Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2021 Jan 1.
Published in final edited form as: J Immunol. 2019 Nov 20;204(1):159–168. doi: 10.4049/jimmunol.1900741

Upregulation of H3K27 Demethylase KDM6 During RSV Infection Enhances Pro-Inflammatory Responses and Immunopathology

Carrie-Anne Malinczak *, Andrew J Rasky *, Wendy Fonseca *, Matthew A Schaller †, Ronald M Allen *, Catherine Ptaschinski *, Susan Morris *, Nicholas W Lukacs *,‡
PMCID: PMC6920528  NIHMSID: NIHMS1541814  PMID: 31748348

Abstract

Severe disease following RSV infection has been linked to enhanced pro-inflammatory cytokine production that promotes a Th2-type immune environment. Epigenetic regulation in immune cells following viral infection plays a role in the inflammatory response and may result from upregulation of key epigenetic modifiers. Here we show that RSV-infected bone marrow-derived dendritic cells (BMDC) as well as pulmonary DC from RSV-infected mice upregulated expression of Kdm6b/Jmjd3 and Kdm6a/Utx, H3K27 demethylases. KDM6-specific chemical inhibition (GSK J4) in BMDC led to decreased production of chemokines and cytokines associated with the inflammatory response during RSV infection (i.e. CCL-2, CCL-3, CCL-5, IL-6) as well as decreased MHC II and co-stimulatory marker (CD80/86) expression. RSV-infected BMDC treated with GSK J4 altered co-activation of T cell cytokine production to RSV as well as a primary ovalbumin response. Airway sensitization of naïve mice with RSV-infected BMDCs exacerbate a live challenge with RSV infection but was inhibited when BMDCs were treated with GSK J4 prior to sensitization. Finally, in vivo treatment with the KDM6 inhibitor, GSK J4, during RSV infection reduced inflammatory DC in the lungs along with IL-13 levels and overall inflammation. These results suggest that KDM6 expression in DC enhances pro-inflammatory innate cytokine production to promote an altered Th2 immune response following RSV infection that leads to more severe immunopathology.

Introduction

Respiratory syncytial virus (RSV) infects nearly all infants by age two and is the leading cause of bronchiolitis in children worldwide (1, 2). The CDC estimates that up to 125,000 pediatric hospitalizations in the United States each year are due to RSV, at an annual cost of over $300,000,000 (2–4). In the late 1960s, attempts to vaccinate children with formalin-inactivated RSV vaccine caused severe exacerbated disease upon re-infection with live RSV due to enhanced inflammatory disease and mucus production (5–7). Furthermore, several epidemiological studies link severe RSV infection with the later development of hyper-reactive airway disease, including asthma, that persists even years after the initial viral infection has resolved (1, 4, 8). RSV likely initiates and reinforces the immune environment by further altering pathogenic immune responses.

During a viral infection, the immune response is regulated by dendritic cells (DC) as they instruct T cells toward distinct T helper type responses (9). RSV can skew the immune response away from anti-viral and towards a Th2-type response by inhibiting the production of IFN-β and subsequently decreasing the less pathogenic anti-viral Th1 response (10). The reduction of anti-viral responses as well as skewing towards dysregulated Th2/Th17 has been correlated with severe disease (4, 11, 12), leading to airway alterations linked to exacerbated allergic responses later in life (13). RSV-exposed DC are sufficient to promote a more severe and accelerated disease environment when exposed to secondary RSV challenge (14, 15) or allergens (15). Understanding whether and how RSV infection influences DC function to alter the immune environment leading to exacerbation or initiation of a pathogenic environment will be crucial for modifying pulmonary pathologies.

Immune regulation by epigenetic mechanisms, an intense area of research, alters DNA transcription via histone proteins that comprise nucleosomes (16, 17). Lysine residues in the histone tail are often modified to allow an open (active) or closed (silenced) configuration of the gene. For example, the addition of methyl groups on lysine (K) 4 of histone (H) 3 (i.e. H3K4) leads to activation of gene transcription, whereas H3K27 methylation is a repressive mark (18–20). H3K4 methylation is crucial for active gene transcription, while H3K27 methylation appears to regulate and fine-tune gene transcription (18, 21). This process is controlled by methyltransferases that add methyl groups and demethylases that remove them, such as the lysine demethylase family of enzymes, including KDM5 and KDM6. Removal of the H3K4 methylation mark by KDM5 leads to repressed gene transcription while KDM6, an H3K27 demethylase that removes the methylation mark from H3K27, leads to more active gene transcription. In addition to the canonical role of H3K27 demethylation, KDM6 also contributes to gene activation by modulation of H3K4 methylation through stabilization of the MLL complex (22, 23) and guides gene transcription by binding POLII to enhance its movement along genes (24, 25). There is already evidence that KDM6 is involved in the inflammatory response (21, 24, 26). Additionally, our lab has previously shown that KDM5B and KDM6B are upregulated during RSV infection and identified that KDM5B enhances RSV-driven immunopathology by inhibiting key cytokines, especially IFN-β (27). The specific role of KDM6 during RSV infection has not previously been explored.

In the present study, we examined the KDM6 family of histone lysine demethylases (KDM6A/B). Specifically, we demonstrate that RSV infection leads to upregulation of KDM6A/B in BMDC and that inhibition of its enzymatic activity depresses multiple cytokines and chemokines associated with RSV-driven inflammatory responses as well as antigen presentation/co-stimulation of DC. Furthermore, in vivo inhibition of KDM6 activity leads to decreased inflammatory DC infiltration into the lungs, reduced immunopathology and decreased Th2-skewing, indicating that KDM6 upregulation during RSV-infection enhances immunopathology, partially through alteration of APC function. These results indicate that targeting epigenetic pathways and overall DC function may be crucial for limiting long-term RSV-driven disease pathologies.

Materials and Methods

Animals

All experiments involving the use of animals were approved by the University of Michigan animal care and use committee (protocol PRO0000888, exp. 02/14/2022). Male/female C57BL/6, female OT-II and male/female BALB/c mice, 6 to 8 weeks of age, were purchased from The Jackson Laboratory (Bar Harbor, ME).

