Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2021 Jan 1.
Published in final edited form as: J Immunol. 2019 Nov 25;204(1):169–179. doi: 10.4049/jimmunol.1900736

Interleukin-17 Promotes Pseudomonas aeruginosa Keratitis in C57BL/6 Mouse Corneas

Rao Me 1, Nan Gao 1, Chenyang Dai 1,2, Fu-shin X Yu 1
PMCID: PMC6920547  NIHMSID: NIHMS1541821  PMID: 31767781

Abstract

The aim of this study was to elucidate the expression and functions of Interleukin (IL)-17 in C57BL/6 mouse corneas in response to Pseudomonas aeruginosa (PA) infection. We found that PA-infection induced an increased signaling of IL-23/23R/17/17R in mouse corneas Targeting IL-17A or the IL-17A-specific receptor IL-17RA/IL-17RC with neutralizing antibodies resulted in a significant decrease in the severity of PA keratitis, including a decrease in bacterial burden and PMN infiltration. IL-17A signaling blockade also significantly reduced the expression of the pro-inflammatory cytokines L-1β, IL-24, and MMP-13 and increased the expression of the anti-inflammatory cytokine IL-1RA in mouse corneal epithelium. The presence of mouse IL-17A exacerbated PA-mediated tissue destruction. A cytokine protein array revealed that the expression of Osteoprotegerin (OPG) was regulated by IL-17A, and OPG neutralization also resulted in a decrease in the severity of PA keratitis. While both IL-17 and OPG affected the balanced expression of IL-1β and IL-1RA, only IL-17 inhibited the expression of TH2 cytokines. Taken together, our results revealed that IL-17A, along with its downstream factor OPG, plays a detrimental role in the pathogenesis of PA keratitis. Targeting IL-17A and/or the OPG/RANKL/RANK/TRAIL system is a potential therapeutic strategy in controlling the outcome of PA keratitis which was demonstrated by concurrent topical application of IL-17A neutralizing antibody and ciprofloxacin in B6 mice.

Introduction

Microbial keratitis is a sight-threatening disease that occurs worldwide. It remains one of the major causes of irreversible corneal blindness, which is the second most common global cause of legal blindness after cataracts (1). Contact lens use is a significant predisposing risk factor for microbial keratitis, especially in patients with extended-use lenses (2). Corneal hypoxia, decreased tear production, micro-trauma, and increased cornea temperature caused by the contact lens allows pathogens to better adhere to the ocular surface, and increase their opportunity to infect the eye (3, 4). Among all contact lens-related pathogens, Pseudomonas aeruginosa (PA) is the most frequently isolated and most pathogenic organism (5). PA causes a keratitis with rapid onset and progression, and clinically manifests with strong inflammation and ulceration. More severe complications including anterior chamber hypopyon and descemetocele formation, corneal scarring, and perforation may occur (6).

The severe keratitis caused by PA is known to result from not only the high virulence characteristics of the bacteria itself, but also from the excessive host immune inflammatory response (7). PA can quickly attach to the corneal epithelium by its pilli, and then inject various toxins to the host cell using the type III system (8). Elastase and alkaline proteases produced by PA can also disrupt the epithelium barrier and promote invasion to the corneal stroma (8, 9). Our previous study showed that in a B6 mouse model of PA keratitis, it takes approximately 18–24 h for the bacteria to cross the epithelial basement membrane and reach the stroma (10). Certain components of the bacteria can activate the innate defense system. For example, the corneas as well as the lung pretreated with PA flagellin significantly attenuated the severity of infectious diseases by activating TLR5 signaling, and reprogramming the expression of downstream genes to enhance the innate defense function (11, 12). However, the immune response to PA invasion is not always protective, and an overwhelming host inflammatory response can cause tissue destruction (13, 14). For example, neutrophils are crucial for bacterial clearance, but persistent neutrophil recruitment and degranulation releases excessive oxidants, including hydrogen peroxide and hydroxyl radicals, that attack host tissues (15). Inflamed leukocytes also secretes proteolytic enzymes that damage host structures (16). Several studies showed that depletion of specific pro-inflammatory mediators such as IL-1β promote bacterial clearance in PA keratitis (17, 18). The need for a balanced host response to infection is also important in other mucosal tissues, such as the lung and in the cornea (19, 20). In general, rapid resolution of infection-induced inflammation in a tissue, such as the cornea, is determined by the balance of pro- and anti-inflammatory immune responses, which include the expression of cytokines and chemokines, of which one such group is the IL-17 family of cytokines (14).

