Dietary supplementation with free methionine or methionine dipeptide improves environment intestinal of broilers challenged with Eimeria spp.

Abstract

This study examined the influence of a diet enriched with free methionine (dl-Met) or methionine dipeptide (dl-MMet) on the intestinal health of Eimeria-challenged (EC) and unchallenged (UC) broilers. A non-supplemented, methionine-deficient diet (NS) was used as control. Treatments were arranged in a 2 × 3 factorial completely randomized design with eight replications. Broilers in the EC group were infected with sporulated oocysts of Eimeria spp. (E. acervulina, E. maxima, E. praecox, and E. mitis) at 14 d of age. Performance analysis, light and electron microscopy of the jejunum, analysis of genes related to apoptosis and cell proliferation in the jejunum, and blood tests were performed at 6 days post-inoculation (dpi). EC broilers had poorer performance than UC broilers, regardless of diet (P < 0.001). Broilers fed the dl-Met diet had greater weight gain (P = 0.004) and lower feed conversion ratio (P = 0.019) than broilers fed other diets. Jejunal sections from EC broilers fed the NS diet showed short (P = 0.001) and wide villi (P < 0.001) with increased crypt depth (P < 0.001) and reduced villus / crypt ratio (P = 0.001), jejunal absorptive surface area (P < 0.001), number of neutral goblet cells (Eimeria challenge: P = 0.048; diet P = 0.016), and mucin 2 (MUC2) gene expression (P = 0.018). EC birds fed the dl-MMet diet had higher enterocyte height (P < 0.001). Birds fed the dl-MMet diet had low lamina propria width (P = 0.009). UC broilers fed the dl-Met diet had the highest number of acidic goblet cells (P = 0.005), whereas EC broilers assigned the dl-MMet diet showed the highest number of intraepithelial lymphocytes (P = 0.033). Reduced expression of caspase-3 (CASP3) (P = 0.005), B-cell lymphoma 2 (BCL2) (P < 0.001), mechanistic target of rapamycin (MTOR) (P < 0.001), and ribosomal protein S6 kinase B1 (RPS6KB1) (P < 0.001) genes was observed in EC animals. MTOR expression levels were highest in birds fed the dl-MMet diet (P = 0.004). Plasma activities of aspartate aminotransferase (AST) was influenced by both diet (P = 0.002) and Eimeria challenge (P = 0.005), with EC broilers assigned the NS diet showing the highest levels. EC broilers fed the NS diet had higher creatine kinase (CK) activity (P = 0.049). EC broilers had lower plasma uric acid (P = 0.004) and higher serum mucoproteins level (P < 0.001). These results indicate that methionine dipeptide supplementation is able to mitigate the harmful intestinal effects of Eimeria spp. in broilers.

Introduction

The intestine is a highly dynamic organ composed of different types of epithelial cells. Intestinal epithelial cells are responsible not only for food digestion and nutrient absorption but also for protecting the body against chemical agents and damage caused by commensal and invasive microorganisms, thereby playing a role in the control of homeostasis and intestinal health (Okumura and Takeda, 2017). In birds, several classes of pathogens can affect the intestinal environment, leading to reduced feed efficiency, changes in the local and systemic immune system, and increased susceptibility to abiotic and biotic stresses (Fasina et al., 2008; Park et al., 2008; Belote et al., 2018).

Avian coccidiosis, a disease caused by Eimeria spp., is difficult to control and leads to major economic losses in poultry production every year (Peek and Landman, 2011). Hematological and biochemical changes, as well as alterations in the expression of genes involved in mucus production, apoptosis, cell proliferation, and migration have been observed in animals with coccidiosis or other intestinal infections (Koynarski et al., 2007; Rath et al., 2009; Adamu et al., 2013; Kitessa et al., 2014; Tan et al., 2014; Chen et al., 2015; Melkamu et al., 2018). Changes in intestinal morphology are also observed, mainly related to the apoptosis process, related to the removal of damaged or unwanted cells, functioning as a host defense mechanism during infection (Idris et al., 1997; Sakamoto et al., 2014; Tan et al., 2014).

In general, animals suffering from infection and tissue injury have a high nutrient demand, especially of amino acids (Grimble and Grimble, 1998). Nutritional supplementation with proteins and amino acids can increase the availability of these nutrients for the synthesis of endogenous proteins and peptides that play a role in the defense system (Grimble and Grimble, 1998), contributing to intestinal health.

In corn- and soybean meal-based broiler diets, the essential amino acid methionine is a major growth-limiting factor. Studies have shown that its deficiency can suppress weight gain (Del Vesco et al., 2015), intestinal development (Bauchart-Thevret et al., 2009), and function of the intestinal mucosal immune system (Wu et al., 2018). Previous studies by our research group revealed that methionine supplementation (dl-Met) improves the performance of broilers under harsh environmental conditions through direct and indirect antioxidant effects (Del Vesco et al., 2014; Del Vesco et al., 2015; Gasparino et al., 2018). Methionine contributes to intestinal health and immune function and protects the intestine from cellular damage by attenuating inflammation and oxidative stress and by influencing intestinal permeability (Grimble, 2006; Bauchart-Thevret et al., 2009; Ruth and Field, 2013; Bin et al., 2017; Seyyedin and Nazem, 2017).

Other studies have shown that supplementation with dipeptides may be more advantageous than with free amino acids under certain conditions, such as in the case of intestinal diseases affecting the absorptive capacity of enterocytes (Silk et al., 1974; Matthews and Adibi, 1976). Because dipeptide absorption is mediated by peptide transporter 1 (PepT1), a protein highly resilient to intestinal damage (Barbot et al., 2003; Gilbert et al., 2008), dipeptides are absorbed more efficiently than free amino acids and, therefore, may help prevent protein malnutrition (Matthews and Adibi, 1976; Barbot et al., 2003). Methionine dipeptide is currently used to enrich feeds for aquatic organisms (Mamaug et al., 2012; Nunes et al., 2018). However, there is limited information regarding the effects of methionine dipeptide on physiological, histological, and molecular mechanisms in broilers.

In this study, we hypothesized that methionine deficiency and Eimeria infection could damage the jejunal mucosa of broilers and that such damage could be attenuated by methionine supplementation, whether in the free form or as dipeptide. To test this hypothesis, we investigated the effects of methionine-deficient (NS) and methionine-supplemented diets (dl-Met and dl-MMet) on animal performance, jejunal morphometry (as an indicator of jejunal mucosal integrity), expression of genes related to mucin production and apoptosis, jejunal cell proliferation, and blood parameters in broilers inoculated with sporulated oocysts of Eimeria spp.

Materials and Methods

All animal experiments were approved (CEUA no. 4000170615) by the Animal Ethics Committee of the State University of Maringá, Brazil.

