Influence of electromagnetic waves, with maxima in the green or red range, on the morphofunctional properties of multipotent stem cells

Abstract

This paper examines the effect of electromagnetic waves, with maxima in the green or red regions of the spectrum, on the morphofunctional state of multipotent mesenchymal stromal cells. The illumination regimes used in our experiments did not lead to any substantial heating of the samples; the physical parameters of the lighting were carefully monitored. When the samples were illuminated with a green light, no significant photostimulatory effect was observed. Red light, on the other hand, had an evident photostimulatory effect. It is shown that photostimulation with a red light decreases the enzymatic activities of mitochondrial dehydrogenases and enhances the viability of cells, their proliferative activity, and their ability to form bone tissue. It is also established that red light stimulates cell proliferation, while not activating the genes that increase the risk of the subsequent malignant transformation of cells or their death. This paper discusses the possible role of hydrogen peroxide in the processes examined.

Introduction

Visible light is a necessary condition for the existence of life on Earth. It is a natural source of energy for most photosynthetic organisms [1]. Moreover, many important processes in animals (phototaxis, phototropism, photoperiodism, circadian rhythms, vision, etc.) are light-dependent [2]. More than a century ago, practitioners began to use light in therapeutic medicine, and in 1903, the Danish physician and researcher Nils Finsen received the Nobel Prize in Physiology and Medicine “for the development of effective methods of phototherapy” [3]. Finsen found that spectral bands of sunlight differed in their therapeutic efficiency. At the beginning of his research, he tested and selected suitable absorption filters but then switched to artificial light sources (the Finsen lamp) [4]. Finsen’s discovery stimulated research in the field and throughout the twentieth century, a lot of information about the effects of visible light on biological objects was accumulated. Currently, querying the PubMed system for “light therapy” yields more than 92,000 articles, with their number growing exponentially. At the initial stage of those photobiology studies, the phenomena of photobiomodulation were investigated using optical filters and monochromators [5]. The next major milestone in studying the effects of visible light on living organisms was the invention of lasers [6] and laser-based techniques [7–9]. The use of lasers designated the beginning of studies of the effects of low-intensity laser radiation on biological objects [10]. Nowadays, lasers are largely superseded by LED illuminators. Thus, a vast body of information has been accumulated over the past century, which is summarized in a huge number of works [11–20]. Currently, sources of visible light are used in practical medicine, especially in physiotherapy and photodynamic therapy, as well as for diagnostics of a number of diseases [21].

The effect of visible light on different organs, tissues and types of human cells is known to vary [13]. The most susceptible to this effect are dividing cells, which, under normal circumstances, are not exposed to electromagnetic radiation of a visible range [22]. Bone marrow cells are a type of dividing cell; they have been investigated extensively—in part, due to their potential use in replacement and rehabilitation therapy [23]. A large number of pathologies are known to be associated with bone marrow cells and the approaches based on the stimulation of bone marrow cells (including the photostimulation technique) have been studied for a long time [24–27]. In experiments with transplantation of bone marrow cells to rabbits [28] and rats [29], visible light was shown to have a significant photostimulatory effect. The treatment of skin wounds with donor bone marrow cells was also more effective when the treatment procedure included exposure to visible light [30, 31].

In most of the publications we analyzed, researchers used light sources with green and/or red emission, with the irradiance at the surface of the illuminated objects ranging from 0.1 to 30.0 W/m². There is much controversy in the data on the use of light sources with green or red emission. This is probably due to the fact that bone marrow contains various cellular fractions, which may have different primary targets for visible light. Moreover, cells of one of the bone marrow fractions may be affected by the intracellular signals transmitted by the cells of other fractions. It is not exactly clear how cells of the main bone marrow fraction—namely, multipotent mesenchymal stromal cells (MMSC)—are photostimulated under these conditions.

