horseman N. D.. . 2012. Mammary gland serotonin regulates parathyroid hormone-related protein and other bone-related signals. Am. J. Physiol. Endocrinol. Metab. 302:E1009–E1015. doi: 10.1152/ajpendo.00666.2011 [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Hernandez L. L., Limesand S. W., Collier J. L., Horseman N. D., and Collier R. J.. . 2009. The bovine mammary gland expresses multiple functional isoforms of serotonin receptors. J. Endocrinol. 203:123–131. doi: 10.1677/JOE-09-0187 [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Hernández-Castellano L. E., Hernandez L. L., and Bruckmaier R. M.. . 2019. Review: endocrine pathways to regulate calcium homeostasis around parturition and the prevention of hypocalcemia in periparturient dairy cows. Animal 1–9. doi: 10.1017/S1751731119001605 [DOI] [PubMed] [Google Scholar]
  8. Hernández-Castellano L. E., Hernandez L. L., Weaver S., and Bruckmaier R. M.. . 2017. Increased serum serotonin improves parturient calcium homeostasis in dairy cows. J. Dairy Sci. 100:1–8. doi: 10.3168/jds.2016-11638 [DOI] [PubMed] [Google Scholar]
  9. Hoenderop J. G., Nilius B., and Bindels R. J.. . 2005. Calcium absorption across epithelia. Physiol. Rev. 85:373–422. doi: 10.1152/physrev.00003.2004 [DOI] [PubMed] [Google Scholar]
  10. Kovacs C. S. 2011. Calcium and bone metabolism disorders during pregnancy and lactation. Endocrinol. Metab. Clin. North Am. 40:795–826. doi: 10.1016/j.ecl.2011.08.002 [DOI] [PubMed] [Google Scholar]
  11. Laporta J., Keil K. P., Weaver S. R., Cronick C. M., Prichard A. P., Crenshaw T. D., Heyne G. W., Vezina C. M., Lipinski R. J., and Hernandez L. L.. . 2014. Serotonin regulates calcium homeostasis in lactation by epigenetic activation of hedgehog signaling. Mol. Endocrinol. 28:1866–1874. doi: 10.1210/me.2014-1204 [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Laporta J., Peters T. L., Weaver S. R., Merriman K. E., and Hernandez L. L.. . 2013. Feeding 5-hydroxy-l-tryptophan during the transition from pregnancy to lactation increases calcium mobilization from bone in rats. Domest. Anim. Endocrinol. 44:176–184. doi: 10.1016/j.domaniend.2013.01.005 [DOI] [PubMed] [Google Scholar]
  13. Le Floc’h N., Oteen W., and Merlot E.. . 2011. Tryptophan metabolism, from nutrition to potential therapeutic applications. Amino Acids 41:1195–1205. doi: 10.1007/s00726-010-0752-7 [DOI] [PubMed] [Google Scholar]
  14. Lieben L., Carmeliet G., and Masuyama R.. . 2011. Calcemic actions of vitamin D: effects on the intestine, kidney and bone. Best Pract. Res. Clin. Endocrinol. Metab. 25:561–572. doi: 10.1016/j.beem.2011.05.008 [DOI] [PubMed] [Google Scholar]
  15. Livak K. J., and Schmittgen T. D.. . 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods 25:402–408. doi: 10.1006/meth.2001.1262 [DOI] [PubMed] [Google Scholar]
  16. Mahadevan S., Kumaravel V., and Bharath R.. . 2012. Calcium and bone disorders in pregnancy. Indian J. Endocrinol. Metab. 16:358–363. doi: 10.4103/2230-8210.95665 [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Martín-Tereso J., and Verstegen M. W.. . 2011. A novel model to explain dietary factors affecting hypocalcemia in dairy cattle. Nutr. Res. Rev. 24:228–243. doi: 10.1017/S0954422411000126 [DOI] [PubMed] [Google Scholar]
  18. Mödder U. I., Achenbach S. J., Amin S., Riggs B. L., Melton L. J. 3rd, and Khosla S.. . 2010. Relation of serum serotonin levels to bone density and structural parameters in women. J. Bone Miner. Res. 25:415–422. doi: 10.1359/jbmr.090721 [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Pai V. P., and Horseman N. D.. . 2008. Biphasic regulation of mammary epithelial resistance by serotonin through activation of multiple pathways. J. Biol. Chem. 283:30901–30910. doi: 10.1074/jbc.M802476200 [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Rakopoulos M., Vargas S. J., Gillespie M. T., Ho P. W., Diefenbach-Jagger H., Leaver D. D., Grill V., Moseley J. M., Danks J. A., and Martin T. J.. . 1992. Production of parathyroid hormone-related protein by the rat mammary gland in pregnancy and lactation. Am. J. Physiol. 263:E1077–E1085. doi: 10.1152/ajpendo.2006.263.6.E1077 [DOI] [PubMed] [Google Scholar]
  21. Ross D. G., Smart C. E., Azimi I., Roberts-Thomson S. J., and Monteith G. R.. . 2013. Assessment of ORAI1-mediated basal calcium influx in mammary epithelial cells. BMC Cell Biol. 14:57. doi: 10.1186/1471-2121-14-57 [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. SAS Inc 2003. SAS® User’s guide: statistics, version 9.0 edition. SAS Inc., Cary, NC. [Google Scholar]
  23. VanHouten J., Dann P., McGeoch G., Brown E. M., Krapcho K., Neville M., and Wysolmerski J. J.. . 2004. The calcium-sensing receptor regulates mammary gland parathyroid hormone-related protein production and calcium transport. J. Clin. Invest. 113:598–608. doi: 10.1172/JCI18776 [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Wang L., Erlandsen H., Haavik J., Knappskog P. M., and Stevens R. C.. . 2002. Three-dimensional structure of human tryptophan hydroxylase and its implications for the biosynthesis of the neurotransmitters serotonin and melatonin. Biochemistry 41:12569–12574. doi: 10.1021/bi026561f [DOI] [PubMed] [Google Scholar]
  25. Wysolmerski J. J. 2010. Interactions between breast, bone, and brain regulate mineral and skeletal metabolism during lactation. Ann. N. Y. Acad. Sci. 1192:161–169. doi: 10.1111/j.1749-6632.2009.05249.x [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Yadav V. K., Ryu J. H., Suda N., Tanaka K. F., Gingrich J. A., Schütz G., Glorieux F. H., Chiang C. Y., Zajac J. D., Insogna K. L., . et al. 2008. Lrp5 controls bone formation by inhibiting serotonin synthesis in the duodenum. Cell 135:825–837. doi: 10.1016/j.cell.2008.09.059 [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Journal of Animal Science are provided here courtesy of Oxford University Press

RESOURCES