Animals and experimental design

A total of 384 one-day-old male Cobb 500 chicks not vaccinated against coccidiosis were used in the experiments. Birds were housed in suspended cages (1 m², eight chickens per cage) with droppings tray in a temperature-controlled environment under a 24 h light photoperiod. The ambient temperature was initially set at 33 °C and gradually decreased according to bird age, following the recommendations for the Cobb 500 strain. All chicks were raised under the same conditions until 10 d of age. Then, the birds were fasted for 6 h, weighed, and distributed in a completely randomized design, with a 2 × 3 factorial arrangement and eight replications. The first factor was Eimeria challenge: Eimeria-challenged (EC) broilers or unchallenged (UC) broilers. The second factor was diet: non-supplemented, methionine deficient diet (NS), diet enriched with dl-methionine 99% (dl-Met), and diet enriched with methionine dipeptide dl-methionyl-dl-methionine 95% (dl-MMet) (Table 1).

Table 1.

Composition of experimental diets (%)

Ingredients, kg	Diets1
	NS	dl-Met	dl-MMet
Corn, 7.8%	54.89	54.89	54.89
Soybean meal, 46%	37.30	37.30	37.30
Soybean oil	3.80	3.80	3.80
l-Lysine HCl, 78%	0.16	0.16	0.16
l-Threonine, 98.5%	0.04	0.04	0.04
dl-Methionyl-dl-methionine, 95%	-	-	0.29
dl-Methionine, 99%	-	0.28	-
Dicalcium phosphate, 20%	1.53	1.53	1.53
Limestone, 38%	1.16	1.16	1.16
Salt	0.45	0.45	0.45
Vitamin–mineral premix2	0.40	0.40	0.40
Inert filler	0.30	0.02	0.01
Total	100.00	100.00	100.00

¹NS, non-supplemented, methionine deficient diet; dl-Met, diet supplemented with the recommended levels of methionine in the free form, dl-methionine 99%; dl-MMet, diet supplemented with the recommended levels of methionine in the form of dipeptide, dl-methionyl-dl-methionine 95%.

²Diets provided the following nutrients, per kg = retinyl acetate, 3.44 mg; cholecalciferol, 50 µg; dl-α-tocopherol, 15 mg; thiamine, 1.63 mg; riboflavin, 4.9 mg; pyridoxine, 3.26 mg; cyanocobalamin, 12 μg; d-pantothenic acid, 9.8 mg; d-biotin, 0.1 mg; menadione, 2.4 mg; folic acid, 0.82 mg; niacinamide, 35 mg; selenium, 0.2 mg; iron, 35 mg; copper, 8 mg; manganese, 60 mg; zinc, 50 mg; iodine, 1 mg; and butylated hydroxy toluene, 80 mg.

Birds had free access to feed and water throughout the experiment. Diets were based on corn and soybean meal and were formulated according to Rostagno et al. (2011). Anticoccidial drugs were not added to the diets. Feed composition is presented in Table 1, and data on analyzed and calculated nutrient contents are given in Table 2.

Table 2.

Analyzed and calculated nutrient composition of experimental diets

Nutrients	Diets1
	NS	dl-Met	dl-MMet
Analyzed composition 2 , g/kg
Crude protein	217	220	216
Total amino acid
Total lysine	14.14	14.04	13.84
Total methionine	3.38	6.15	6.21
Total methionine + cystine	7.42	10.01	10.08
Total threonine	9.82	10.03	9.67
Total tryptophan	3.16	3.20	3.13
Total valine	11.81	11.99	11.49
Total isoleucine	10.74	10.67	10.42
Total arginine	15.61	16.01	15.42
Calculated digestible amino acid
Digestible lysine	12.87 (100)3	12.78 (100)	12.59 (100)
Digestible methionine	3.05 (24)	5.78 (45)	5.84 (46)
Digestible methionine + cystine	6.53 (51)	9.10 (71)	9.17 (73)
Digestible threonine	8.54 (66)	8.73 (68)	8.41 (67)
Digestible tryptophan	2.81 (22)	2.85 (22)	2.79 (22)
Digestible valine	10.39 (81)	10.56 (83)	10.12 (80)
Digestible isoleucine	9.56 (74)	9.75 (76)	9.27 (74)
Digestible arginine	14.52 (113)	14.89 (117)	14.34 (114)
Calculated composition
AME4, kcal/kg	3.053	3.052	3.052
Calcium, g/kg	8.76	8.76	8.76
Available phosphorus, g/kg	4.50	4.50	4.50
Sodium (g/kg)	2.00	2.00	2.00

¹NS, non-supplemented, methionine deficient diet; dl-Met, diet supplemented with the recommended levels of methionine in the free form, dl-methionine 99%; dl-MMet, diet supplemented with the recommended levels of methionine in the form of dipeptide, dl-methionyl-dl-methionine 95%.

²Diets were formulated on the basis of the total amino acid contents of corn and soybean meal determined by near-infrared reflectance spectroscopy. Values are expressed as grams per kilogram, not as percentage of diet. Total amino acid contents were determined by high-performance liquid chromatography by Evonik Industries, Germany.

³Values in parentheses indicate amino acid/lysine ratios, ideal protein concept.

⁴AME, apparent metabolizable energy.

At 14 d of age, broilers in the EC group (n = 192) were inoculated orally with 1 mL of a suspension of sporulated Eimeria spp. oocysts (2 × 10⁴ oocysts of E. acervulina, 2 × 10⁴ oocysts of E. praecox, 1.6 × 10⁴ oocysts of E. maxima, and 4 × 10⁴ oocysts of E. mitis). Broilers in the UC group (control, n = 192) received instead 1 mL of saline solution. EC and UC broilers were housed separately to prevent cross-infection. At 6 days post-inoculation (dpi; 20 d of age), birds were killed by cervical dislocation.

Diagnosis of coccidiosis

On the 6th dpi, fresh fecal droppings were randomly collected from the bottom tray of the cages. Samples collected from EC and UC broilers were pooled separately for analysis. A qualitative coprological test was used to confirm the presence or absence of oocysts in fecal droppings. The analysis was carried out according to Gordon and Whitlock (1939), with modifications. About 2 g of droppings was dissolved in 15 mL of distilled water and centrifuged at 2500 rpm for 2 min. The supernatant was discarded, and the pellet homogenized in 10 mL of sucrose solution at a density of 1.18 g/mL. The mixture was centrifuged at 2500 rpm for 2 min. The resulting pellet was smeared onto a histological slide and examined under an Olympus P1 BX50 polarized light microscope (Japan) coupled to an Olympus PMC 35B digital camera (40 × objective lens) (Japan).

Animal performance

For performance analyses, each cage (containing eight birds) was considered an experimental unit. Birds were weighed at 14 and 20 d of age, and weight gain (WG) was determined as the difference between the two measurements. Feed intake (FI) was calculated as the difference between the weight of feed offered on day 14 and the weight of residual feed collected at the end of day 20. The feed conversion ratio (FCR) was calculated as the ratio of FI to WG.