IL-17 was first identified in 1993 and rose to prominence after the discovery of IL-17-secreting CD4+ T cells in 2005 (21). There are six members in the IL-17 cytokine family, IL-17A- F (22). IL-17A is the prototypical member of this family, and signals through a heteromeric receptor complex consisting of IL-17RA and IL-17RC, along with its homologue IL-17F. Other family members signal through multimeric units sharing the common chain IL-17RA (23, 24). While Th17 cells are a major source of IL-17 cytokines, they can also be produced by innate immune cells, including dendritic cells, macrophages, gamma delta T cells and type 3 innate lymphoid cells (25). Binding of IL-17A receptors recruits the adaptor Act1, which is also an E3 ubiquitin ligase, and activates TRAF-6, which initiates the NF-κb and MAPK pathways and starts the transcription of many downstream genes (26–28). IL-17 has been shown to play a role in both pathological states and homeostasis of mucosal tissues. Proper IL-17 signaling enhances the immunity that protects the host from pathogen invasion (29). For example, IL-17 has been shown to play a crucial role in protection against fungal infection (30, 31). Patients who have IL-17 genetic defect are much more prone to have mucocutaneous candidiasis (32). Moreover, IL-17-deficient mice are shown to be more susceptible to Klebsiella and Streptococcus pneumoniae (33, 34). On the other hand, unrestrained IL-17 signaling can lead to immunopathology and inflammation-induced tissue destruction (35, 36). IL-17 also has also been linked to the pathogenesis of many autoimmune diseases, including psoriasis, inflammatory bowel disease, and autoimmune arthritis (37–39). In short, IL-17A acts as a double-edged sword, promoting an immune response that can defend against infection but may also result in damage to the host.

Given the dual roles of IL-17A in mucosal immunity, we assessed the expression of IL-17 signaling and its role in PA keratitis of B6 mice. We found that the IL-23/17 signaling was greatly elevated in the PA-infected mouse cornea. Blockade of IL-17/17R signal significantly attenuated the severity of PA keratitis by altering gene expression and suppressing infection-induced inflammation. We also identified that osteoprotegerin is a downstream effector of IL-17 signaling and plays a detrimental role in PA corneal infections. Targeting IL-17 and/or OPG may be used as an adjunctive therapy, in combination with antibiotics, to treat bacterial keratitis. Concurrent topical application of IL-17A neutralizing antibody and ciprofloxacin demonstrated therapeutic potential of IL-17 neutralization as an adjunctive therapy for treating PA keratitis in B6 mice.

Material and Methods

Animals

Wild-type C57BL/6 (B6) mice (8 week old; female) were purchased from The Jackson Laboratory (Bar Harbor, ME). All animal procedures were performed in compliance with the Association for Research in Vision and Ophthalmology Statement for the Use of Animals in Ophthalmic and Visual Research and were approved by the Institutional Animal Care and Use Committee of Wayne State University.

Mouse model of PA keratitis

Mice were anesthetized with an intraperitoneal injection of ketamine (90 mg/kg) and xylazine (10 mg/kg) before surgical procedures. Mouse corneas were scratched gently with a sterile 26-gauge needle to create three 1-mm incisions to break the epithelial barrier and were inoculated with 1.0 × 104 CFU of ATCC 19660, a virulent, laboratory strain known to consistently produce severe keratitis in experimentally infected mice with type III secretion system, in 5μl of PBS.

Administration of neutralizing antibody or recombinant protein

To apply neutralizing antibodies or recombinant proteins, mice were subconjunctivally-injected with anti-IL-17 (250ng/5μl; R&D Systems, Minneapolis, MN), anti-17RA (400ng/5μl; R&D Systems, Minneapolis, MN), anti-17RC (400ng/5μl; R&D Systems, Minneapolis, MN), recombinant mouse IL-17A (200ng/5μl; R&D Systems, Minneapolis, MN) 4 h before the inoculation with PA on the corneas. To explore the clinical use of anti-IL17 treatment, ciprofloxacin ophthalmic solution was used to dissolve anti-IL17Ab, and 5 μl was instilled into mouse corneas, starting 16 hours after PA inoculation and continuing every 2 hours thereafter during day 1 and 2, every 4 hours during day 3 after initial treatment.

Isolation of mouse corneal epithelial cells

A razor blade was tailored to ∼5 mm wide in the edge and placed in a Castroviejo razor blade breaker and holder. Mice were euthanized by cervical dislocation. Under the microscope, corneal epithelial cells (CECs) were surgically scraped off from the basement membrane. Cells were collected to the razor blade from the basement membrane. Liquid nitrogen was used to snap freeze the cells and cool off the tip of a sharp surgical scalper at the same time. Cells were immediately transferred into precooled 1.5-ml Eppendorf tubes placed on dry ice by scraping the razor blade with the scalper. Cells were processed immediately for RNA isolation or protein extraction, or they were stored at −80°C for later use.

Clinical examination, quantification of PA CFU, and determination of myeloperoxidase units

Corneas were photographed at 1 day post-infection (dpi) for the assessment of infection severity. Clinical scores were assigned to the infected corneas in a blinded fashion according to a previously-reported scale (40). Whole corneas were excised and placed in 200 ml of sterile PBS. Tissue was homogenized with a TissueLyser II (Qiagen, Valencia, CA). The homogenates were divided into two parts. The first fraction (50 ml) was subjected to serial log dilutions for the assessment of viable bacterial number. The remaining homogenates were further lysed for myeloperoxidase (MPO) measurement. MPO units were determined according to a previously reported method. One MPO unit corresponds to 2.0 × 105 polymorphonuclear leukocytes (PMNs).