In this work, experiments were conducted on the culture of MMSC, with the cells being illuminated by light sources with green and red emission. The average irradiance at the surface of illuminated samples was about 1 W/m², which was in the range of the irradiance values used by other authors. The culture of primary human fetal fibroblasts (PHFF) was used as a control. The experiments showed that only red light had a significant effect on the morphofunctional state of MMSC. The effect of green light seemed to be secondary; it was probably mediated by the signals transmitted by the cells of another bone marrow fraction.

Materials and methods

Cell cultures

MMSC were allocated from the femur of male mice of the CD-1 line. The separation of multipotent mesenchymal stromal cells from blood cells and hematopoietic stem cells was carried out by means of the procedure described in [32]. The purified suspension of cells was cultivated in a CO₂-incubator at 37 °C and the maintenance of CO₂ in an atmosphere of 5%. We used the DMEM cultural media from a 10% solution of fetal bovine serum (Sigma, USA). The fibroblast of an integument of a human fetus (PHFF) used for comparison was allocated from the abortive material of a fetus. Cultivation of cells was carried out in DMEM/F-12 medium, from a 10% solution of fetal bovine serum, a l-glutamine (2 mm), penicillin (100 units/ml), and streptomycin (100 μg/ml) (Sigma, USA) at 37 °C in an atmosphere of 5% of CO₂.

Assessment of viability of cells

The assessment of viability of cells was carried out on a microscope Axiovert 200 (Carl Zeiss, Germany). In order to carry out the analysis, we used the Live/Dead Cell Viability Assays Kit (TermoFisher, USA), which provides a simple, two-color fluorescence assay that distinguishes metabolically active cells from injured cells and dead cells. The assay is based on the reduction of C12-resazurin to red-fluorescent C12-resorufin (λ_ex = 488 нм, λ_em = 575 нм) in metabolically active cells and on the uptake of the cell-impermeant, green-fluorescent nucleic acid stain, SYTOX Green dye (λ_ex = 488 нм, λ_em = 530 нм), in cells with compromised plasma membranes (usually late apoptotic and necrotic cells). Dyes were added onto the medium (5 mg/ml), and then the plate was located in a CO₂-incubator for 15 min; thereafter microphotographing of cells was carried out [33]. The surface occupied with cells was determined through different times after influence by the technique described earlier [34].

Assessment of differentiation potential

An assessment of the differentiation potential of mesenchymal stromal cells of mouse marrow investigated their ability of osteogene differentiation in response to particular differentiation incentives. For the induction of a differentiation of cell predecessors, they were cultivated in the environment with the addition of osteogene differentiation incentives (dexamethasone (10 nM), glitserol-2-phosphate (10 mM), and 2-phospho-l-acidum ascorbic (0.2 mM) (Sigma, USA)). Late stages of the osteogene differentiation of cells, estimated by coloring the calcinated matrix components with alizarin red (Prime Chemicals Group, Russia) with the addition of an oxyhydroxide of ammonium [35], obtained the quantitative data by means of processing of microphotographs in ImageJ.

Assessment of enzymatic activity of mitochondrial dehydrogenases

The assessment of enzymatic activity of mitochondrial dehydrogenases was carried out by a special water-soluble dye 3 (4,5-dimethylmetathiazole-2-ooze)-2.5-diphenyl-2H-tetrazolium bromide (Sigma, USA), whose dehydrogenases translate slightly soluble formazan. A measurement of dye was added to the medium of cultivation of cells at a concentration of 5 mg/ml. Within 5 min, the culture of cells was actively stirred up by means of a rocking chair and then placed in a CO₂-incubator for 3 h. A transfer of formazan in the aqueous phase was made by an organic solvent of dimethyl sulfoxide (Fluka, Germany). The optical density of the received solutions was measured on Microplate Reader 680 XR (BioRad, France) at 540 nm. When calculating, we considered that 14.14 μg of formazan in 3 ml corresponded to one unit of optical density with a length of optical paths of 1 cm [36].