Histological analyses

Sample collection and preparation

The jejunum of six broilers per treatment, chosen on the basis of the average body weight of each replicate group, was collected for histological analysis immediately after birds were euthanized, at 6 dpi. A segment (about 5 cm) from the distal portion of the duodenum to the Meckel’s diverticulum was removed, opened longitudinally, washed with sterile physiological solution (4 °C), and fixed in Bouin solution for 6 h. The specimens were stored in 70% alcohol until further processing. Samples were dehydrated in a graded ethanol series, cleared in xylene, and embedded in paraffin. Semi-serial longitudinal sections (3 µm thick) were obtained using a microtome (RM2125 RTS, Leica Biosystems Nussloch GmbH, Germany).

Jejunal morphometry

Histological sections were stained with Hematoxylin and Eosin (HE). Villus height and width and crypt depth and width (Figure 1A) were determined in 20 villi per animal (Gottardo et al., 2016). Results are expressed as µm. Images were captured at 40× magnification using an Olympus PMC 35B digital camera (Japan) mounted on an Olympus P1 BX50 polarized light microscope (Japan). Morphometric measurements were performed using Image-Pro Plus version 4.0 (Media Cybernetics, United States). The villus / crypt ratio was calculated as the ratio of villus height to crypt depth. The absorptive surface area of the jejunal mucosa was estimated according to the equation of Kisielinski et al. (2002): Absorptive surface area = [(VW × VH) + (VW ÷ 2 + CW ÷ 2)² − (VW ÷ 2)²] / [(VW ÷ 2 + CW ÷ 2)²], where VH is the villus height, VW is the villus width, and CW is the crypt width. Surface area results are expressed as µm².

Figure 1.

Representative photomicrograph showing villus height and width (yellow arrows) and crypt depth and width (green arrows) (A). Hematoxylin Eosin stain, HE; magnification, 4×; scale bar, 50 µm. Enterocyte height (yellow arrow) and lamina propria width, green arrow, in the jejunal mucosa of broilers at 6 d post-inoculation with Eimeria spp. (B). Hematoxylin Eosin stain, HE; magnification, 40×; scale bar, 30 µm.

Enterocyte height and lamina propria width (Figure 1B) were measured in 20 villi per animal (120 measurements per treatment). Histological sections were stained with HE, and images were captured at 40× magnification (Olympus PMC 35B digital camera and Olympus P1 BX50 polarized light microscope, Japan). Measurements were taken using Image-Pro Plus version 4.0 (Media Cybernetics). Results are expressed as µm.

Quantification of neutral and acidic goblet cells

Jejunal specimens were stained with Periodic Acid–Schiff (PAS) and counterstained with Eosin for the identification and quantification of neutral goblet cells (Figure 2A). Sections stained with Alcian Blue (AB) (pH 2.5) were used for the identification and quantification of acidic goblet cells (Figure 2B). Images were captured at 10× magnification (Olympus PMC 35B digital camera and Olympus P1 BX50 polarized light microscope, Japan). Neutral and acidic goblet cells were counted in 20 villi per bird (Image-Pro Plus version 4.0, Media Cybernetics).

Figure 2.

Neutral goblet cells, some of which are indicated by yellow arrowheads, in the villi of jejunum of broilers (A). Periodic Acid–Schiff stain, PAS, with Eosin counterstain; magnification, 10×; scale bar, 10 µm. Acidic goblet cells, black arrowheads (B). Alcian Blue stain, AB, pH 2.5; magnification, 10 ×; scale bar, 10 µm. Intraepithelial lymphocytes, green arrowheads. Hematoxylin Eosin stain, HE; magnification, 40 ×; scale bar, 30 µm (C).

Quantification of intraepithelial lymphocytes (IELs)

Sixteen histological images were obtained from six animals per treatment. Histological sections were stained with HE and captured at 40× magnification (Figure 2B) (Olympus PMC 35B digital camera and Olympus P1 BX50 polarized light microscope, Japan), and 160 enterocytes were counted per image, totaling 2,560 enterocytes counted per bird. Results are expressed as the number of IELs / 100 epithelial cells (Ferguson and Murray, 1971; Sant’ana et al., 2012). Cell counting was performed using Image-Pro Plus version 4.0 (Media Cybernetics).

Electron microscopy

Jejunum samples from three birds per treatment were subjected to transmission electron microscopy (TEM) and scanning electron microscopy (SEM) observation. The segment from the distal portion of the duodenum to the Meckel’s diverticulum was collected, opened longitudinally, washed with sterile physiological solution (4 °C), fixed in 2.5% glutaraldehyde solution in 0.1 M sodium cacodylate buffer (pH 7.2) for 2 h at room temperature, and stored at 4 °C until further processing for TEM or SEM analysis.

TEM analysis

Jejunal specimens were cut with a scalpel blade and post-fixed in a solution containing 1% osmium tetroxide, 0.8% potassium ferrocyanide, and 10 mM calcium chloride in 0.1 M cacodylate buffer. Samples were dehydrated in increasing concentrations of acetone and embedded in Epon resin. Ultrathin sections were obtained, stained with uranyl acetate and lead citrate, and examined under a JEOL JEM-1400 microscope (Japan).

SEM analysis

Jejunal fragments of about 1 cm² were dehydrated for 15 min in increasing ethanol concentrations (30, 50, 70, 90, and 100%) and subjected to critical-point drying with carbon dioxide (BAL-TEC Critical Point Dryer CPD-030, Liechtenstein) for 10 cycles. Small cuts were performed vertically and horizontally over samples to facilitate the observation of oocysts within villous. Samples were mounted on stubs with carbon tape, sputtered with a thin layer of gold for three cycles of 260 s at 27 °C and 50 mA (BAL-TEC Sputter Coater SCD-050, Liechtenstein), and observed under a Quanta 250 microscope (FEI Company, United States).

Gene expression

Six broilers from each treatment at 6 dpi were chosen on the basis of the average body weight of each replicate group, and their jejunum (from the distal end of the duodenum to Meckel’s diverticulum) was collected, rinsed with cold sterile saline (4 °C), added to a microtube containing 1 mL of TRIzol (Invitrogen, Carlsbad, CA), and stored at −80 °C until total RNA extraction.

Total RNA was extracted using TRIzol (Invitrogen), according to the manufacturer’s protocol. After extraction, total RNA was quantified at 260 nm using a NanoDrop 2000c spectrophotometer (Thermo Fisher Scientific, United States). RNA integrity was assessed by electrophoresis in 1% agarose gel. Bands were stained with SYBR Safe DNA gel stain (Invitrogen) and visualized under ultraviolet light (L-PIX TOUCH, Loccus Biotechnology, Brazil).