RSV-infection and in vivo GSK J4 Treatment

A chimeric RSV A2 strain with recombinant Line19 fusion protein (A2/L19-F) was used for all experiments and propagated in Hep2 cells as previously described (28). This strain was used due to its ability to enhance viral infection with increased viral load, mucus hypersecretion and airway hyperreactivity in mouse models due to Line 19-derived F protein, including pathogenic IL-13 and IL-17 responses (11, 28). Male Balb/c mice were infected intratracheally with 2.0 × 105 pfu of RSV A2/L19-F and tissues harvested at 8 days post-infection. Viral stocks were grown in Hep-2 cells and concentrations determined by plaque assay. Virus was ultra-centrifuged (100,000xg for 30 minutes at 4°C) and re-suspended in fresh cell culture media (RPMI 1640 supplemented with 10% fetal calf serum (FCS), L-glutamine, penicillin/streptomycin, non-essential amino acids, sodium pyruvate, 2-mercaptoethanol (ME)) or 1X DPBS prior to use. In some experiments, cultured dendritic cells were infected with RSV for 24 hours, thoroughly washed, and 2.5 × 105 cells were transferred intratracheally into naïve male mice. Ultraviolet (UV)-inactivated virus was prepared by exposure to UV light to inactivate RSV as previously described (29, 30). For in vivo GSK J4 treatment, GSK J4 (Millipore-Sigma, St. Louis, MO, USA) was reconstituted in DMSO and further diluted in PBS without Ca/Mg (final concentration 2 mg/mL; 2.5% DMSO); 200 μL was given intraperitoneally per animal for a final dosing concentration of 20 mg/kg per animal per dose, given once daily over 7 days.

Bone Marrow-Derived Dendritic Cells and Co-culture with CD4+ T cells

Bone marrow from C57BL/6 or Balb/c mice was collected by flushing the femur and tibia of hind legs with RPMI 1640 supplemented with 10% fetal calf serum (FCS), L-glutamine, penicillin/streptomycin, non-essential amino acids, sodium pyruvate, 2-mercaptoethanol (ME). BMDCs were grown in RPMI 1640 supplemented with 10% FCS, L-glutamine, penicillin/streptomycin, non-essential amino acids, sodium pyruvate, 2-mercaptoethanol (ME) and 10 ng/ml of recombinant murine granulocyte macrophage-colony stimulating factor (GM-CSF; R&D Systems, Minneapolis, MN, USA). Cells were fed on Days 3 and 5 with fresh GM-CSF. On Day 6, cells were cultured with RSV (MOI = 2.5). For some experiments, cells were concurrently treated with 10 μM GSK J4 (Sigma, St. Louis, MO, USA), a chemical inhibitor of KDM6A/B (31), 10 μM inactive isomer control, GSK J5 (abcam), or with ethanol (0.1%) as a control. At 24 hours, supernatant was collected for protein analysis using Bio-Plex cytokine assay (Bio-Rad Laboratories, Hercules, CA). Cells were collected in TRIzol reagent and mRNA was extracted using TRIzol reagent (Invitrogen, Carlsbad, CA) for quantitative RT-PCR or resuspended in PBS for flow cytometry. For some experiments, CD4+ T cells were isolated from the lymph nodes of RSV-infected Balb/c mice or spleens from naïve OT-II mice using the T cell isolation II kit (Miltenyi Biotec). Cells were then cultured with the treated BMDCs. For OT-II cells, co-culture was performed in the presence of ovalbumin peptide 323–339 (10 μg/mL; Invivo Gen, San Diego, CA). At 48 hours, the supernatant was collected and protein levels were measured with a Bio-Plex cytokine assay (Bio-Rad Laboratories, Hercules, CA).

Quantitative RT-PCR

Lung tissue was homogenized in TRIzol reagent, and mRNA was subsequently extracted using TRIzol reagent (Invitrogen, Carlsbad, CA). cDNA from lung or BMDC mRNA (described above) was synthesized using murine leukemia virus reverse transcriptase (Applied Biosystems, Foster City, CA) by incubation at 37 °C for one hour, followed by incubation at 95 °C for 10 min to stop the reaction. Real-time quantitative PCR (qPCR) was measured using Taqman primers, with a FAM-conjugated probe to measure transcription of Kdm6a, Kdm6b, Il4, Il5, Il13, 18s. Fold change was quantified using the 2-ΔΔ cycle threshold (CT) method. Quantification of mRNA for the F protein for RSV was used as an indication of active viral replication and was quantitated using specific primers with comparison of expression to the 18s ribosomal mRNA gene as the housekeeping gene control. All reactions were run on a 7500 Real-Time PCR System (Applied Biosystems, Foster City, CA).

Flow Cytometry

BMDC were collected and resuspended in PBS. Live cells were identified using LIVE/DEAD Fixable Yellow Dead Cell Stain kit (Thermo Fisher Scientific, Waltham, MA), incubated at 4°C for 20 minutes then washed and resuspended in PBS with 1% FCS. Fc receptors were blocked with purified anti-CD16/ 32 (clone 93; BioLegend, San Diego, CA). Surface markers were identified using Abs (clones) against the following antigens, all from BioLegend: anti-CD11c (N418), MHC II (M5/114.15.2), CD11b (M1/70), CD80 (16–10/A1), CD86 (GL-1). The lungs were removed, and single cells were isolated by enzymatic digestion with 1 mg/mL collagenase (Roche) and 20 U/mL DNaseI (Sigma, St. Louis, MO) in RPMI 1640 + 10% FCS for 60 min at 37°C. Tissues were further dispersed through an 18-gauge needle (5-mL syringe), red blood cells (RBCs) were lysed and samples were filtered twice through 100-μm nylon mesh. Cells were resuspended in PBS. Live cells were identified using LIVE/DEAD Fixable Yellow Dead Cell Stain kit (Thermo Fisher Scientific, Waltham, MA), then washed and resuspended in PBS with 1% FCS. Fc receptors were blocked with purified anti-CD16/ 32 (clone 93; BioLegend, San Diego, CA). Surface markers were identified using Abs (clones) against the following antigens, all from BioLegend: anti-CD11c (N418), MHC II (M5/114.15.2), CD11b (M1/70), CD80 (16–10/A1), CD86 (GL-1), F4/80 (BM8), Ly6C (HK1.4), CD3 (145–2C11), CD4 (GK1.5), CD8 (53–6.7), CD69 (H1.2F3). Data were collected using a NovoCyte flow cytometer (ACEA Bioscience, Inc. San Diego, California). Data analysis was performed using FlowJo software (Tree Star, Oregon, USA). All populations were gated as: cells/singlets (doublet discrimination)/live cells. Distinct populations were then gated as follows: CD11c+ dendritic cells: CD11b+/CD80+; CD11b+/CD86+; CD11b+/MHCII+; F4/80 macrophages: CD11c-/CD11b+/F4/80+; inflammatory monocytes: CD11c-/CD11b+/Ly6C+; inflammatory dendritic cells: CD11c+/CD11b+/Ly6C+; T cells: CD3+/CD4+, CD3+/CD8+; activated CD4+ T cells: CD3+/CD4+/CD69+; eosinophils: CD11b+/side scatter (SS)hi/SiglecF+; neutrophils: CD11b+/SShi/Gr-1+.