Semiquantitative and quantitative PCR

The primers used in this study are listed in Table 1. Total RNA was extracted with an RNeasy mini kit (Qiagen) following the manufacturer’s instructions. For semiquantitative PCR, cDNA was amplified with TaqMan technology (Promega, Madison, WI). PCR products were subjected to electrophoresis on 2% agarose gels containing ethidium bromide. For quantitative PCR (qPCR), cDNA was amplified using a StepOnePlus real-time PCR system (Applied Biosystems, University Park, IL) with SYBR Green PCR master mix (Applied Biosystems). Data were analyzed by using the ΔΔ cycle threshold method with β-actin as the internal control.

Table 1.

Primer sequences used for PCR

Primers Forward (5’→3’) Reverse (5’→3’)
mβ-actin GACGGCCAGGTCATCACTATTG AGGAAGGCTGGAAAAGAGCC
mIL-23 AGAAGAAGAGGATGAAGAGAC GGTGTGAAGTTGGTCCAT
mIL-23R GGAGACAGAAGAAGAACAAC AATGATGGACGCAGAAGG
mIL-1β TGCCACCTTTTGACAGTGATG AAGGTCCACGGGAAAGACAC
mIL-1Ra GGGACCCTACAGTCACCTAA GGTCCTTGTAAGTACCCAGCA
mIL-17A TTTAACTCCCTTGGCGCAAAA CTTTCCCTCCGCATTGACAC
mIL-17RA ACAGTTCCCAAGCCAGTTGC GCTCAGCCCAACCCAAGATA
mIL-17RC GCTGCCTGATGGTGACAATG GAGGCCGGTTTTCATCTCCA
mIL-24 GCTTTCACCAAAGCGACTTC GCCCAGTAAGGACAATTCCA
mSOCS-3 ATTCACCCAGGTGGCTACAG GCCAATGTCTTCCCAGTGTT
mIL-36α CCAAGAACTGGGGGAAATCT GGAGGGCTCAGCTTTCTTTT
mIL-36γ CCCATGCAAGTACCCAGAGT GGGAAAGCCACTGATTCAAA
mCXCL-1 TGTTGTGCGAAAAGAAGTGC TACAAACACAGCCTCCCACA
mIL-1Ra GGGACCCTACAGTCACCTAA GGTCCTTGTAAGTACCCAGCA
mIL-10 TGCCTGCTCTTACTGACTGG CTGGGAAGTGGGTGCAGTTA
mCCL-2 CCACAACCACCTCAAGCACT AGGCATCACAGTCCGAGTCA
mOPG GCCACGCAAAAGTGTGGAAT TTTGGTCCCAGGCAAACTGT
mMMP-13 TGATGAAACCTGGACAAGC CTGGACCATAAAGAAACTGAA
mS100A8 TTCGTGACAATGCCGTCTGA AGGGCATGGTGATTTCCTTGT
mS100A9 TGGGCTTACACTGCTCTTACC GGTTATGCTGCGCTCCATCT

Western blot, ELISA, and Protein Array

Mouse corneal samples were lysed with RIPA buffer. The lysates were centrifuged to obtain supernatant. Protein concentration was determined by BCA assay. For Western blot analysis, the protein samples were separated by SDS-PAGE and electrically transferred onto nitrocellulose membranes (Bio-Rad Laboratories, Hercules, CA). The membranes were blocked with 5% milk and subsequently incubated with primary and secondary antibodies. Signals were visualized using SuperSignal West Pico chemiluminescent substrate (Thermo Scientific, Pittsburgh, PA). β-actin was used as the loading control. Quantification of protein levels was based on the densitometry of blots by using the software Carestream MI SE (Informer Technologies, Rochester, NY). The antibodies used included: anti-IL-23, anti-IL-23R, anti-IL-17A, anti-IL-17RC, anti-MCPIP-1, anti-Osteoprotegerin (R&D), and anti-β-actin (A1978; Sigma-Aldrich). Enzyme-linked immunosorbent assay (IL-23; R&D) and protein array (Proteome Profiler Array Mouse XL Cytokine Array Kit; R&D) were performed following manufacturer’s protocols.

Immunohistochemistry

At the indicated time points, the corneas were enucleated, embedded in Tissue-Tek OCT compound, and frozen in liquid nitrogen. 6-μm thick sections were cut and mounted to poly-L-lysine-coated glass slides, fixed in 4% paraformaldehyde, blocked with PBS containing 2% BSA for 1 h at room temperature. Sections were then incubated with primary Abs: rat anti-mouse NIMP-R14 (1:50; BD), followed by the secondary Ab, FITC-conjugated goat anti- rabbit IgG (1:100; Jackson ImmunoResearch Laboratories). Slides were mounted with Vectasheild mounting media containing DAPI. Controls were similarly treated with corresponding IgG from the same animal as the primary antibody.