To avoid genomic DNA contamination, 1 µg of total RNA was treated with amplification grade DNase I (Invitrogen), according to the manufacturer’s instructions. Following this procedure, complementary DNA (cDNA) synthesis was performed using the SuperScript III First-Strand Synthesis SuperMix kit (Invitrogen Corporation, Brazil), following the manufacturer’s protocol. cDNA samples were stored at −20 °C until amplification.

Real-time polymerase chain reaction (RT-qPCR) was performed using 5 μL of cDNA diluted to 40–80 ng/µL, 0.5 or 1 μL of each primer (forward and reverse) at 10 µM (corresponding to final concentrations of 200 and 400 nM, respectively), 12.5 μL of SYBR^TM Green PCR Master Mix (Applied Biosystems, United States), and ultrapure water to complete the volume to 25 μL. RT-qPCR reactions were carried out on a thermal cycler StepOne Real-Time PCR system version 2.3 (Applied Biosystems). Thermal cycling conditions were as follows: initial cycle of 95 °C for 10 min, 40 cycles of denaturation at 95 °C for 15 s, and annealing at 60 °C for 1 min. The melting curve was obtained by heating from 65 to 95 °C.

The primers used for the amplification of mucin 2 (MUC2), B-cell lymphoma 2 (BCL2), caspase-3 (CASP3), mechanistic target of rapamycin (MTOR), and ribosomal protein S6 kinase B1 (RPS6KB1) genes were designed on the basis of gene sequences deposited in the National Center for Biotechnology Information (NCBI, www.ncbi.nlm.nih.gov) database using the Integrated DNA Technologies system (www.idtdna.com) (Table 3). The β-actin gene was used as an endogenous control. All analyses were carried out in duplicate, and the results were expressed as arbitrary units (AU). The 2^−∆CT method (Livak and Schmittgen, 2001) was used for relative quantification of gene expression.

Table 3.

Primer sequences used in real-time PCR

Gene1	Primer sequence, 5′→3′ 2	Amplicon size, bp3	Accession number
MUC2	F: GGCATGAAATTCCTTGTGACG	128	JX284122.1
	R: AGTGGGTGTTGGTATGGTG
BCL2	F: GCTTTATCCTCCTGCCCCTC	181	NM_205339.2
	R: CCTTTTTCCTCCACCCTGTT
CASP3	F: TGGTATTGAAGCAGACAGTGGA	103	NM_204725.1
	R: GGAGTAGTAGCCTGGAGCAGTAGA
MTOR	F: TTGGGTTTGCTTTCTGTGGCTGTC	119	XM_417614
	R: ACAGACTTCTGCCTCTTGTGAGCA
RPS6KB1	F: TTTGCCTCCCTACCTCACACAAGA	123	NM_001030721.1
	R: AAGAACGGGTGAGCCTGAACTTCT
β-actin	F: GCCAACAGAGAGAAGATGAC	130	L08165.1
	R: CACCAGAGTCCATCACAATAC

¹ MUC2, mucin 2 gene; BCL2, B-cell lymphoma 2 gene; CASP3, caspase-3 gene (reference: Zuniga et al., 2018); MTOR, mechanistic target of rapamycin gene (reference: Lee, 2012); and RPS6KB1, ribosomal protein S6 kinase B1 gene (reference: Lee, 2012).

²F, forward; R, reverse.

³bp, base pairs.

Plasma analyses

Aspartate aminotransferase (AST), creatine kinase (CK), uric acid (UA), and creatinine (Cr) levels were determined in the blood plasma of six animals per treatment, chosen on the basis of the average body weight of each replicate group (n = 6). Shortly after euthanasia (6 dpi), blood samples were collected from the jugular vein of broilers into heparin tubes. Samples were centrifuged at 3000 rpm for 10 min, and the plasma was separated and stored at −20 °C until use. Analyses were carried out according to the manufacturer’s recommendations (AST, MS10009010018; CK, MS10009010069; UA, MS10009010071; and Cr, MS10009010034; Labtest Diagnóstica, Lagoa Santa, Minas Gerais, Brazil). Readings were performed on an Evolution 300 UV-VIS spectrophotometer (Thermo Fisher Scientific). AST and CK activities are expressed as U/L. UA and Cr levels are expressed as mg/dL.

Serological analyses

Blood samples were collected from the jugular vein of six birds per treatment, chosen on the basis of the average body weight of each replicate group. Samples were collected into a test tube immediately after euthanasia (6 dpi), allowed to clot under refrigeration, and then centrifuged at 3000 rpm for 10 min at 4 °C. The serum was separated and stored at −20 °C until use. Mucoproteins level (MUCO) (MS80022230147) and lactate dehydrogenase (LDH) activity (MS80022230084) determination was performed as per the manufacturer’s instructions (Gold Analisa, Belo Horizonte, Minas Gerais, Brasil). Readings were performed on an Evolution 300 UV-VIS spectrophotometer (Thermo Fisher Scientific). Serum MUCO and LDH results are expressed, respectively as mg/dL of MUCO and U/L.

Statistical analysis

Normality was assessed by the Shapiro–Wilk test, and the effects of treatments on animal performance, intestinal parameters, gene expression, and plasma and serological analyses were analyzed by two-way analysis of variance (ANOVA). All effects were considered fixed. The interaction between Eimeria challenge and diet was also investigated. When interaction and diet effects were significant, means were compared by Tukey’s test at P < 0.05. When Eimeria challenge was significant, Student’s t-test was used for comparison of means, P < 0.05 (SAS version 9.00, 2002; SAS Institute Inc., Cary, NC).

Results

Coprological tests confirmed the absence of oocysts in droppings of UC broilers, thereby validating their use as a control group (Figure 3A). Microscopic observation of the jejunum of UC birds revealed normal mucosal and villous architecture and absence of parasites (Figure 3C). The successful infection of broilers in the EC group was confirmed by the presence of Eimeria spp. oocysts in fecal droppings (Figure 3B) and histological sections of the jejunum (Figure 3D).

Figure 3.

Representative images showing absence of oocysts in coprological samples (A) from unchallenged broilers and presence of oocysts (yellow arrowheads), in coprological samples (B) from Eimeria-challenged broilers at 6 d post-inoculation. Magnification, 40×; scale bar, 30 µm. Histological section of the jejunum of an unchallenged broiler (C). Note the well-preserved morphology and integrity of the membrane. Hematoxylin Eosin stain, HE; magnification, 40 ×; scale bar, 30 µm. Histological section of the jejunum of an Eimeria-challenged broiler at 6 d post-inoculation (D). Note the presence of Eimeria oocysts, green arrowheads. Hematoxylin Eosin stain, HE; magnification, 40×; scale bar, 30 µm.