Chromatin immunoprecipitation

Chromatin immunoprecipitation (ChIP) was performed as previously described (32). Briefly, cells (1 × 106 total cells) were fixed in 18.5% paraformaldehyde (PFA). Glycine (10X) was added to quench extra PFA. Cells were washed using ice-cold PBS and lysed in SDS buffer. Cells were then sonicated using a Branson Digital Sonifier 450 (VWR, West Chester, PA, USA) to create 200–1000 bp fragments. The lysate was clarified by centrifugation, and 5% of the supernatant was saved to measure the input DNA. The remaining chromatin was incubated with 1 μg of anti-H3K27me3 antibody (Active Motif), H3K4me3 antibody (Abcam) or control IgG (Millipore) and incubated at 4°C with rotation overnight. Immune complexes were precipitated with salmon sperm DNA/protein A agarose beads. The bead complexes were washed with a series of buffers (low-salt immune complex buffer, high-salt immune complex buffer, LiCl immune complex buffer, and Tris/EDTA buffer). Protein-DNA complexes and input DNA were eluted using elution buffer. Crosslinking was reversed by incubation at 65°C, and samples were treated with proteinase K. DNA was purified by phenol:chloroform:isoamyl alcohol separation and ethanol precipitation. Primers for the promoter regions of CD80 (Forward: CACCCCCGCAAGCAGAATCC; Reverse: GGCAACTCAAAGGTCCCCAGAAC) and CD86 (Forward1: AAGAAAAAGTCAACCACCAGGG; Reverse1: TTCAAGTCCGTGCTGCCTAC; Forward1: AAGAAAAAGTCAACCACCAGGG; Reverse2: CGTGGGTGCTTCCGTAAGTT) were designed using Lasergene software and DNA was amplified by qPCR using SYBR Green buffer (Applied Biosystems, Foster City, CA).

Lung Histology

The middle and inferior lobes of the right lung were perfused with 10% formalin for fixation and embedded in paraffin. Five-micrometer lung sections were stained with periodic acid-Schiff (PAS) to detect mucus production, and inflammatory infiltrates. Photomicrographs were captured using a Zeiss Axio Imager Z1 and AxioVision 4.8 software (Zeiss, Munich, Germany). Assessment of mucus using the PAS stained slides was performed in a blinded fashion using a previously established scale ranging from 1 to 4 with 1- absent, 2- staining in multiple airways, 3- staining in multiple airways with mucus plugging, 4- severe mucus plugging in multiple airways as described (33).

Lung draining lymph node in vitro re-infection and cytokine production assay

Lung draining lymph nodes (LDLN) were enzymatically digested using 1 mg/mL collagenase A (Roche) and 20 U/mL DNaseI (Sigma-Aldrich) in RPMI 1640 with 10% FCS for 45 min at 37°C. Tissues were further dispersed through an 18-gauge needle (1-mL syringe). RBCs were lysed, and samples were filtered through 100-μm nylon mesh. Cells (5 × 105) from LDLN were plated in 96-well plates and re-infected with 1.5–3.0 × 105 pfu of RSV. IL-4, IL-5, IL-13, Il-17A and IFN-γ levels in supernatants were measured with a Bio-Plex cytokine assay (Bio-Rad Laboratories, Hercules, CA).

Statistical analysis

Data were analyzed by Prism 7 (GraphPad Software). Data presented are mean values ± SEM. Comparison of two groups was performed with an unpaired, two-tailed Student t-test. Comparison of three or more groups was analyzed by one-way ANOVA, followed by two-tailed Student t-test for individual comparisons. A p-value <0.05 was considered significant.

Results

Histone lysine demethylases Kdm6a and Kdm6b are upregulated following RSV infection

Epigenetic enzymes have been implicated in regulating immune gene transcription during inflammatory responses (34–36). Previous studies have shown that histone lysine demethylases are upregulated during RSV infection, especially in CD11c+ populations that control the immune response to RSV (27). In the current studies, male C57BL/6 and Balb/c mice were infected intratracheally with RSV and at 8 days post-infection, we collected the CD11c+ cell population from the lungs and verified RSV infection by evaluation of viral gene expression (Supplemental Figure 1a, b). We then evaluated the epigenetic enzyme expression in the CD11c+ cell population and showed upregulated gene expression of Kdm6a and Kdm6b H3K27 demethylases in both strains of mice (Figure 1a,b). Next, we evaluated the upregulation of Kdm6 demethylases in CD11c+ bone marrow-derived dendritic cells (BMDC) since a significant source of inflammatory CD11c+ cells recruited to the lungs during infection are bone marrow-derived and furthermore, epigenetic alteration of inflammatory DC regulates RSV-driven immunopathology (27). BMDC were infected with live RSV (MOI = 2.5) for 4, 8, 12, or 24 hours and infection verified by RSV gene expression (Supplemental Figure 1c) and cells were then evaluated for Kdm6a/b mRNA expression (Figure 1c). Significant upregulation of both Kdm6a and Kdm6b was observed at 8 hrs in the C57BL/6 and at 4 or 12 hrs for the Balb/c mouse derived BMDC (Figure 1d,e), indicating that there may be differential regulation dependent upon mouse strain but still significant in both models. The use of UV-inactivated RSV did not lead to upregulation of Kdm6a or Kdm6b (Supplemental Figure 1d), demonstrating a direct effect of RSV on the expression of these gene regulatory chromatin modifiers.

Figure 1. Histone lysine demethylases Kdm6a and Kdm6b are upregulated following RSV infection.

Figure 1.

A, B. Male C57BL/6 or Balb/c mice were infected with RSV (2 × 105 pfu) and lungs collected 8 days post-infection and compared to naïve control animals. Lungs were harvested and the CD11c+ cell population isolated using MACS bead separation, mRNA extracted and qPCR performed to determine epigenetic enzyme expression (N ≥ 3). C. Experimental design for BMDC culture D, E. BMDC isolated from C57BL/6 or Balb/c mice were infected in vitro with RSV and cells collected at the indicated timepoints, mRNA extracted and qPCR performed to determine epigenetic enzyme expression (N = 3). Data represent Mean ± SEM (Representative of 2 individual experiments). * = p < 0.05; ** = p < 0.01; *** = p < 0.001.