Flow cytometry analysis

Whole corneas were digested in 20 μl Liberase TL (2.5 mg/ml; Sigma-Aldrich), followed by incubation at 37°C for 45 minutes. Cell suspensions were passed through a 70 μm filter. Viable cells were then counted using trypan blue dye exclusion. Cells were incubated at 4°C in PBS containing 2% FBS and Fc. The cells were subsequently labeled with PerCP-Cy5-conjugated CD45, FITC-conjugated Ly6G, APC-conjugated IL17RA, or APC-conjugated IL17RC (eBioscience) for 30 minutes in 2% FBS at 4°C in the dark. All samples were washed and reconstituted in PBS. Flow cytometry was performed with a FACS system (BD FACSAria II), and the data were analyzed using FlowJo software.

Statistical analysis

A nonparametric Mann-Whitney U test was used to compare the clinical scores. A paired t-test or one-way ANOVA was used to compare quantitative means. A p value < 0.05 was considered to be significant.

Results

PA infection increases IL-23/17-axis signaling in B6 mouse cornea

To understand the role of the IL-23/17 signaling axis, we first investigated the expression of the IL-23/17 signaling axis in B6 mouse corneas in response to PA infection (Fig. 1). At the mRNA levels, IL-23 and its receptor IL-23R, IL-17A and its receptor IL-17RA, IL17RC, were significantly increased in mouse corneas at 1-day post-infection (dpi) relative to naive corneas, as shown by RT-PCR (Fig. 1A). At the protein level, Western-blot analysis showed that at 1dpi, there was an increased expression of IL-23, IL-17A and their receptors IL-23R, IL-17RC (Fig. 1B) in the infected corneas. The time course study of IL-23 expression was performed and shown in suppl Fig. 1 and the expression of IL-17RA and RC in isolated CECs of naïve corneas in suppl Fig. 2.

Figure 1. PA infection increases IL23/17-axis signaling in B6 mouse cornea.

Figure 1.

(A) Mouse corneas were scratched with a needle and inoculated with 1.0 × 104 CFU PA. Whole corneas were collected at 1dpi for quantitative real-time PCR or semiquantitative RT-PCR analysis of IL-23, IL-17A, IL-17RA, IL-17RC. (N=3) (B) Western-blot analysis of IL-23, IL-23R, IL-17A, IL17-RC in cell lysates of whole corneas infected with PA at 1dpi. β-actin serves as the loading control. The results are presented as a relative increase (fold) to those of naive corneas, set as 1. Data are representative of three independent experiments (A, mean ± SEM). *p<0.05, **p<0.01, ***p<0.001 (One-way ANOVA). (C) The corneas were excised and processed for immunohistochemistry analysis at 1dpi. The 6μm cryostat sections were stained with anti-IL17RA (green), anti-IL23R (green), and DAPI (blue) for nuclei. Two independent experiments were performed; 1 representative image for each condition is presented. E, epithelium; S, stroma. PA, P. aeruginosa. (D) Flow cytometric analyses of IL-17RA and IL-17RC positive immune cells in naïve and infected (Inf) corneas. 10 corneas were pooled for each sample. Percentage of IL17RA, IL17RC and Ly6G positive cells are shown in the flow cytometric plots.

Tissue distribution of IL-23 and 17 receptors were assessed using immunohistochemistry. In PA-infected corneas, numerous IL-23R-positive and IL-17RA-positive cells were seen in the corneal stroma (Fig. 1C).Western-blot shows mouse corneal epithelium also express IL-17RA and IL-17RC. As most cells in the stroma of 1 dpi corneas were IL-17R positive, we used flow cytometry to determine if neutrophils, the most popular infiltrated cells at early stage of infection, express IL-17RA and IL-17RC (Fig. 1D). Our data showed that in PA infected corneas, 70.6% Ly6G positive cells were IL-17RA positive and 75.6% were IL-17RC positive, consistent with that reported for Aspergillus-induced keratitis (41). Taken together, components of the IL-23/17 signaling pathway were up-regulated in PA infected mouse corneas.

Blockade of IL-17A receptors improves the outcome of PA keratitis in mouse cornea

Having identified the increased expression of IL-17A receptors IL-17RA and IL-17RC during PA infection in mouse corneas, we next investigated the effect of IL-17A receptor signaling in the pathogenesis of PA keratitis (Fig. 2). IL-17RA and IL-17RC are heteromeric receptor complex components for IL-17A. While IL-17RC determines the specificity of IL-17A, IL-17RA is the shared receptor for IL-17 cytokines. As shown in Figure 2, treating the corneas with IL-17RA- or IL-17RC-neutralizing antibodies resulted in a significant decrease in the severity of P. aeruginosa keratitis, including markedly reduced clinical scores, significantly dampened bacterial burden, and notably decreased MPO activities. Hence, both IL-17RA and IL-17RC participate in the pathogenesis of PA keratitis in B6 mouse corneas.

Figure 2. IL-17RA, IL-17RC neutralizing antibodies decrease the severity of PA infection in B6 mouse cornea.

Figure 2.