Figure 4A–C shows representative SEM and light microscopy images of an unsporulated E. maxima oocyst within a jejunal enterocyte. Parasite infection caused loss of mucous membrane integrity, as revealed by TEM (Figure 4D).

Figure 4.

Microscopic images of the jejunal mucosa of broilers at 6 d post-inoculation, dpi with Eimeria spp. oocysts. Scanning electron micrographs showing an unsporulated oocyst of E. maxima within an enterocyte, yellow arrow (A, B). Magnification, 2000×; scale bar, 50 µm (A). Magnification, 15,000×; scale bar, 5 µm (B). Histological section of the jejunal mucosa showing an oocyst of E. maxima within an enterocyte, yellow arrow (C). Hematoxylin Eosin stain, HE; magnification, 40×; scale bar, 30 µm. Transmission electron micrograph of the jejunal epithelium showing cells with damaged apical membrane and loss of brush border integrity, red arrow. Magnification, 10,000 ×; scale bar, 1 µm (D).

Animal performance

The FI, WG, and FCR of broilers at 6 dpi are presented in Figure 5A and B. No interaction effect between Eimeria challenge and diet was observed on FI (P = 0.149), WG (P = 0.906), or FCR (P = 0.116). Eimeria challenge had a negative effect on FI (P < 0.001), WG (P < 0.001), and FCR (P < 0.001) (Figure 5A); that is, EC broilers had lower FI (~14%) and WG (~37%) and higher FCR (~38%) than UC broilers. An effect of diet (Figure 5B) on WG (P = 0.006) and FCR (P = 0.005) was also observed: broilers fed the dl-Met diet showed the highest WG and the lowest FCR. No significant differences in performance parameters were observed between dl-Met and dl-MMet diets or between dl-MMet and NS diets.

Figure 5.

Effects of Eimeria challenge (A) and diet (B) on feed intake, weight gain, and feed conversion ratio of broilers at 6 dpi with Eimeria spp. ^a,bDifferent letters indicate significant differences by Tukey’s test and Student’s t-test (P < 0.05). Results are presented as mean and standard error. Each cage with eight birds was considered an experimental unit, n = 8. UC, unchallenged broilers; EC, Eimeria-challenged broilers; NS, non-supplemented, methionine deficient diet; dl-Met, diet supplemented with free methionine, dl-methionine 99%; dl-MMet, diet supplemented with methionine dipeptide, dl-methionyl-dl-methionine 95%.

Histological analyses

Morphometric analysis of the jejunum

Morphometric results of the jejunum are shown in Table 4. An interaction effect between Eimeria challenge and diet was observed on villus height (P < 0.001), villus width (P < 0.001), crypt depth (P < 0.001), villus/crypt ratio (P = 0.001), jejunal absorptive surface area (P > 0.001), and enterocyte height (P < 0.001). EC broilers fed the NS diet had shorter and wider villi, higher crypt depth, lower villus/crypt ratio, and smaller absorptive surface area. EC broilers fed the dl-MMet diet showed the highest enterocyte height.

Table 4.

Morphometric parameters and absorptive surface area of the jejunum of broilers at 6 d post-inoculation with Eimeria spp.

		Villus height, µm	Villus width, µm	Crypt depth, µm	Villus / crypt ratio	Absorptive surface area, µm2	Enterocyte height, µm
Treatments		Mean	Mean	Mean	Mean	Mean	Mean
UC1	NS3	652.893c	87.008c	145.493d	4.555bc	12.503c	340.478d
	dl-Met4	829.408ab	141.347b	188.262c	4.475c	14.903b	426.280bc
	dl-MMet5	788.362b	93.140c	144.242d	5.598a	17.182a	441.226c
EC2	NS	395.593f	162.895a	209.197a	1.957f	6.500f	417.638b
	dl-Met	435.790e	148.242ab	197.715bc	2.248e	7.168e	432.723bc
	dl-MMet	501.664d	146.206ab	196.684bc	2.612d	8.166d	471.284a
Main Effects
Eimeria challenge	UC	768.655	110.787	162.183	4.871	15.023	408.381
	EC	440.778	152.815	201.464	2.252	7.226	438.741
Diet	NS	498.513	132.540	183.715	2.996	8.901	386.774
	dl-Met	632.600	144.794	192.988	3.362	11.036	429.502
	dl-MMet	645.013	119.673	170.463	4.105	12.674	456.255
P-value
Eimeria challenge		<0.001	<0.0001	<0.001	<0.001	<0.001	<0.001
Diet		<0.001	0.001	<0.001	<0.001	<0.001	<0.001
Eimeria challenge × Diet		0.001	<0.001	<0.001	0.001	<0.001	<0.001
Pooled standard error (SEp)		33.937	13.613	8.409	0.212	0.443	14.740

¹UC, unchallenged broilers.

²EC, Eimeria-challenged broilers.

³NS, non-supplemented, methionine deficient diet.

⁴ dl-Met, diet supplemented with free methionine, dl-methionine 99%.

⁵ dl-MMet, diet supplemented with methionine dipeptide, dl-methionyl-dl-methionine 95%.

^a–fMeans in the same column followed by different letters differ significantly by Tukey’s test (P < 0.05). The bird was considered an experimental unit, n = 6. Results are presented as mean and pooled standard error (SEp).

There was no interaction effect between Eimeria challenge and diet on lamina propria width; however, independent effects of Eimeria challenge (P < 0.001) and diet (P = 0.009) on this parameter were observed (Figure 6). EC broilers had greater lamina propria width than UC broilers (406.44 vs. 181.84 µm, respectively), and broilers fed the dl-MMet diet had the lowest lamina propria width.

Figure 6.

Effects of Eimeria challenge and diet on the width of the lamina propria in the jejunum of broilers at 6 dpi with Eimeria spp. ^a,bDifferent letters indicate significant differences by Tukey’s test and Student’s t-test (P < 0.05). Results are prssesented as mean and standard error. The bird was considered an experimental unit, n = 6. UC, unchallenged broilers; EC, Eimeria-challenged broilers; NS, non-supplemented, methionine deficient diet; dl-Met, diet supplemented with free methionine, dl-methionine 99%; dl-MMet, diet supplemented with methionine dipeptide, dl-methionyl-dl-methionine 95%.

Quantification of neutral and acidic goblet cells and IELs

To broaden our understanding of the effects of the treatments on the intestinal environment of broilers, we determined the number of goblet cells that produce neutral or acid mucus and the percentage of IELs in the jejunum of broilers at 6 dpi (Table 5). We observed an interaction effect between Eimeria challenge and diet on the number of acidic goblet cells (P = 0.005) and IELs (P = 0.033). UC broilers fed the dl-Met diet had the highest number of acidic goblet cells, and EC broilers fed the dl-MMet diet had the highest percentage of IELs. The lowest number of neutral goblet cells was observed in EC broilers (P = 0.048) and in broilers fed the NS diet (P = 0.016).