Inhibition of KDM6 reduces DC cytokine and co-stimulatory molecule expression

To examine the role of KDM6 enzymes, GSK J4 (10 μM), a competitive inhibitor that blocks KDM6 demethylase activity was used (31). Based on time-course studies, to determine optimal cytokine and chemokine gene expression, (Supplemental Figure 2a) and to allow for epigenetic modification of these genes following epigenetic enzyme upregulation, BMDC were treated with GSK J4 or vehicle and concurrently infected with RSV for 24 hours. RSV infectivity of BMDC treated with vehicle or GSK J4 was similar, as indicated by the levels of RSV gene expression (Figure 2a). Additionally, we analyzed the live cell populations using flow cytometry and observed no difference in cell viability compared to vehicle-treated controls (Figure 2b). Treatment with GSK J4 during RSV-infection led to a significant reduction in CCL-2, CCL-3, CCL-5, and IL-6 (Figure 2c) indicating a decrease in inflammatory chemokines and cytokines in response to RSV-infection. An inactive isomer of GSK J4 (GSK J5) was also used as a control and showed no reduction in these specific cytokines (Supplemental Figure 2b), confirming specificity of this response to GSK J4. Additionally, correlating with previous studies from our laboratory (29, 30), no upregulation of the inflammatory response (i.e. Il6 or chemokines) was observed using UV-inactivated RSV (Supplemental Figure 2c,d), indicating that active viral infection is necessary for this response. In order to examine DC activation, co-stimulatory and maturation markers were examined and indicated a reduction in CD80 and CD86 as well as MHC II expression (Figure 2d) and this reduction was confirmed using siRNA to knockdown gene expression of Kdm6b (Supplemental Figure 2e). Treatment with GSK J4 demonstrated increased H3K27 methylation status (Figure 2e) indicating targeted inhibition of KDM6 enzyme activity, as well as a significant reduction in H3K4 methylation (Figure 2f), correlating with the reduced expression of key APC associated molecules. Thus, during RSV-infection, KDM6 enzymatic activity led to upregulation of cytokines and chemokines associated with RSV-driven inflammation and the activation of molecules necessary for optimal APC function.

Figure 2. Inhibition of KDM6 reduces DC cytokine and co-stimulatory molecule expression.

Figure 2.

BMDC were isolated from C57BL/6 mice, cultured for 6 days in the presence of GM-CSF and infected with RSV + GSK J4 or vehicle control in vitro for 24 hours. A. mRNA was extracted and qPCR performed to determine RSV F gene expression (N = 3). B. Cells were collected, processed and stained for flow cytometry analysis of live cell populations (N = 3). C. Supernatant was collected and protein evaluated using Bio-Plex assay (N = 3). D. Cells were collected, processed and stained for flow cytometry analysis of APC markers (N = 3). E, F. Cells were collected and DNA extracted for ChIP analysis (N ≥ 3). Data represent Mean ± SEM (Representative of at least 2 individual experiments). * = p < 0.05; ** = p < 0.01; *** = p < 0.001; **** = p < 0.0001.

Inhibition of KDM6 in BMDC alters cytokine response of CD4+ T-helper cells

Since both cytokine and co-stimulatory molecules were altered by KDM6 inhibition, we examined if altering KDM6 activity in DC resulted in an altered ability to activate T cells. Previous studies have shown that in vitro infection of DC, followed by co-culture with T cells leads to altered T cell cytokine production (14, 27). BMDC were infected with RSV (MOI = 2.5) and treated with GSK J4 (10 μM) for 24 hours and then co-cultured with T cells (1:10) for 48 hours and cytokine production examined (Figure 3a). Co-culture of RSV infected BMDC with T cells isolated from the lymph nodes of RSV-infected Balb/c mice led to significantly reduced IL-17A and IFN-γ production upon inhibition of KDM6 in BMDC (Figure 3b). Additionally, when BMDC from C57BL/6 mice were infected with RSV +/− GSK J4 and co-cultured with ovalbumin peptide specific OT-II CD4+ T cells (37, 38), decreased production of IL-5 and IL-13 following exposure to ova peptide was observed (Figure 3c). These data indicate that DC-specific KDM6 expression has a role in regulating the development of the T cell response following RSV infection as well as to unrelated primary immune responses linked to Th cell mediated disease. Differences between these responses may be due to the elicitation of an already established secondary response in the RSV responses as compared to a primary T cell response observed in the OT-II ova TCR transgenic responses. Further studies will be needed to better understand these differences.

Figure 3. Inhibition of KDM6 in BMDC alters cytokine response of CD4+ T-helper cells.

Figure 3.

A. DC/T cell co-culture experimental design B. RSV-infected DC (Balb/c) co-cultured with CD4+ T cells isolated from the lymph nodes of RSV-infected female Balb/c mice at 8 days post-infection. Supernatant collected and protein concentration analyzed using Bio-Plex assay (N ≥ 4). C. RSV-infected DC (C57BL/6) co-cultured with CD4+ T cells isolated from the spleens of naïve female OT-II mice exposed to ovalbumin peptide. Supernatant collected and protein concentration analyzed using Bio-Plex assay (N = 3). Data represent Mean ± SEM (Representative of 2 individual experiments). * = p < 0.05.

BMDC-induced RSV sensitization is altered by KDM6 inhibition in RSV challenge

To further examine the role of KDM6 enzymatic function, RSV infected BMDC (24 hour) with or without inhibition of KDM6 were transferred intratracheally into naïve Balb/c mice and at 7 days post-DC transfer, BMDC sensitized mice were challenged with RSV (Figure 4a). Our lab has previously demonstrated that this sensitization protocol with DC elicits a pathogenic immune environment upon RSV re-infection (15, 27). Instillation of RSV-infected BMDC led to enhanced inflammation and mucus within the lungs compared to RSV only (Figure 4b) at 8 days post-infection. However, KDM6-inhibited BMDC sensitization resulted in reduced inflammation and mucus production compared to vehicle control (Figure 4b) with a correlative decrease in the expression of pathologic Th2 genes (Il4, Il5, Il13) (Figure 4c). We also observed a decrease in inflammatory innate immune cells (Figure 4d) as well as neutrophils (Figure 4e), while activated CD4+ T cells were not significantly decreased (Figure 4f) within the lungs of animals given KDM6-inhibited BMDC. The activated CD8+ T cells show a decrease in number, although not significant, opposite of CD4. These data indicate that BMDC-specific KDM6 activity contributes to RSV-driven immunopathology within the lungs consistent with those observed following secondary RSV infections.