Measurement of concentration of hydrogen peroxide

The concentration of hydrogen peroxide was measured by the method of reinforced chemoluminescence in system luminol-4-iodinephenol-peroxidase. A luminometer used a highly sensitive lumenmeter of Biotoks 7 AM (Ekon, Russia). The experimental details of the method have been described earlier [37]. The high sensitivity of the method allows to record hydrogen peroxide in concentrations less than 1 nm [38]. The content of hydrogen peroxide was determined with the use of gauge schedules of dependence of a chemoluminescence on the known concentration of hydrogen peroxide in solution. The initial concentration of the hydrogen peroxide used for calibration was defined by a spectrophotometer at 240 nm with the use of coefficient of molar absorption 43.6 М⁻¹ × сm⁻¹ [39]. The initial concentration of hydrogen peroxide in the water was about 5 nM.

RT PCR

The definition of change of gene expression was carried out by the RT PCR method as described earlier [40]; information about the used primers is presented in Table 1. The PCR mode was as follows: (1) “hot start” (for an exception of not specific annealing of primers) at 95 °C, 5 min., (2) denaturation at 95 °C, 15 s, (3) annealing of primers and synthesis at 60 °C, 40 s. Stages 2–3 were repeated 40 times. The determination of values of a threshold cycle—Ct was carried out by means of the software BioRad (USA). The level of gene expression was normalized to that of the housekeeping genes cytoskeletal actin (Actb), ribosomal protein (RPLP), and glyceraldehyde 3-phosphate dehydrogenase (GADPH). The processing of results was carried out by a standard technique [41]. Changes of level of an expression of genes represented control values observed in intact cells.

Table 1.

Oligonucleotides used for qRT-PCR

Genes	GenBank accession #	Oligonucleotide 5′–3′
Alkaline phosphatase, liver/bone/kidney, ALPL	NM_000478.4	CATGCTGAGTGACACAGACAAGAA ACCGCCCACCACCTTGTAG
Bone gamma-carboxyglutamate protein, BGLAP	NM_199173.4	GGTGCAGAGTCCAGCAAAGG GCGCCTGGGTCTCTTCACTA
Bone morphogenetic protein 1, BMP1	NM_006129.4	AGGGCAATGATGTGTGCAAGT GCCATGCAGCTTGGAGTCA
bone morphogenetic protein receptor, type IA, BMPR1A	NM_004329.2	TCAGCGAACTATTGCCAAACAG TTGCCCATCCATACTTCTCCAT
Collagen, type I, alpha 1, COL1A1	NM_000088.3	CGATGGCTGCACGAGTCA CAGGCGGGAGGTCTTGGT
Collagen type III alpha 1, COL3A1	NM_000090.3	TGGAGGATGGTTGCACGAA GTAGTCTCACAGCCTTGCGTGTT
Epidermal growth factor receptor, EGFR	NM_005228.3	CTGAGCTCTCTGAGTGCAACCA CAGCTTTGCAGCCCATTTCT
Fibroblast growth factor 2, FGF-2	NM_002006.4	CGGTCAAGGAAATACACCAGTTG GCCCAGGTCCTGTTTTGGAT
Fibroblast growth factor receptor 1, FGFR1	NM_015850.3	TGCACCAACGAGCTGTACATG CTGCTTGAAGGTGGGTCTCTGT
Insulin-like growth factor 1, IGF1	NM_000618.3	TGCTTCCGGAGCTGTGATCT GCTGACTTGGCAGGCTTGAG
Insulin-like growth factor 1 receptor, IGFR1	NM_000875.3	ACGGCATGGCATACCTCAAC TTCGGCTACCATGCAATTCC
Runt-related transcription factor 2, RUNX2	NM_004348.3	GTATGTCCGCCACCACTCACTAC GAAGGGTCCACTCTGGCTTTG
Homolog 2, similar to mothers against decapentaplegic, SMAD2	NM_005901.5	GACACCAGTTTTGCCTCCAGTATT TCCAGAGGCGGAAGTTCTGTT
Homolog 4, similar to mothers against decapentaplegic, SMAD4	NM_005359.5	CATTGGATGGGAGGCTTCAG TCCAGAGACGGGCATAGATCA
Homolog 5, similar to mothers against decapentaplegic, SMAD5	NM_005903.6	AGGAACCTGAGCCACAATGAAC GTTGTTGGGCTGGTGGAAAG
Secreted phosphoprotein 1, SPP1	NM_000582.2	TTCGCAGACCTGACATCCAGTA CCATTCAACTCCTCGCTTTCC
Transforming growth factor beta receptor 1, TGFBR1	NM_004612.2	TGTGCTTCGTCTGCATCTCACT TGGCACTCGATGGTGAATGA
Tumor necrosis factor, TNF	NM_000594.3	AGGCCAAGCCCTGGTATGA GCTGAGTCGGTCACCCTTCTC
Vitamin D receptor, VDR	NM_000376.2	GCTGGACGCCCACCATAA CTCCACCATCATTCACACGAACT
Cyclin-dependent kinase inhibitor 1B, CDKN1B	NM_004064.4	GCCAGCGCAAGTGGAATTT CTCCACCTCTTGCCACTCGTA
TNF receptor associated factor 2, TRAF2	NM_021138.3	GGCCGTCTGTCCCAGTGAT TTCGTGGCAGCTCTCGTATTC
Cluster differentiation 40 molecule, CD40	NM_001250.4	ACACTGCCACCAGCACAAATACT CTGTTTCTGAGGTGCCCTTCTG
Tumor necrosis factor receptor superfamily, member 1A, TNFRSF1	NM_003844.3	CTGGCGCTTGGGTCTCCTA TGCGTTGCTCAGAATCTCGTT
Aldehyde dehydrogenase 1 family member A1, ALDH1A1	NM_000689.4	GCAGTGAAGGCCGCAAGA CCCTCTCGGAAGCATCCATAG