Mice were subconjunctivally injected with IL-17RA (400ng/5μl), IL-17RC (400ng/5μl) neutralizing antibody 4h before the inoculation with 1.0 × 104 CFU PA. Mouse IgG serves as control. (A) Mouse corneas were monitored and photographed (original magnification × 10) at 1dpi. The numbers within each eye micrograph are the clinical scores assigned and presented as median plus interquartile range. (B &C) At 1 dpi, the corneas were excised and subjected to bacterial plate counting (CFU per cornea) and MPO unit determination. Data are representative of three independent experiments with five corneas per group (mean ± SEM). (N=5) *p<0.05, **p<0.01 (paired t-test).

IL-17A promotes PA keratitis in B6 mouse cornea

Having shown no detectable differences between blocking IL-17ARA and RC at I dpi, we next investigated the effects of IL-17A activity in PA keratitis using two complementary approaches: application of IL-17A-neutralizing antibody or application of exogenous mouse IL-17A prior to PA inoculation. Neutralizing antibody was subconjunctivally injected 4 h before PA inoculation. Blockade of IL-17A resulted in much-reduced severity of PA keratitis, compared to those eyes injected with control IgG (Fig. 3). The clinical scores assigned to anti-IL-17A mice were significantly lower than those of control IgG group with lowered bacterial burden and MPO activity (Fig. 3 B & C).

Figure 3. IL-17A neutralizing antibody and rmIL-17 have opposing effects on the outcome of PA infection in B6 mouse corneas.

Figure 3.

Mice were subconjunctivally injected with IL-17A neutralizing antibody (250ng/5μl) or recombinant mouse IL-17A (200ng/5μl in 0.1% BSA) 4h before the inoculation with 1.0 × 104 CFU PA. Mouse IgG or 0.1% BSA serves as control. (A&D) Mouse corneas were monitored and photographed (original magnification × 10) at 1dpi. The numbers within each eye micrograph are the clinical scores assigned and presented as median plus interquartile range. (B&E&C&F) At 1 dpi, the corneas were excised and subjected to bacterial plate counting (CFU per cornea) and MPO unit determination. Data are representative of three independent experiments with five corneas per group (B, C, mean ± SEM). (N=5) *p<0.05, **p<0.01 (paired t-test). (G) Mouse corneas were treated with anti-IL17 antibody, or rmIL-17A and inoculated with P. aeruginosa, Naïve corneas were used as negative Control. The corneas were excised and processed for immunohistochemistry analysis at 1dpi. The 6μm cryostat sections were stained with NIMP-R14 antibody for neutrophils. The images of neutrophils (green) were merged with DAPI (blue nuclei) staining. Two independent experiments were performed; 1 representative image for each condition is presented. E, epithelium; S, stroma. NL, naive cornea.

We next administrated recombinant mouse (rm)-IL-17A prior to PA inoculation. In contrast to blockade of IL-17A, the presence of exogenous IL-17A markedly increased the susceptibility of mouse corneas to PA infection, with higher clinical scores (Fig. 3 D), bacterial burden, and MPO activity compared with the BSA control group (Fig. 3 D & F).

Immunofluorescence analysis revealed the role of IL-17A in the neutrophil recruitment in PA-infected corneas (Fig. 3 G). No neutrophil staining can be detected in the naive corneas. Numerous Ly6G-positive cells were observed in corneal stroma in PA-infected corneas, consistent with the increased MPO activity. In contrast to IL-17A-blockade which decreased the number of infiltrated neutrophils, exogenous rm-IL-17A greatly increased the number of infiltrated neutrophils in the cornea, with epithelium edema and heavy stromal infiltration. Hence, blockade of IL-17A decreased and presence of rmIL-17A increased the severity of PA-keratitis in B6 mouse corneas.

Blockade of IL-17A altered gene expression in response to PA infection in B6 mouse corneas

We next used IL-17A-neutralizing antibodies and real-time PCR to assess the effects of IL-17A on the expression of several innate immune responsive genes which were shown to be associated with the pathogenesis of PA keratitis (Fig. 4). At 6 hpi, IL-17A blockade dampened expression of CXCL-1, IL-24 and MMP13, and increased expression of the anti-inflammatory gene IL-10, IL-1Ra in response to PA infection in B6 mouse corneas (Fig. 4 A). Importantly, both S100A8 and A9 were highly induced in CECs in response to PA in an IL-17A-independent manner.

Figure 4. Blockade of IL-17A alteres gene expression in B6 mouse corneas in response to PA infection.

Figure 4.

Mouse corneas were treated with anti-IL17A antibody or control IgG and inoculated with 1.0 × 104 CFU PA. Corneal epithelial cells were collected at 6 hpi and analyzed by real-time PCR. The results are presented as a relative increase (fold) to those of naive corneas, set as 1. Data are representative of three independent experiments with three corneas per group (mean ± SEM). (N=3) *p<0.05, **p<0.01 (One-way ANOVA).