Table 5.

Quantification of neutral and acidic goblet cells and intraepithelial lymphocytes (IELs) in the jejunum of broilers at 6 d post-inoculation with Eimeria spp.

		Neutral goblet cells	Acidic goblet cells	IELs, %
Treatments		Mean	Mean	Mean
UC1	NS3	62.150	57.600b	11.885d
	dl-Met4	92.233	107.392a	13.652cd
	dl-MMet5	93.300	80.400b	18.368bcd
EC2	NS	65.417	62.533b	25.920b
	dl-Met	64.817	61.700b	21.882bc
	dl-MMet	86.830	71.900b	43.514a
Main Effects
Eimeria challenge	UC	84.567a	85.117	14.753
	EC	71.502b	64.994	29.669
Diet	NS	64.110b	60.560	20.306
	dl-Met	78.525ab	84.546	17.767
	dl-MMet	90.065a	76.150	30.941
P-value
Eimeria challenge		0.048	0.003	<0.001
Diet		0.016	0.019	0.001
Eimeria challenge × Diet		0.140	0.005	0.033
Pooled standard error (SEp)		17.798	17.015	7.138

¹UC, unchallenged broilers.

²EC, Eimeria-challenged broilers.

³NS, non-supplemented, methionine deficient diet.

⁴ dl-Met, diet supplemented with free methionine, dl-methionine 99%.

⁵ dl-MMet, diet supplemented with methionine dipeptide, dl-methionyl-dl-methionine 95%.

^a–dMeans in the same column followed by different letters differ significantly by Tukey’s test and Student’s t-test (P < 0.05). The bird was considered an experimental unit, n = 6. Results are presented as mean and pooled standard error (SEp).

Gene expression

The expression level of MUC2, CASP3, and BCL2 genes in the jejunum of broilers at 6 dpi are shown in Table 6. UC broilers did not differ in MUC2 expression. EC broilers fed the NS diet showed lower (P = 0.018) expression of this gene than EC broilers fed dl-Met or dl-MMet diets. EC birds showed lower expression of CASP3 and BCL2 than UC birds. Diet had no effect on the expression of CASP3 (P = 0.991) and BCL2 (P = 0.068).

Table 6.

Expression of mucin 2 (MUC2), caspase-3 (CASP3), and B-cell lymphoma 2 (BCL2) genes in the jejunum of broilers at 6 d post-inoculation with Eimeria spp.

		MUC2, AU	CASP3, AU	BCL2, AU
Treatments		Mean	Mean	Mean
UC1	NS3	0.730a	0.128	0.005
	dl-Met4	0.650a	0.124	0.007
	dl-MMet5	0.738a	0.114	0.006
EC2	NS	0.196c	0.081	0.003
	dl-Met	0.334b	0.081	0.003
	dl-MMet	0.348b	0.093	0.004
Main Effects
Eimeria challenge	UC	0.706	0.122a	0.006a
	EC	0.293	0.085b	0.003b
Diet	NS	0.463	0.104	0.004
	dl-Met	0.492	0.103	0.005
	dl-MMet	0.543	0.103	0.005
P-value
Eimeria challenge		<0.001	0.005	<0.001
Diet		0.087	0.991	0.070
Eimeria challenge × Diet		0.018	0.575	0.053
Pooled standard error (SEp)		0.057	0.023	0.001

¹UC, unchallenged broilers.

²EC, Eimeria-challenged broilers.

³NS, non-supplemented, methionine deficient diet.

⁴ dl-Met, diet supplemented with free methionine, dl-methionine 99%.

⁵ dl-MMet, diet supplemented with methionine dipeptide, dl-methionyl-dl-methionine 95%.

^a–cMeans in the same column followed by different letters differ significantly by Tukey’s test and Student’s t-test (P < 0.05). The bird was considered an experimental unit, n = 6. Results are expressed as arbitrary units, AU, and are presented as mean and pooled standard error (SEp).

Figure 7 shows the expression level of MTOR and RPS6KB1 genes. Eimeria challenge had a significant effect on the expression of MTOR (P < 0.001) and RPS6KB1 (P < 0.001); the lowest expression level was observed in EC broilers. Broilers fed the dl-MMet diet showed higher MTOR expression (P = 0.004). However, diet did not have a significant effect on RPS6KB1 expression (P = 0.619).

Figure 7.

Effects of Eimeria challenge and diet on the expression of the genes mechanistic target of rapamycin kinase, MTOR and ribosomal protein S6 kinase B1, RPS6KB1 in the jejunum of broilers at 6 dpi with Eimeria spp. Results are expressed as arbitrary units, AU, and are presented as mean and standard error. ^a,bDifferent letters indicate significant differences by Tukey’s test and Student’s t-test (P < 0.05). The bird was considered an experimental unit, n = 6. UC, unchallenged broilers; EC, Eimeria-challenged broilers; NS, non-supplemented, methionine deficient diet; dl-Met, diet supplemented with free methionine, dl-methionine 99%; dl-MMet, diet supplemented with methionine dipeptide, dl-methionyl-dl-methionine 95%.

Blood tests

The activity of AST and CK enzymes and the contents of UA and Cr in the plasma of broilers at 6 dpi are presented in Table 7. There was an interaction effect between Eimeria challenge and diet on CK activity (P = 0.049). EC broilers fed the NS diet had higher CK activity. EC broilers had higher AST activity (P = 0.002) and lower UA content (P = 0.004) than UC broilers. Broilers fed the NS diet showed higher AST activity (P = 0.005) than those fed dl-Met and dl-MMet diets. Eimeria challenge had no effect on Cr level (P > 0.05).

Table 7.

Plasma activities of aspartate aminotransferase (AST) and creatine kinase (CK) and plasma levels of uric acid (UA) and creatinine (Cr) in broilers at 6 d post-inoculation with Eimeria spp.

		AST, U/L	CK, U/L	UA, mg/dL	Cr, mg/dL
Treatments		Mean	Mean	Mean	Mean
UC1	NS3	179.790	3103.656ab	6.103	1.645
	dl-Met4	129.290	2340.976bc	6.552	1.665
	dl-MMet5	129.135	2910.181ab	7.993	1.693
EC2	NS	236.482	4018.000a	5.088	1.648
	dl-Met	184.183	1198.625c	4.270	1.610
	dl-MMet	165.480	1585.931c	5.892	1.612
Main Effects
Eimeria challenge	UC	145.013b	2748.352	6.902a	1.668
	EC	195.382a	2164.549	5.083b	1.623
Diet	NS	210.713a	3675.121	5.642	1.647
	dl-Met	159.232b	1717.875	5.307	1.632
	dl-MMet	147.308b	2248.056	6.943	1.653
P-value
Eimeria challenge		0.002	0.112	0.004	0.202
Diet		0.005	0.001	0.070	0.931
Eimeria challenge × Diet		0.825	0.049	0.643	0.574
Pooled standard error (SEp)		43.610	982.452	1.699	0.100

¹UC, unchallenged broilers.