Influence of visible light

In the experiments, we used two types of light-emitting diodes (Osram, Germany), with green and red emissions. The dispersion of light-emitting diodes on intensity did not exceed 5%; with a radiation divergence angle of approximately 40°. The definition of the spectral characteristics of the luminous fluxes was carried out by means of a USB3000T spectrometer (OceanOptics, USA) in the range 300 to 1000 nm. The definition of the power characteristics of luminous fluxes was carried out with the help of the automatic Field Master complex (Coherent, the USA) having a constant spectral response in the range 310 to 2800 nm. The characteristic ranges of the light-emitting diodes are presented in Fig. 1. It shows a working wavelength of the light-emitting diodes designated as green—525 nm and red—632 nm. A half-width of a spectrum line for the green light-emitting diode equaled 26 nm (512–538 nm) and for red 25 nm (625–640 nm). Apparently from a tab to the drawing 1 power density significantly depends on the working distance between the surface of diodes and objects. In order that the radiation power density on a surface of exemplars influenced by green and red light-emitting diodes was equal, the distance from an object to light-emitting diodes was 7 and 2 cm respectively. The radiation power density on a surface of exemplars under such circumstances was about 1.2 W/m². Cages were irradiated in cultural strip tablets (8 × 12 small cavities). During the radiation, the strip tablet was sorted and divided into three groups (control, green, red), 4 columns in each (8 × 4 wells). Radiation by electromagnetic waves, with maxima in green or red spectral ranges, was carried out in the conditions of a CO₂ incubator. During the radiation, the medium was replaced with DMEM fenol red free (Sigma, USA). Control specimens were not exposed to light; however, replacement of the environment in them was made. To prevent evaporation of the culture medium during irradiation, the plates were covered with an optically transparent plastic. In order to prevent the exposure of light to neighboring wells, the bottom and walls of all wells were covered with a light-tight polymeric material.

Fig. 1.