IL-17A promotes PA keratitis in mouse cornea in part by regulating Osteoprotegerin expression

To further explore the underlying mechanism of IL-17 signaling in PA keratitis, we assessed the effects of IL-17A on the expression of cytokines, chemokines, and growth factors using the XL mouse cytokine array. Among 111 genes, osteoprotegerin (OPG) protein levels were undetectable in naïve corneas and became abundant in PA-infected corneas (suppl Fig. 3). IL-17A-neutralization suppressed, while rm-IL-17A augmented the infection-induced expression of OPG at 1dpi (Fig. 5 A). To confirm the cytokine array results, qRT-PCR and Western blot was performed. qRT-PCR revealed that OPG transcripts were significantly increased in the PA-infected cornea relative to naive corneas; a significant suppression of OPG transcription was observed in Anti-IL-17A-treated corneas while augmented OPG expression was observed in rm-IL-17A treated corneas (Fig. 5 B). Western blot analysis showed a similar pattern of OPG expression at the protein levels in PA-infected corneas with different IL-17A activities (Fig. 5 C). Tissue distribution of OPG was also assessed. No staining was detected in naive corneas whereas strong staining of OPG was observed in the stroma in PA -infected corneas with minimal staining in the epithelium (Fig. 5 D).

Figure 5. IL-17A regulated OPG expression in B6 mouse corneas in response to PA infection.

Figure 5.

Mouse Corneas were treated with anti-IL17A antibody or rmIL-17A and inoculated with 1.0 × 104 CFU PA. Whole corneas were collected at 1dpi. (A) Protein array analysis revealed the effect of IL-17A on cytokine expression. Selected images for Osteoprotegerin was shown. (B) q-PCR analysis of Osteoprotegerin in whole corneas infected with P. aeruginosa at 1dpi. (N=3) (C) Western-blot analysis of Osteoprotegerin in cell lysate of whole corneas infected with P. aeruginosa at 1dpi. β-actin serves as the loading control. Data are representative of three independent experiments with three corneas per group (B, mean ± SEM). *p<0.05, **p<0.01 (One-way ANOVA). (D) The corneas were excised and processed for immunohistochemistry analysis at 1dpi. The 6μm cryostat corneal sections were stained with anti-Osteoprotegerin (green) and DAPI (blue) for nuclei. Two independent experiments were performed; 1 representative image for each condition is presented. E, epithelium; S, stroma. OPG, Osteoprotegerin.

OPG regulates IL-17A, but not S100A8/9, expression in PA -infected corneas

We next assessed the function of OPG in the pathogenesis of PA keratitis. Blockade of OPG by neutralizing antibody resulted in a decrease in the severity of keratitis, including lower clinical scores, dampened bacterial burden, and reduced influx of neutrophils as indicated by MPO activity, when compared to those eyes injected with control IgG (Fig. 6). qRTPCR analysis revealed that OPG neutralization significantly decreased the levels of IL-17A transcripts, but exhibited no effects on the expression of the antimicrobial peptides S100A8, S100A9 in PA-infected corneas (Fig. 6 D).

Figure 6. Blockade of OPG attenuates the severity of PA infection in B6 mouse cornea.

Figure 6.

Mice were subconjunctivally injected with Osteoprotegerin neutralizing antibody (200ng/5μl) 4h before the inoculation with 1.0 × 104 CFU PA. Mouse IgG serves as control. (N=5) (A) Mouse corneas were monitored and photographed (original magnification×10) at 1dpi. The numbers within each eye micrograph are the clinical scores assigned and presented as median plus interquartile range. (B&C) At 1 dpi, the corneas were excised and subjected to bacterial plate counting (CFU per cornea) and MPO unit determination. (D) Whole corneas were collected at 1dpi. q-PCR analysis of Anti-OPG in whole corneas infected with PA at 1dpi. Data are representative of three independent experiments with three corneas per group (B, C, D mean ± SEM). (N=3) *p<0.05, **p<0.01 (One-way ANOVA).

Upregulation of OPG is partially responsible for IL-17A-exacerbated PA keratitis

To further identify the role of OPG in the IL-17/17R pathway in PA keratitis, we subconjunctivally injected rm-IL-17A and OPG-neutralizing antibodies simultaneously. Neutralization of OPG significantly dampened the severity of PA keratitis, including a partially decreased clinical score, bacterial burden, and MPO activity compared with rmIL-17A-only-treated PA keratitis infection as the control (Fig 7). Hence, PA-induced, IL-17-dependent upregulation of OPG is partially responsible for the observation that IL-17A exacerbates PA keratitis in B6 mouse corneas.

Figure 7. OPG upregulation is partially responsible for IL-17-worsened outcome of PA keratitis in B6 mice.

Figure 7.

Mouse corneas were treated with rmIL-17A or rmIL-17A+Anti-OPG antibody and inoculated with 1.0 × 104 CFU PA, 0.1% BSA serves as control. (A) Mouse corneas were monitored and photographed (original magnification×10) at 1dpi. The numbers within each eye micrograph are the clinical scores assigned and presented as median plus interquartile range. (B&C) At 1 dpi, the corneas were excised and subjected to bacterial plate counting (CFU per cornea) and MPO unit determination. Data are representative of three independent experiments with five corneas per group (B, C, mean ± SEM). (N=5) *p<0.05, **p<0.01 (One-way ANOVA).