²EC, Eimeria-challenged broilers.

³NS, non-supplemented, methionine deficient diet.

⁴ dl-Met, diet supplemented with free methionine, dl-methionine 99%.

⁵ dl-MMet, diet supplemented with methionine dipeptide, dl-methionyl-dl-methionine 95%.

^a–cMeans in the same column followed by different letters differ significantly by Tukey’s test and Student’s t-test (P < 0.05). The bird was considered an experimental unit, n = 6. Results are presented as mean and pooled standard error (SEp).

Serum MUCO levels and LDH activity in broilers at 6 dpi are shown in Figure 8A and B, respectively. There was no interaction effect between Eimeria challenge and diet on MUCO levels (P = 0.400) and LDH enzyme activity (P = 0.920). However, we observed effect of Eimeria challenge on the MUCO levels. EC broilers had higher (P < 0.001) MUCO levels than UC broilers. Diet did not affect MUCO levels (P = 0.174), and neither Eimeria challenge (P = 0.824) nor diet (P = 0.121) influenced LDH activity. Supplementary Table S1 summarizes all the results of this study.

Figure 8.

Effects of Eimeria challenge and diet on the mucoprotein level, mg/dL (A) and lactate dehydrogenase, U/L enzyme activity (B) in the serum of broilers at 6 dpi with Eimeria spp. Results are presented as mean and standard error. ^a,bDifferent letters indicate significant differences by Tukey’s test and Student’s t-test (P < 0.05). The bird was considered an experimental unit, n = 6. UC, unchallenged broilers; EC, Eimeria-challenged broilers; NS, non-supplemented, methionine deficient diet; dl-Met, diet supplemented with free methionine, dl-methionine 99%; dl-MMet, diet supplemented with methionine dipeptide, dl-methionyl-dl-methionine 95%.

Discussion

We evaluated the damage caused by Eimeria infection to the jejunal mucosa of broilers fed diets supplemented or not with methionine in free or dipeptide form (NS, dl-Met, or dl-MMET, respectively). EC broilers had lower FI and WG and higher FCR. A reduction in feed consumption is expected under conditions of infection, which can lead to inadequate intake of essential nutrients (carbohydrates, fatty acids, and amino acids), thereby affecting animal performance (Miska and Fetterer, 2018). The lower WG of EC broilers may also have occurred as a result of lesions to the intestinal mucosa, as evidenced by changes in the expression of genes encoding digestive enzymes and nutrient carriers in the small intestine (Paris and Wong, 2013; Su et al., 2015; Miska and Fetterer, 2018; Khatlab et al., 2019). Regarding diet, we observed that the supplementation of methionine in the form of free amino acid in adequate amounts to the needs of animal’s favors protein synthesis, since methionine is related to modulation animal growth by regulating several metabolic pathways (Barnes et al., 1995; Ball et al., 2006; Tesseraud et al., 2011).

As reported in other studies, the morphometric changes in the jejunum of EC broilers fed the NS diet (e.g., lower and wider villus and greater crypt depth) are indicative of the impact of Eimeria infection and methionine deficiency on animal health and intestinal functionality (Fernando and McCraw, 1973; Bauchart-Thevret et al., 2009; Silva et al., 2009; Gottardo et al., 2016). The lower villus height observed in these treatments (EC and NS) suggests greater cell loss due to infectious challenge and methionine deficiency (Fernando and McCraw, 1973; Bauchart-Thevret et al., 2009). The larger villus width observed in this group may have occurred as a consequence of the accumulation of immune cells (Chen et al., 2015). Symons (1965) reported that damage to and loss of epithelial cells, as well as an increase in villus width, can alter villous architecture and stimulate the proliferation of stem cells in the crypt. Thus, the greater crypt depth and lower villus/crypt ratio in EC broilers fed the NS diet suggest that proliferation and migration of epithelial cells from crypts to villi occurred in an attempt to restore the intestinal mucosa (Silva et al., 2009) and that the demand for new cells exceeded the normal rate of cellular proliferation and regeneration.

EC chickens fed the NS diet had smaller absorptive surface area, which resulted in poor animal performance. Furthermore, this group of broilers had a reduced number of neutral goblet cells and MUC2 expression. These results are similar to those reported in previous studies (Bauchart-Thevret et al., 2009; Lihn et al., 2009; Dkhil et al., 2013; Gao et al., 2019). Goblet cells perform an important protective function in the gut by synthesizing and secreting important compounds, such as mucin, which is considered to be the host’s first innate line of defense against pathogen-induced epithelial lesions (Dkhil et al., 2013). The results observed in this study may have occurred as a consequence of methionine deficiency (Bauchart-Thevret et al., 2009), intestinal mucosal deterioration, and reduced regenerative capacity of the crypt (Lihn et al., 2009; Dkhil et al., 2013). This suggests that both methionine deficiency and Eimeria challenge suppress the proliferation of neutral goblet cells, MUC2 gene expression, and the reestablishment of the mucus layer, thereby increasing susceptibility to further infection (Forder et al., 2012).

We observed a greater amount of acidic goblet cells in the jejunum of UC broilers fed the dl-Met diet, an indication of greater mucus secretion (Seyyedin and Nazem, 2017). This result suggests that methionine contributes to intestinal health, as a high number of goblet cells are beneficial to the immune system of broilers. Goblet cells synthesize and secrete mucins onto the surface of the intestinal epithelium, forming a physical and chemical barrier against pathogenic invaders. The mucus layer also facilitates the transport of digested nutrients into enterocytes (Kim and Ho, 2010). Acid mucin is less degraded by bacterial glycosidases (Robertson and Wright, 1997; Kim and Ho, 2010). The increase in goblet cells as a result of methionine supplementation (whether in free form or as a dipeptide) probably led to an increase in cysteine concentration, as these cells secrete cysteine-rich mucins involved in immune function of the intestine (Van Klinken et al., 1998; Bauchart-Thevret et al., 2009).

EC broilers fed the dl-MMet diet showed higher enterocyte height and percentage of IELs in the jejunum. These morphological changes were probably an attempt to increase the absorption surface area in response to the lower intestinal villus height caused by the infection (Silva et al., 2010). Enterocytes are the first cells to be invaded by intestinal protozoa. Following invasion, cytokines and chemokines are secreted, orchestrating the immune response (Stadnyk, 2002). High IEL percentages are indicative of a local cellular immune response to prevent the spread of the parasite to other jejunal cells. According to Lillehoj and Chung (1992), the immune response mediated by IELs and lamina propria lymphocytes is effective, consisting mainly of T, B, and natural killer cells. IELs are capable of eliminating Eimeria-infected cells, reducing the number of intracellular sporozoites and inhibiting infection progression (Lillehoj and Trout, 1996). The highest IEL percentage was observed in EC broilers assigned the dl-MMet diet, showing that methionine dipeptide and its metabolites, such as the immunomodulatory and antioxidant glutathione, may stimulate the immune response of epithelial cells, protect the intestinal environment from oxidative damage during immunological reactions, and increase T-cell proliferation (Grimble, 2006).