Energy spectra of visible light sources (LED arrays). The energy spectrum of the matrix with emission in the green region of the spectrum (green) was measured from a distance of 3 cm, red (red)—1 cm. The inset shows the dependence of energy efficiency on the working distance between the surface of the diodes and the object

Results

In the preliminary experiments, we investigated the effect of green and red light on the intensity of energy metabolism, which was judged by the activity of mitochondrial dehydrogenases. The irradiation regimes varied by the duration of light exposure (7.5, 15, 30, and 60 min), corresponding to the final irradiation doses of 540, 1080, 2160, and 4320 J/m² respectively. The 7.5-min and 15-min exposures were shown to be not long enough for the appearance of any substantial changes in the activity of mitochondrial dehydrogenases. Increasing the time of exposure to 30 min resulted in the development of evident biological effects. When the exposure time was further increased to 60 min, the manifestation of the beneficial effects was significantly reduced. Since the photomodulatory effect was maximal at the exposure time of 30 min, this regime was used in all the subsequent experiments. It should be noted that the effects registered in those experiments were quite stable: they developed within 4 h after irradiation and persisted for several days.

Figure 2 shows changes in the activity of mitochondrial dehydrogenases caused by the irradiation of MMSC and PHFF cultures for 3 days with green or red light. One can see that in both cultures, the activity of mitochondrial dehydrogenases decreased. The response of MMSC and PHFF to irradiation was quite similar, yet the inhibitory effect of green light was less pronounced comparatively to the effect of red light (up to 15 and 30% inhibition respectively).

Fig. 2.

Evaluation of enzymatic activity of mitochondrial dehydrogenases of MMSC and PHFF lines on the 3rd day after exposure to electromagnetic waves with maxima in the green or red regions of the spectrum. Data are represented as the means ± SEM of three independent experiments. The asterisks mark the values that significantly differ from the control at p < 0.05 (Student’s unpaired t test)

Figure 3 shows evaluation of viability of MMSC and PHFF after a 3-day exposure to green or red light. It was found that the green light did not change viability of cells of both types. At the same time, exposure of MMSC and PHFF to red light resulted in the development of substantial effects. The number of viable cells in the MMSC culture increased by a factor of 1.4 after the exposure, whereas the number of dead cells decreased by ~ 40%. In the PHFF culture, the number of viable cells increased by a factor of 1.2, and the number of dead cells—although not changing much—still showed a tendency to decrease (by ~ 10%).

Fig. 3.

Evaluation of cell viability of MMSC and PHFF lines on the 3rd day of cultivation after exposure to electromagnetic waves with maxima in the green or red regions of the spectrum. Data are represented as the means ± SEM of four independent experiments. The asterisks mark the values that significantly differ from the control at p < 0.05 (Student’s unpaired t test)

The effect of green and red light on the ability of MMSC and PHFF to colonize the surface of culture substrates is shown in Fig. 4. It should be noted that the cells did not always form a monolayer, sometimes multilayer formations and cell aggregates were observed. The dynamics of the process had a sigmoidal character, with the rate of cell division and colonization being the highest in the period of 3rd–9th day. After the 11th day, no differences between the experimental groups were observed. The median of culture colonization (the time taken by the cells to occupy 50% of the culture substrate) was about 5 days for MMSC and 6 days for PHFF.

Fig. 4.

Effect of electromagnetic waves with maxima in the green or red regions of the spectrum on the ability of MMSC (a) and PHFF (b) cell cultures to colonize the surface of culture substrates. Data are represented as the means ± SEM of four independent experiments. The asterisks mark the values that significantly differ from the control at p < 0.05 (Student’s unpaired t test)

The experiments showed that green light did not affect the rate of cell division; the values of colonization median were the same as in the control samples (5 days for MMSC and 6 days for PHFF). Exposure of the cultures to red light, on the other hand, resulted in a substantial increase in the rate of cell division and culture colonization. In the samples irradiated with red light, the values of colonization median were about 4 days for MMSC and 5.5 days for PHFF. In terms of the relative rate of substrate colonization, the area colonized by MMSC in the samples irradiated with red light was 20% larger by the 5th day comparatively with the control samples. For PHFF, the area gain under these conditions amounted to 15%.