Figure 4. BMDC-induced RSV sensitization is altered by KDM6 inhibition in RSV challenge.

Figure 4.

A. DC transfer experimental design B. Lungs were embedded in paraffin and Periodic acid-Schiff stain (PAS) was performed to visualize inflammation and mucus (bright pink staining). Representative photos shown. C. Lungs were homogenized and mRNA extracted to determine cytokine gene expression compared to naïve controls (N = 5). D-F. Lungs were processed into single-cell suspension and stained for flow cytometry analysis. (N = 5). Data represent Mean ± SEM (N = 5 male Balb/c mice/group). * = p < 0.05; ** = p < 0.01; *** = p < 0.001; **** = p < 0.0001.

In vivo inhibition of KDM6 alters the immune response to RSV infection

To determine if KDM6 has an immunopathologic role during a primary RSV infection in vivo, Balb/c mice were treated systemically (IP) with GSK J4 (20 mg/kg) daily for 7 days to inhibit KDM6 enzymatic activity (Figure 5a). Tissues were collected at 8 days post-infection and evaluated for RSV-driven immunopathology. This time point has previously been described in mouse models comparing live viral infection to UV-inactivated RSV control, showing that live RSV is required for activation of the immune response leading to immunopathology, peaking at 8 days post-infection (29, 30). Lung histology showed that KDM6 inhibition resulted in decreased mucus production and inflammation as well as a reduction of bronchus-associated lymphoid tissue (BALT) in the lungs (Figure 5b,c) with a correlative decrease in mucus score (Figure 5d) and mucus genes, gob5 and muc5ac (Figure 5e). Additionally, we observed a decrease in inflammatory CD11c+ DC (CD11b+/MHCII+ and CD11b+/CD86+) and F4/80+ macrophages in the lungs of KDM6-inhibited animals (Figure 5f,g) with no alteration in eosinophil or neutrophil cell infiltration (Figure 5h). Furthermore, in vivo treatment with GSK J4 led to fewer activated CD4+ T cells within the lungs (Figure 5i), suggesting a role for KDM6 in the adaptive immune response, likely through altered APC function. Analysis of the cytokine production from RSV re-infected isolated lymph node cells showed reduced IL-13 and IFN-γ in GSK J4-treated mice compared to vehicle control mice (Figure 5j). Overall, these data show decreased inflammatory responses by inhibiting KDM6 activity, demonstrating a direct link between KDM6 activity and RSV-driven immunopathology.

Figure 5. In vivo inhibition of KDM6 alters the immune response to RSV infection.

Figure 5.

Male Balb/c mice were infected with RSV (2 × 105 pfu) and concurrently treated with GSK J4 to inhibit KDM6 enzymatic activity and tissues were harvested at 8 days post-infection. A. Experimental design B,C. Lungs were embedded in paraffin and Periodic acid-Schiff stain (PAS) was performed to visualize mucus (bright pink staining) and inflammatory infiltrates (blue). Representative photos shown at 100x magnification. D. Subjective mucus scoring was performed on blinded histological slides on a scale of 1–4 for mucus production (N = 5) E. Lungs were homogenized and mRNA extracted to determine mucus gene expression compared to naïve controls (N = 5) F-I. Lungs were processed into single-cell suspension and stained for flow cytometry analysis. (N = 5). J. Lung draining lymph nodes (LDLN) were processed into single cell suspension and re-infected with RSV in vitro for 48 hours to determine cytokine protein levels (N = 5). Data represent Mean ± SEM. Representative of at least 2 independent experiments. * = p < 0.05; ** = p < 0.01; *** = p < 0.001; **** = p < 0.0001.

Discussion

RSV is an ubiquitous pathogen, infecting nearly all children by the age of two (1, 2) and is the second most likely cause of death by a pathogen in infants under the age of one (39). RSV is characterized by a dysregulated immune response that leads to poor immunologic recall that allows re-infection throughout life. Additionally, clinical data support a link between early life severe RSV infection and the development of airway disease later in life, including asthma (1, 8, 40, 41). Therefore, elucidation of mechanisms that drive disease is crucial for protection from both primary infection and exacerbated diseases later in life. While epigenetic alterations of DC have been described that change their overall function, including DNA methylation and chromatin modifications, the specific changes during different diseases will require individual investigation. To extend our earlier observations in DC (15, 27), we sought to examine the role of specific epigenetic effects on DC-driven mechanisms following RSV infection. These altered innate immune responses are impactful as in vivo inhibition of KDM6 enzymes leads to decreased RSV-driven immunopathology. These studies indicate the following novel findings: 1) Upregulation of key epigenetic enzymes, such as KDM6 demethylases, following RSV infection leads to altered APC function, increased pro-inflammatory responses, and immunopathology and 2) targeting specific epigenetic mechanisms that alter inflammatory DC responses may be pivotal for limiting long-term RSV-driven disease pathologies. Thus, an early viral response may specifically “train” innate immune cells leading to long-term phenotypes.

Previous studies have shown that epigenetic modulation directs the differentiation and maturation of immune cells. A key epigenetic gene modifier is H3K27 tri-methylation, which represses gene transcription, and removal of this mark by KDM6 demethylases leads to active gene transcription. Studies have shown that KDM6B can enhance both pro-inflammatory and anti-inflammatory responses by targeting distinct transcription factors, such as NF-kB (24, 42, 43) in a context-dependent manner in gene promoters (24). KDM6B can drive M2 polarization via STAT6 activation (44), Th1 cell differentiation via Tbet interaction (45), and support EMT pathways via TGF-β and SMAD3 (46). Additionally, a role has been shown for KDM6A/B in autoimmunity in the experimental autoimmune encephalomyelitis (EAE) model of multiple sclerosis, with chemical inhibition leading to a tolerogenic DC phenotype and decreased Th1 and Th17 responses (47). Importantly, the KDM6 family of enzymes has been shown to regulate not only H3K27me3 but also H3K4me deposition through stabilization of the MLL complex (22, 23), an H3K4 methyltransferase that deposits activating methylation marks on the histone tail. Studies have shown that the overexpression of KDM6B leads to increased H3K4me3 while leaving H3K27me relatively unchanged (48) similar to our observations of H3K4me3 on CD80/86. Overall our data expand on the inflammatory role for KDM6 in driving pathologic diseases, linking innate cytokine production by inflammatory DC and induction of Th2 cytokines leading to lung immunopathology in RSV infection.