Blockade of either IL-17A or OPG resulted in continuously attenuated inflammation in B6 mouse cornea in response to PA infection

To further investigate the long-term effects of IL-17A and OPG blockade, we subconjunctivally injected either IL-17A or OPG neutralizing antibodies 4 hours prior to inoculation, and allowed the infection to continue until the 3 dpi at which time the control corneas had high clinical scores and were near to corneal perforation, hence, experiments were terminated at 3 dpi. We found that at this time point, the expression of all cytokines assessed were induced and significantly her that that in the naïve corneas. The mRNA levels of TH17 (IL-23) and IL17A) and TH1 (IFN-γ, IL-2, and TNF-α), as well as IL-6 cytokines were significantly lower in IL-17 and OPG blockaded compared to infected control corneas, with no significant differences between two treated groups; the lower levels of these cytokines may reflect the decreased severity of keratitis. On the other hand, TH2 cytokines (IL-4, IL-5) as well as IL-10 (a Treg cytokine) were significantly higher in IL-17A, but not OPG neutralizing antibody-treated, compared to the infection control corneas. The levels of another Treg cytokine, TGFβ, were similar in all three infected corneas. As for inflammation, blockades of IL-17A and OPG greatly decreased IL-1β and significantly increased IL-1Ra expression, consistent with decreased keratitis severity of these treated corneas.

Adjunct topical IL17A neutralizing antibody improved the outcome of keratitis in antibiotic-treated corneas post PA infection

To explore the potential clinical application of anti-IL-17A treatment as an adjunctive therapy, we topically applied ciprofloxacin concurrently with IL-17A neutralizing antibody, starting at 16 hpi by which time our previous study showed that the invading pathogens are mostly in the epithelium layer (42). The eyes treated with anti-IL17A Ab significantly improved the outcome of PA keratitis (Fig.10). The clinical score in anti-IL17 group was significantly decreased from day 1 to day 3 post treatment compared with ciprofloxacin control group. Consistent with reduced corneal opacification, additional topical anti-IL17A also significantly reduced PMN infiltration. Hence, topical anti-IL17 treatment has potential as an adjunct therapy to antibody for treating PA keratitis.

Figure 10. Concurrent topical application of IL-17A neutralizing antibody and ciprofloxacin eradicates PA-infection associated inflammation in B6 mice.

Figure 10.

C57BL/6 mouse corneas were inoculated with 1.0 × 104 CFU PA. Topical solution containing ciprofloxacin (Cip) was used to dissolve IL-17A neutralizing antibody. Topical antibiotic with or without anti-IL17A Ab was then applied, starting 16 hours after infection, at 2-hour intervals during the first and second days of treatment and at 4-hour intervals on the third day of treatment. The infected corneas were (A) photographed and (B) scored, and (C) myeloperoxidase (MPO) activity assay was performed at the end of experiment. The results are representative of 3 independent experiments. Data are representative of three independent experiments with five corneas per group (B, C, mean ± SEM). (N=5) *p<0.05, **p<0.01 (paired t-test).

Discussion

In this study, we investigated the role of IL-17A and its receptor IL-17RA/IL-17RC in PA keratitis in B6 mouse corneas. We identified that the IL-23/23R- 17/17R signaling pathway is upregulated in the cornea in response to PA infection. Functionally, blockade of IL-17A or its receptor IL-17RA, IL-17RC resulted in decreased severity of PA keratitis, decreased bacterial burden, and inhibited the infection-induced inflammation in B6 mouse cornea. While addition of exogenous IL-17A exacerbated PA keratitis, its blockade dampened the expression of pro-inflammatory cytokines/chemokines, and suppressed PMN infiltration. We also found that IL-17A induced OPG expression in PA-infected corneas, and neutralization of OPG attenuated PA keratitis. The latter also influences IL-17A expression. IL-17, but not OPG, suppresses TH2 immune response while both promote inflammatory response as assessed by IL-1β/IL-1Ra expression. Finally, concurrent topical application of IL-17A neutralizing antibody and ciprofloxacin eradicated PA infection-associated inflammation and corneal opacification in B6 mice. Taken together, these results suggest that IL-17/17R signaling plays a pathological role in PA keratitis, including the induction of pro-inflammatory cytokine/chemokine and OPG expression and the suppression of TH2 response.