In this work, we also investigated the effect of green and red light on the rate of formation of crystalline calcium phosphate in the culture of MMSC. For the initiation of calcium phosphate crystallization in the MMSC culture, an osteogenic inductive mixture was used. Its application led to the emergence of evident signs of differentiation, formation of a crystalline structure of calcium phosphate. The effect of green and red light on the rate of calcium phosphate crystallization in the MMSC culture is shown in Fig. 5. As one can see on the control samples, the formation of calcium deposits linearly depended on the cultivation time. When the cells were exposed to green light, the rate of accumulation of calcium deposits, which was monitored for 19 days, did not differ from that in the control samples. Irradiation with red light, however, caused a sharp acceleration of deposit accumulation. By the 5th day of the experiment, the samples irradiated with red light showed a 2.9-fold increase, as compared with the control, in the amount of accumulated calcium deposits. By the 11th day, the amount of deposits was 2.3-fold of that in the control samples, and by the 19th day, the value declined to a 1.4-fold difference.

Fig. 5.

Effect of electromagnetic waves, with maxima in the green or red regions of the spectrum, on the formation rate of crystalline calcium phosphate in MMSC culture. Representative micrographs are presented. Micrographs show colored crystalline calcium phosphate in intact cells (a–c) and cells exposed to green (d–f) and red (j–i) light. The cells were cultured for 5 (a, d, f), 11 (b, e, h), and 19 (c, f, i) days. The graph shows the numerical values characterizing the calcification of cells. Data are represented as the means ± SEM of three independent experiments. The asterisks mark the values that significantly differ from the control at p < 0.05 (Student’s unpaired t test)

To understand what molecular mechanisms underlie the effects of green and red light, we analyzed the level of expression of a number of genes. The main focus of the analysis was on the genes of the so-called fetal proteins, osteogenic factors, and cell cycle regulators. Changes in the expression level of a gene allow judging of the likelihood of manifestation of the gene-encoded trait, since the content of the corresponding mRNA often correlates with the probability of development of the trait. Table 2 shows the dynamics of relative changes in the gene expression levels, which were observed in the culture of PHFF irradiated with green or red light.

Table 2.

Relative changes in the levels of gene expression in MMSC culture at different times after exposure to electromagnetic waves with maxima in the green or red regions of the spectrum

Genes	Relative levels of gene expressions
	After 2 h		After 1 day		After 2 day
	Green	Red	Green	Red	Green	Red
ALPL	− 1.4	7.1*	1.4	− 132.5*	3.4	5.3*
BGLAP	− 9.1*	− 22.5*	16.1*	12.5*	− 1.2	− 2.1
BMP1	− 1.1	− 1.3	3.6	1.2	2.7	3.5
BMPR1A	1.3	1.4	1.74	1.0	1.6	10.4
COL1A1	1.0	− 1.2	2.8	1.8	1.3	2.4
COL3A1	− 1.0	− 1.3	1.3	1.8	1.6	3.1
EGFR	1.8	1.0	2.9	2.6	1.1	2.5
FGF-2	− 1.2	− 2.2	1.8	2.1	2.1	2.0
FGFR1	1.4	1.3	1.6	1.5	− 1.7	− 1.1
IGF1	− 7.0*	− 5.1*	− 3.2	− 1.0	4.1	1.1
IGFR1	− 1.1	7.4*	1.9	− 2.1	− 1.4	2.0
RUNX2	1.6	− 12.8*	4.7	2.8	− 1.6	− 1.4
SMAD2	− 1.0	1057	2.6	2.3	1.2	19.2*
SMAD4	− 2.6	− 4112	2.5	1.8	1.9	11.1*
SMAD5	1.40	1.8	1.6	1.5	− 1.4	3.7
SPP1	− 1.0	30.3*	15.7*	74.0*	5.7*	7.0*
TGFBR1	− 1.5	1.0	1.6	− 2.3	2.8	2.7
TNF	21.8*	23.5*	− 3.8	− 1.8	− 1.1	− 481.0*
VDR	1.7	− 6.4*	6.7*	6.0*	− 17.5*	10.0*
CDKN1B	− 1.1	2.0	101.1*	179.7*	203.6*	49.8*
TRAF2	2.0	− 3.0	1.79	− 65.7*	34.0*	101.8*
CD40	1.3	− 8.5*	− 1.0	− 202.2*	− 1.3	− 21.7*
TNFRSF1	− 1.9	28.284	− 2.8	1.5	1.0	− 377.4*
ALDH1A1	270.6*	205.0*	31.7*	89.2*	− 4.7	− 14.7*