The myeloid/inflammatory DC has been linked to chronic disease that is enhanced and/or exacerbated by RSV (15, 49, 50). Our lab has previously observed an upregulation of KDM5B, an H3K4 demethylase, following RSV infection of DCs (27) that contributes to a pathogenic T cell-mediated immune response due to the regulation of critical innate cytokines, especially Type I IFN. While KDM6A/B are upregulated following RSV infection, PolyI:C, a double stranded RNA and TLR3 agonist did not induce KDM6 expression (27). Interestingly, KDM5B and KDM6 do not appear to regulate the same genes. To evaluate KDM6 targets, inhibition of KDM6 enzymatic activity was accomplished using GSK J4, which has previously been shown to be specific for KDM6 activity (31). While a study determined minor GSK J4 activity against KDM5 enzymes as well (51), no increase in the level of H3K4me3 on the CD80/86 promoter regions was observed in our data, an expected enzymatic activity if KDM5, a H3K4 demethylase, was inhibited. Furthermore, RSV-infected BMDC with inhibited KDM6 enzymatic function led to decreased APC maturation marker expression (CD80/86 and MHCII) as well as decreased IL-6 along with chemokines; whereas our previous studies with KDM5B inhibition showed an increase in IL-6 as well as IFN-β with no alteration of APC markers (27). Importantly, decreased infiltration of inflammatory DC/macrophages into the lung, as well as decreased activation of T cells were observed following inhibition of KDM6 during in vivo RSV infection. These latter studies demonstrated that inhibition of KDM6 demethylation led to a reduction of Th2 induced pathology, including development of mucus hypersecretion. These data indicate that the effect of KDM6 activity alters both the innate as well as adaptive immune responses in a related but different mechanism from KDM5B, largely through alteration of APC function. Thus, there appears to be an epigenetic program that controls multiple chromatin modifying enzymes that alters the ability of the immune response to function appropriately during RSV infection.

These studies demonstrate a novel pathway whereby RSV infection leads to upregulation of epigenetic enzymes KDM6A and KDM6B that modify multiple DC functions. These include maturation of APC including costimulatory molecule expression as well as activation of defined chemokines and cytokines responsible for RSV-driven immunopathology (Figure 6). Inhibition of this activity leads to protection from Th2-driven lung pathogenesis that has been linked both to the exacerbated response following RSV vaccination (52–54) and the enhanced likelihood of asthma development later in life (1, 8, 40, 41). While these studies focused on DC-driven T cell adaptive responses due to their role in immunopathology, it is likely that the in vivo use of GSK J4 blocked multiple responses, including directly modifying macrophages and T cells. Thus, KDM6 may be a therapeutic target that could alter the progression of pathogenic immune responses in the lung during RSV infection and modify the long-term immune environment.

Figure 6. RSV infection leads to upregulation of epigenetic enzymes KDM6A and KDM6B to enhance immunopathology.

Figure 6.

Figure created with BioRendor.com

Supplementary Material

1

Key Points.

  1. KDM6 demethylases are upregulated in inflammatory DC following RSV infection

  2. KDM6 during RSV infection alters APC function of DC

  3. KDM6 increases pro-inflammatory responses and RSV-driven immunopathology

Acknowledgements

This work was funded in part by NIH grant AI036302.