Lamina propria cells can initiate cellular and humoral responses to parasitic infection (Fernando and McCraw, 1973; Duszynski et al., 2005; Trevizan et al., 2016). The greater lamina propria width in EC broilers suggests edema formation and high presence of additional immune cells (Trevizan et al., 2016). In healthy animals, the lamina propria contains few immune cells and, thus, does not have a large width (Erben et al., 2014). This characteristic was observed in broilers fed the dl-MMet diet, another evidence that methionine dipeptide contributes to intestinal integrity and health. Furthermore, the increased IEL production in broilers fed the dl-MMet diet indicates that the animals were able to mount an appropriate immune response against Eimeria infection without needing to recruit additional defense cells from the lamina propria.

Studies have associated intestinal cellular loss to apoptosis (Yan et al., 2015; Abdel-Haleem et al., 2017). Not only damaged and unwanted cells but also pathogen-infected cells are eliminated via apoptosis (Williams, 1994; Vaux and Strasser, 1996). However, Eimeria spp. are able to continue their life cycle within the cell by disrupting apoptotic pathways (del Cacho et al., 2004) and, when opportune, inhibit the NF-κB nuclear transcription factor pathway to trigger apoptosis and facilitate their release into the intestinal lumen. B-cell lymphoma 2 protein (BCL2) proteins are important apoptosis regulators. The family includes pro-apoptotic BCL2-associated X protein (BAX) and anti-apoptotic BCL2. Another apoptosis-regulating protein worth mentioning is caspase-3 (Dolka et al., 2016). In this study, low expression of BCL2 and CASP3 genes was observed in the jejunum of EC broilers at 6 dpi, showing that jejunal epithelial cells were more vulnerable to apoptosis. Eimeria spp. most likely blocked the apoptotic pathway by inhibiting CASP3 expression in order to facilitate their survival and spread (Lüder et al., 2001). However, low CASP3 expression may prevent the protozoa from escaping the cell and infecting other cells, affecting its intracellular cycle (del Cacho et al., 2004). The result of present study suggests that it is possible that another type of cell death was induced, such as necrosis, as suggested by the low villus height possibly as a consequence of cell destruction observed in the EC broilers. Necrosis is a pathological mechanism related to the loss of membrane integrity and consequent release of cellular content, which induces an inflammatory response to repair the damaged tissue (Heussler et al., 2001; Rock and Kono, 2008; Sharma et al., 2015).

Eimeria challenge reduced the expression of MTOR and RPS6KB1 genes. mTOR participates in protein synthesis through phosphorylation, activation of RPS6KB1, and inhibition of eukaryotic translation initiation factor 4E-binding protein 1 (4E-BP1) (Showkat et al., 2014). mTOR has also been associated with improvement of the intestinal barrier function by increased epithelial cell proliferation and differentiation (Yang et al., 2016; Shao et al., 2017). However, activation of the mTOR signaling pathway is dependent on the availability of nutrients and energy (Richards et al., 2010). In broilers evaluated in this study, Eimeria infection caused damage to the intestinal mucosa (Tan et al., 2014), which in turn may have reduced nutrient absorption (Sharma and Fernando, 1975; Ruff et al., 1976) affecting the transcription of MTOR and RPS6KB1 genes. In contrast, animals fed the dl-MMet diet showed higher MTOR expression. Methionine may be a regulator of the mTOR signaling pathway (Zhou et al., 2016). Zhou et al. (2016) observed that methionine could activate mTOR and promote protein synthesis. According to Yang et al. (2016), activation of the mTOR pathway in the intestine may increase the proliferation and migration of intestinal epithelial cells and, therefore, reduce gut mucosal dysfunction. Nakamura et al. (2012) reported that activation of the mTOR signaling pathway by amino acids may have protected the intestinal mucosa of mice from fasting-induced atrophy. In a previous study, our research group demonstrated the higher expression of PEPT1 in the jejunum of broilers fed a methionine dipeptide-supplemented diet (Khatlab et al., 2019). Our results indicate that intestinal absorption and metabolism of dipeptides may have been more efficient than that of free amino acids, leading to higher methionine availability and energy directed toward the activation of the mTOR signaling pathway. This can explain why animals receiving the dl-MMet diet had higher enterocytes height, lower crypt depth, and larger absorptive surface area than animals fed the NS and dl-Met diets.

Higher plasma AST and CK activities were observed in EC birds fed the NS diet. AST and CK perform important functions in amino acid and energy metabolism, respectively, and their levels in blood plasma are related to liver and muscle lesions (Khan et al., 2013). The enzymes can also be detected in the intestine of animals (Samantha et al., 2014; Adeyemi et al., 2015). AST and CK are released into the blood when intestinal tissues are lesioned (Khan et al., 2013). Thus, jejunal cellular injuries caused by Eimeria spp. and methionine deficiency might have led to the loss of cytoplasmic and mitochondrial components to blood plasma. Low UA levels were observed in the plasma of EC animals, suggesting that this antioxidant compound might have been used to combat oxidative stress caused by the infection (Hooper et al., 1998; Settle and Klandorf, 2014; Khatlab et al., 2019).

Higher serum MUCO level was observed in EC broilers, probably as a result of the inflammatory process initiated in the intestinal mucosa. These glycoproteins are produced in the liver following stimulation by proinflammatory cytokines (Rath et al., 2009). Mucoproteins are a heterogeneous fraction of glycoproteins related to acute-phase proteins. They mediate early, nonspecific systemic reactions of the innate immune system against local or systemic disorders caused by several factors, including pathogenic infection (Cray et al., 2009).

The results of this study show that Eimeria infection affected the morphology and function of the jejunum in broilers, leading to impaired animal performance. Free form methionine supplementation (dl-methionine) improved performance, possibly because of the amino acid’s ability to modulate animal growth. Dietary supplementation with methionine dipeptide (dl-methionyl-dl-methionine) has helped maintain the integrity of intestinal environment, especially in cases of pathogenic infection and consequent intestinal cellular damage and reduction of absorptive capacity. This is the first study evaluating the effects of methionine dipeptide on the intestinal health of broilers with coccidiosis. More research is needed to better understand the benefits of methionine dipeptide supplementation for broilers suffering from intestinal diseases.

Conflict of interest statement

None declared.