*The difference between the expression level and control values is more than 5 times

In the analysis of gene expression, we considered the difference between the experiment and control samples to be significant when the expression level changed by a factor of 5. The analysis showed that the number of genes whose expression level changed was much lower when PHFF were irradiated with green light—comparatively with the situation when the cells were exposed to red light. A 2-h exposure of PHFF to green light led to a drop in the levels of gene expression of osteogenic differentiation markers (IGF1 and BGLAP) and a rise in the levels of gene expression of the regulatory cytokine TNF and the dehydrogenase ALDH1A1, which regulates a major switch between metabolic pathways. Irradiation of samples with red light resulted in a similar response and, additionally, altered the expression of a number of other genes. Specifically, there was an increase in the levels of gene expression of ALPL and IGF1R, as well as SPP1, which is responsible for bone mineralization. There was also a drop in the levels of gene expression of some other proteins; transcription factor RUNX2; receptor VDR, which affects mineral exchange; and marker CD40. A 1-day exposure of PHFF samples to visible light (both green and red) led to the growth of the levels of gene expression of BGLAP, ALDH1A1, SPP1, VDR, and proapoptotic factor CDKN1B. Red light additionally caused changes in the levels of gene expression of ALPL, CD40, and TRAF2. After 2 days of irradiation, the profile of gene expression changed—yet, in general, the response of genes of different groups to the stimulus persisted, with the expression of genes of the TNF superfamily changing by two orders of magnitude in a number of cases.

The experiment was repeated 5 times. In some cases, the obtained data did not satisfy the hypothesis of a normal distribution, therefore, non-parametric statistics were used for comparative analysis. Relative changes in gene expression levels were calculated using the formula N = N_exp/N_cont, where N_exp is the distribution median obtained by the action of red or green light, and N_cont is the distribution median obtained in control experiments.

The analysis described above revealed changes in the expression of a number of redox-sensitive genes, and correspondingly, an assumption was made that irradiation with visible light led to the formation of reactive oxygen species (ROS). The most stable ROS is known to be H₂O₂; its concentration can be measured in native aqueous solutions, not containing any dyes or other chemicals—after the exposure to visible light is finished. We wanted to measure the maximal possible yield of H₂O₂ under the effect of visible light, so we conducted control experiments in which we deliberately avoided the use of any complex colloidal systems, imitating the cellular content. The formation of H₂O₂ in water under irradiation with green and red light is shown in Fig. 6. In control samples (not exposed to light), no substantial changes in the concentration of H₂O₂ were observed. Exposure of samples to green or red light resulted in the formation of H₂O₂, whose concentration grew linearly with the time of exposure. The rate of H₂O₂ formation was 0.2 nM/min (~ 3 pM × m²/J) in the case of green light and about 0.9 nM/min (~ 12.5 pM × m²/J) in the case of red light. Thus, the amount of H₂O₂ formed under irradiation with red light was about 4.5-fold of the amount formed under the effect of green light.

Fig. 6.