References

  • 1.Sigurs N, Aljassim F, Kjellman B, Robinson PD, Sigurbergsson F, Bjarnason R, and Gustafsson PM. 2010. Asthma and allergy patterns over 18 years after severe RSV bronchiolitis in the first year of life. Thorax 65: 1045–1052. [DOI] [PubMed] [Google Scholar]
  • 2.Nair H, Nokes DJ, Gessner BD, Dherani M, Madhi SA, Singleton RJ, O’Brien KL, Roca A, Wright PF, Bruce N, Chandran A, Theodoratou E, Sutanto A, Sedyaningsih ER, Ngama M, Munywoki PK, Kartasasmita C, Simões EAF, Rudan I, Weber MW, and Campbell H. 2010. Global burden of acute lower respiratory infections due to respiratory syncytial virus in young children: a systematic review and meta-analysis. Lancet Lond. Engl 375: 1545–1555. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Robinson RF 2008. Impact of respiratory syncytial virus in the United States. Am. J. Health. Syst. Pharm 65: S3–S6. [DOI] [PubMed] [Google Scholar]
  • 4.Lambert L, Sagfors AM, Openshaw PJM, and Culley FJ. 2014. Immunity to RSV in Early-Life. Front. Immunol 5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Fulginiti VA, Eller JJ, Sieber OF, Joyner JW, Minamitani M, and Meiklejohn G. 1969. Respiratory virus immunization. I. A field trial of two inactivated respiratory virus vaccines; an aqueous trivalent parainfluenza virus vaccine and an alum-precipitated respiratory syncytial virus vaccine. Am. J. Epidemiol 89: 435–448. [DOI] [PubMed] [Google Scholar]
  • 6.Kapikian AZ, Mitchell RH, Chanock RM, Shvedoff RA, and Stewart CE. 1969. An epidemiologic study of altered clinical reactivity to respiratory syncytial (RS) virus infection in children previously vaccinated with an inactivated RS virus vaccine. Am. J. Epidemiol 89: 405–421. [DOI] [PubMed] [Google Scholar]
  • 7.Kim HW, Canchola JG, Brandt CD, Pyles G, Chanock RM, Jensen K, and Parrott RH. 1969. Respiratory syncytial virus disease in infants despite prior administration of antigenic inactivated vaccine. Am. J. Epidemiol 89: 422–434. [DOI] [PubMed] [Google Scholar]
  • 8.Henderson J, Hilliard TN, Sherriff A, Stalker D, Al Shammari N, and Thomas HM. 2005. Hospitalization for RSV bronchiolitis before 12 months of age and subsequent asthma, atopy and wheeze: a longitudinal birth cohort study. Pediatr. Allergy Immunol. Off. Publ. Eur. Soc. Pediatr. Allergy Immunol 16: 386–392. [DOI] [PubMed] [Google Scholar]
  • 9.Freer G, and Matteucci D. 2009. Influence of dendritic cells on viral pathogenicity. PLoS Pathog. 5: e1000384. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Swedan S, Andrews J, Majumdar T, Musiyenko A, and Barik S. 2011. Multiple Functional Domains and Complexes of the Two Nonstructural Proteins of Human Respiratory Syncytial Virus Contribute to Interferon Suppression and Cellular Location▿. J. Virol 85: 10090–10100. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Mukherjee S, Lindell DM, Berlin AA, Morris SB, Shanley TP, Hershenson MB, and Lukacs NW. 2011. IL-17-induced pulmonary pathogenesis during respiratory viral infection and exacerbation of allergic disease. Am. J. Pathol 179: 248–258. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Lotz MT, and Peebles RS. 2012. Mechanisms of respiratory syncytial virus modulation of airway immune responses. Curr. Allergy Asthma Rep 12: 380–387. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Tourdot S, Mathie S, Hussell T, Edwards L, Wang H, Openshaw PJM, Schwarze J, and Lloyd CM. 2008. Respiratory syncytial virus infection provokes airway remodelling in allergen-exposed mice in absence of prior allergen sensitization. Clin. Exp. Allergy J. Br. Soc. Allergy Clin. Immunol 38: 1016–1024. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Reed M, Morris SH, Jang S, Mukherjee S, Yue Z, and Lukacs NW. 2013. Autophagy-inducing protein beclin-1 in dendritic cells regulates CD4 T cell responses and disease severity during respiratory syncytial virus infection. J. Immunol. Baltim. Md 1950. 191: 2526–2537. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Jang S, Smit J, Kallal LE, and Lukacs NW. 2013. Respiratory syncytial virus infection modifies and accelerates pulmonary disease via DC activation and migration. J. Leukoc. Biol 94: 5–15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Kouzarides T 2007. Chromatin Modifications and Their Function. Cell 128: 693–705. [DOI] [PubMed] [Google Scholar]
  • 17.Allis CD, and Jenuwein T. 2016. The molecular hallmarks of epigenetic control. Nat. Rev. Genet 17: 487–500. [DOI] [PubMed] [Google Scholar]
  • 18.Barski A, Cuddapah S, Cui K, Roh T-Y, Schones DE, Wang Z, Wei G, Chepelev I, and Zhao K. 2007. High-resolution profiling of histone methylations in the human genome. Cell 129: 823–837. [DOI] [PubMed] [Google Scholar]
  • 19.Fischle W, Wang Y, Jacobs SA, Kim Y, Allis CD, and Khorasanizadeh S. 2003. Molecular basis for the discrimination of repressive methyl-lysine marks in histone H3 by Polycomb and HP1 chromodomains. Genes Dev. 17: 1870–1881. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Zhang Y, and Reinberg D. 2001. Transcription regulation by histone methylation: interplay between different covalent modifications of the core histone tails. Genes Dev. 15: 2343–2360. [DOI] [PubMed] [Google Scholar]
  • 21.De Santa F, Narang V, Yap ZH, Tusi BK, Burgold T, Austenaa L, Bucci G, Caganova M, Notarbartolo S, Casola S, Testa G, Sung W-K, Wei C-L, and Natoli G. 2009. Jmjd3 contributes to the control of gene expression in LPS-activated macrophages. EMBO J. 28: 3341–3352. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Lee MG, Villa R, Trojer P, Norman J, Yan K-P, Reinberg D, Di Croce L, and Shiekhattar R. 2007. Demethylation of H3K27 regulates polycomb recruitment and H2A ubiquitination. Science 318: 447–450. [DOI] [PubMed] [Google Scholar]
  • 23.Arcipowski KM, Martinez CA, and Ntziachristos P. 2016. Histone demethylases in physiology and cancer: a tale of two enzymes, JMJD3 and UTX. Curr. Opin. Genet. Dev 36: 59–67. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Salminen A, Kaarniranta K, Hiltunen M, and Kauppinen A. 2014. Histone demethylase Jumonji D3 (JMJD3/KDM6B) at the nexus of epigenetic regulation of inflammation and the aging process. J. Mol. Med. Berl. Ger 92: 1035–1043. [DOI] [PubMed] [Google Scholar]
  • 25.Estarás C, Fueyo R, Akizu N, Beltrán S, and Martínez-Balbás MA. 2013. RNA polymerase II progression through H3K27me3-enriched gene bodies requires JMJD3 histone demethylase. Mol. Biol. Cell 24: 351–360. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.De Santa F, Totaro MG, Prosperini E, Notarbartolo S, Testa G, and Natoli G. 2007. The histone H3 lysine-27 demethylase Jmjd3 links inflammation to inhibition of polycomb-mediated gene silencing. Cell 130: 1083–1094. [DOI] [PubMed] [Google Scholar]