Generation of hydrogen peroxide in water under the action of electromagnetic waves with maxima in the green or red regions of the spectrum. The background level of H₂O₂ was subtracted from the observed values

Discussion

The experiments with cell cultures showed that green light had no substantial photostimulatory effect on MMSC (Figs. 2, 3, 4, 5). Irradiation of the cells with red light, on the other hand, resulted in photostimulation (Figs. 2, 3, 4, 5). Comparison of the two cultures, MMSC and PHFF, revealed that MMSC were more responsive to photostimulation (Figs. 2, 3, 4, 5). A key result was demonstration of the possibility to stimulate the processes of cell division and development (Figs. 3, 4). Mitogenic stimuli, enhancing cell division, often lead to the formation of cancer cells [42]. In our experiments, we did not find any changes in the expression of genes associated with the malignant transformation of cells—despite the fact of an accelerated proliferation of cells, preceding their redirection to the osteogenic pathway of development (Table 1). This fact allows us to suppose that, in contrast to the methods used earlier, the procedure of photostimulation suggested in the paper would not increase susceptibility of cells to malignization [43–46]. It should be noted that some reports describe a phenomenon of enhanced respiratory activity of cells and a related increase in cell tumorogenity [46]. In our experiments, on the other hand, a decrease in the activity of mitochondrial dehydrogenases was observed, which suggests a lowered respiratory activity of cells (Fig. 2). The causes of changes in the respiratory activity of cells are not known. Changes can be associated directly with the activity of enzymes or general changes in mitochondria [47]. This may be a compensatory effect associated with mitochondrial degradation [48]. On the other hand, this may be an effect associated with a change in the concentration of the free calcium cation or the activation of certain signaling and regulatory pathways of metabolism [49].

Irradiation of MMSC with red light was also found to cause intensive osteogenesis, a faster differentiation of MMSC into the cells of bone tissue (Fig. 5). Earlier, researchers from South Korea developed a technology of dentin regeneration using photostimulation with red light [50]. Red light activated dental stem cells, promoting transition of the TFG-beta factor into the active form. TFG-beta is present in mammal cells mainly in the latent form and is activated by ROS, which are generated under the effect of visible light [50].

It should be noted that ROS are involved in the modulation of a large number of regulatory systems of the cell and the organism [51]. Of all the ROS, the main secondary messenger in the organism of mammals is H₂O₂ [52]. It is constantly generated in living cells—both as a result of normal metabolism and under the effect of external factors (ionizing, ultraviolet, EHF, and microwave radiation; vibration; heat; visible; and infrared radiation in the range of absorption lines of molecular oxygen) [53–57]. Living organisms contain a large number of systems, utilizing H₂O₂ and stabilizing its concentration [58]. As shown above, irradiation of aqueous solutions with the light sources used in our experiments leads to the formation of H₂O₂ (Fig. 6). Earlier it was established that dipoles of oxygen molecules dissolved in water are photoreceptors of laser radiation (632.8 and 1264 nm), which is based on their transition into the singlet state [59]. This phenomenon is called the light-oxygen effect. The general scheme of H₂O₂ formation with the light-oxygen effect was established earlier [60]. Of course, the concentration of ROS can change not only as a result of their direct formation. Not less important is the indirect effect of light on the concentration of ROS, which is described in the literature [61, 62].

Сonclusion

The results of this work show that irradiation of multipotent mesenchymal stromal cells with red light can cause their photostimulation. Green light, in contrast, does not have a significant photostimulatory effect on the cells. The irradiation regimes used in our experiments do not lead to any substantial changes in the temperature of the samples. Irradiation of cells with red light is shown to decrease the enzymatic activity of mitochondrial dehydrogenases and enhance viability and proliferative activity of the cells. The stimulation of multipotent mesenchymal stromal cells with red light leads to more intensive osteogenesis and the development of bone tissue. The analysis of gene expression suggests that red light can stimulate proliferation of cells without the risk of their subsequent malignant transformation. The results obtained also indirectly indicate that H₂O₂ can play a certain role in the processes of photostimulation.

Funding information

The optical part of the work was carried out with the support of R&D program (0024-2019-0004).

Compliance with ethical standards

Conflict of interest

The authors declare that they have no conflict of interest.