  • 27.Ptaschinski C, Mukherjee S, Moore ML, Albert M, Helin K, Kunkel SL, and Lukacs NW. 2015. RSV-Induced H3K4 Demethylase KDM5B Leads to Regulation of Dendritic Cell-Derived Innate Cytokines and Exacerbates Pathogenesis In Vivo. PLoS Pathog. 11: e1004978. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Moore ML, Chi MH, Luongo C, Lukacs NW, Polosukhin VV, Huckabee MM, Newcomb DC, Buchholz UJ, Crowe JE, Goleniewska K, Williams JV, Collins PL, and Peebles RS. 2009. A chimeric A2 strain of respiratory syncytial virus (RSV) with the fusion protein of RSV strain line 19 exhibits enhanced viral load, mucus, and airway dysfunction. J. Virol 83: 4185–4194. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Miller AL, Bowlin TL, and Lukacs NW. 2004. Respiratory syncytial virus-induced chemokine production: linking viral replication to chemokine production in vitro and in vivo. J. Infect. Dis 189: 1419–1430. [DOI] [PubMed] [Google Scholar]
  • 30.Tekkanat KK, Maassab H, Miller A, Berlin AA, Kunkel SL, and Lukacs NW. 2002. RANTES (CCL5) production during primary respiratory syncytial virus infection exacerbates airway disease. Eur. J. Immunol 32: 3276–3284. [DOI] [PubMed] [Google Scholar]
  • 31.Kruidenier L, Chung C, Cheng Z, Liddle J, Che K, Joberty G, Bantscheff M, Bountra C, Bridges A, Diallo H, Eberhard D, Hutchinson S, Jones E, Katso R, Leveridge M, Mander PK, Mosley J, Ramirez-Molina C, Rowland P, Schofield CJ, Sheppard RJ, Smith JE, Swales C, Tanner R, Thomas P, Tumber A, Drewes G, Oppermann U, Patel DJ, Lee K, and Wilson DM. 2012. A selective jumonji H3K27 demethylase inhibitor modulates the proinflammatory macrophage response. Nature 488: 404–408. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Bermick JR, Lambrecht NJ, denDekker AD, Kunkel SL, Lukacs NW, Hogaboam CM, and Schaller MA. 2016. Neonatal monocytes exhibit a unique histone modification landscape. Clin. Epigenetics 8: 99. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Owczarczyk AB, Schaller MA, Reed M, Rasky AJ, Lombard DB, and Lukacs NW. 2015. Sirtuin 1 Regulates Dendritic Cell Activation and Autophagy during Respiratory Syncytial Virus-Induced Immune Responses. J. Immunol. Baltim. Md 1950. 195: 1637–1646. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Bayarsaihan D 2011. Epigenetic Mechanisms in Inflammation. J. Dent. Res 90: 9–17. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Morandini AC, Santos CF, and Yilmaz Ö. 2016. Role of epigenetics in modulation of immune response at the junction of host–pathogen interaction and danger molecule signaling. Pathog. Dis 74. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Shanmugam MK, and Sethi G. 2013. Role of epigenetics in inflammation-associated diseases. Subcell. Biochem 61: 627–657. [DOI] [PubMed] [Google Scholar]
  • 37.Barnden MJ, Allison J, Heath WR, and Carbone FR. 1998. Defective TCR expression in transgenic mice constructed using cDNA-based alpha- and beta-chain genes under the control of heterologous regulatory elements. Immunol. Cell Biol 76: 34–40. [DOI] [PubMed] [Google Scholar]
  • 38.Robertson JM, Jensen PE, and Evavold BD. 2000. DO11.10 and OT-II T Cells Recognize a C-Terminal Ovalbumin 323–339 Epitope. J. Immunol 164: 4706–4712. [DOI] [PubMed] [Google Scholar]
  • 39.Ruckwardt TJ, Morabito KM, and Graham BS. 2016. Determinants of early life immune responses to RSV infection. Curr. Opin. Virol 16: 151–157. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Larkin EK, and Hartert TV. 2015. Genes associated with RSV lower respiratory tract infection and asthma: the application of genetic epidemiological methods to understand causality. Future Virol. 10: 883–897. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Bacharier LB, Cohen R, Schweiger T, Yin-DeClue H, Christie C, Zheng J, Schechtman KB, Strunk RC, and Castro M. 2012. Determinants of asthma after severe respiratory syncytial virus bronchiolitis. J. Allergy Clin. Immunol 130: 91–100.e3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Das ND, Jung KH, Choi MR, Yoon HS, Kim SH, and Chai YG. 2012. Gene networking and inflammatory pathway analysis in a JMJD3 knockdown human monocytic cell line. Cell Biochem. Funct 30: 224–232. [DOI] [PubMed] [Google Scholar]
  • 43.Das A, Das ND, Jung KH, Park JH, Lee HT, Han D, Choi MR, Kang SC, and Chai YG. 2013. Proteomic changes induced by histone demethylase JMJD3 in TNF alpha-treated human monocytic (THP-1) cells. Mol. Immunol 56: 113–122. [DOI] [PubMed] [Google Scholar]
  • 44.Ishii M, Wen H, Corsa CAS, Liu T, Coelho AL, Allen RM, Carson WF, Cavassani KA, Li X, Lukacs NW, Hogaboam CM, Dou Y, and Kunkel SL. 2009. Epigenetic regulation of the alternatively activated macrophage phenotype. Blood 114: 3244–3254. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Pham D, Yu Q, Walline CC, Muthukrishnan R, Blum JS, and Kaplan MH. 2013. Opposing roles of STAT4 and Dnmt3a in Th1 gene regulation. J. Immunol. Baltim. Md 1950. 191: 902–911. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Estarás C, Akizu N, García A, Beltrán S, de la Cruz X, and Martínez-Balbás MA. 2012. Genome-wide analysis reveals that Smad3 and JMJD3 HDM co-activate the neural developmental program. Dev. Camb. Engl 139: 2681–2691. [DOI] [PubMed] [Google Scholar]
  • 47.Doñas C, Carrasco M, Fritz M, Prado C, Tejón G, Osorio-Barrios F, Manríquez V, Reyes P, Pacheco R, Bono MR, Loyola A, and Rosemblatt M. 2016. The histone demethylase inhibitor GSK-J4 limits inflammation through the induction of a tolerogenic phenotype on DCs. J. Autoimmun 75: 105–117. [DOI] [PubMed] [Google Scholar]
  • 48.Wei Y, Zheng H, Bao N, Jiang S, Bueso-Ramos CE, Khoury J, Class C, Lu Y, Lin K, Yang H, Ganan-Gomez I, Starczynowski DT, Do K-A, Colla S, and Garcia-Manero G. 2018. KDM6B overexpression activates innate immune signaling and impairs hematopoiesis in mice. Blood Adv. 2: 2491–2504. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Worgall S 2013. Editorial: RSV, dendritic cells, and allergens—a bad combination. J. Leukoc. Biol 94: 1–3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.McDermott DS, Weiss KA, Knudson CJ, and Varga SM. 2011. Central role of dendritic cells in shaping the adaptive immune response during respiratory syncytial virus infection. Future Virol. 6: 963–973. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Heinemann B, Nielsen JM, Hudlebusch HR, Lees MJ, Larsen DV, Boesen T, Labelle M, Gerlach L-O, Birk P, and Helin K. 2014. Inhibition of demethylases by GSK-J1/J4. Nature 514: E1–E2. [DOI] [PubMed] [Google Scholar]
  • 52.Acosta PL, Caballero MT, and Polack FP. 2016. Brief History and Characterization of Enhanced Respiratory Syncytial Virus Disease. Clin. Vaccine Immunol. CVI 23: 189–195. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Connors M, Kulkarni AB, Firestone CY, Holmes KL, Morse HC, Sotnikov AV, and Murphy BR. 1992. Pulmonary histopathology induced by respiratory syncytial virus (RSV) challenge of formalin-inactivated RSV-immunized BALB/c mice is abrogated by depletion of CD4+ T cells. J. Virol 66: 7444–7451. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Connors M, Giese NA, Kulkarni AB, Firestone CY, Morse HC, and Murphy BR. 1994. Enhanced pulmonary histopathology induced by respiratory syncytial virus (RSV) challenge of formalin-inactivated RSV-immunized BALB/c mice is abrogated by depletion of interleukin-4 (IL-4) and IL-10. J. Virol 68: 5321–5325. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

1

RESOURCES