IL-23 is a heterodimer belonging to the IL-12 family. It is composed of two subunits, IL-23p19 and IL-12p40, and the latter is a common subunit shared with IL-12(43). IL-23 is an important mediator of tissue inflammation (44). Upon infection, IL-23 is rapidly produced by activated macrophages and/or dendritic cells (DCs) at the infected site, and DCs are the main source of IL-23 (45). IL-23 produced by residential DCs is likely to be an initial step in the inflammatory cascade that drives the local expression of pro-inflammatory mediators such as IL-17 and infiltration of innate defense cells such as neutrophils, NK cells and innate lymphoid cells, most of which are capable of secreting IL-17A as well as IL-22 (25, 46). Our results showed that at 1dpi, there are an increased expression of IL-23/17 axis signaling molecules including IL-23, IL-23R, IL-17A and IL-17RA and RC, and infiltrated neutrophils which are both IL-17RA and RC positive in PA-infected corneas, confirming a previous report showing that neutrophils in Aspergillus-induced keratitis express both IL-17RA and RC (41). These expression and distribution data suggest the involvement of the IL-23/IL-17 axis in corneal innate defense and the pathogenesis of PA keratitis.

An early study showed that topical treatment with polyclonal antibodies to IL-17 resulted in significant reductions in corneal pathology and lowered bacterial counts after infection with six different laboratory or clinical PA strains, including both invasive and cytotoxic strains and ICAM1 was suggested as a downstream molecule (47). In the airway mucosa, IL-17A promotes inflammation and impairs host defenses in acute and chronic Pseudomonas lung infection (48, 49). In biofilm bacteria-infected patients, the IL-17 levels in the lavage fluids were significantly higher than that in non-biofilm bacteria-infected patients; the elevated IL-17 was attributed to chronic injuries caused by biofilm infections (50). The effects of IL-17 on PA biofilm formation are unknown. Our study used complimentary appraochs, targeting IL-17A, IL-17RA and RC indivisually in and applying recombinant IL-17A to PA-infected corneas. Our results show that neutralizing IL-17A, IL17RA, or IL17RC all significantly reduced, while exogenous recombinant IL-17 increased bacterial burden, inflammation, including elevated expression of inflammatory cytokines and neutrophil influx and/or accumulation, associated with PA-infection of corneas, suggesting that IL-17 plays a pathological role in PA keratitis by augmenting the infection-induced inflammation.

How might IL-17A drive corneal inflammatory response to PA infection in the cornea? It is likely to act in the context of the tissue microenvironment and with multiple inflammatory mediators. As such, we assessed the effects of IL-17A on the expression of genes known to be involved in the corneal innate defense against microbial infection. Corneal infection occurs when epithelial barrier function is compromised and opportunistic pathogens such as PA invade the epithelium, which functions as the first line of innate immune defense. To that end, we assessed the epithelium expression of cytokines and found that downregulating IL-17A signaling inhibited expression of pathogenic factors CXCL1, IL-24, and MMP13 and elevated expression of anti-inflammatory cytokine IL-10 in PA-infected corneas at 6 hpi. CXCL1 is a major neutrophil recruitment chemokine and a downstream gene of IL-17 (51) while IL-10 is an anti-inflammatory cytokine that counteracts LPS in inducing CXCL1 expression (52). Our previous study showed that IL-24 and its downstream effector SOCS-3 were induced in the corneal epithelium during PA infection and they were detrimental as the early expression of SOCS3 may hinder the development of the innate defense apparatus including inflammation response, resulting in an elevated severity of keratitis (53). We previously showed that MMP-13 is a pathogenic factor that is hijacked by PA to dissolve the protective structures of the cornea, hence allowing PA to cross the basement membrane, causing stromal keratitis (54). Suppression of IL-17 activity inhibited the expression of MMP-13, restricting invading PA to the epithelium, where many antimicrobial cytokines including calprotectin (dimer of S100A8/A9) are expressed. Interestingly, IL-17 signaling appears has no effects on S100A8/A9 expression. Hence, we conclude that IL-17 blockade dampened the expression of pro-inflammatory cytokines (IL-24, CXCL-1, MMP-13), and increased the expression of anti-inflammatory genes (IL-10) to promote the resolution of infection-associated inflammation in B6 mouse cornea.

To further explore the mechanisms underlying IL-17A’s influence on PA infection of the cornea, we used a cytokine protein array and observed and confirmed that the levels of OPG at both transcriptional and translational levels were most dramatically elevated in the mouse cornea in response to PA infection with IL-17 neutralizing suppressing and exogenous IL-17 promoting its expression. Functional study revealed that OPG neutralization attenuated the severity of PA keratitis. OPG encoded by Tnfrsf11b is a decoy receptor of RANK, and RANKL/OPG signaling modulates osteoclast function in bone remodeling (55, 56). It was shown that IL-17 disrupts the RANKL/OPG balance in the synovium and promotes bone erosion in murine collagen arthritis (57). In the cornea, OPG is expressed in fibroblasts and was shown to participate in corneal wound healing (54). Macrophages and neutrophils are known to be the source of OPG (58, 59). Our immunofluorescence analysis also revealed its distribution in the stromal infiltrating cells during PA infection. This is the first report to link OPG expression to corneal infection and IL-17 signaling and to show a detrimental role of the gene in the pathogenesis of PA keratitis. Interestingly, neutralizing OPG partially down-regulated IL-17A expression, suggesting a positive feedback loop of IL-17A and OPG expression. Moreover, while IL-17A suppresses TH2 type response, OPG exhibited no such effects in PA infected corneas. Like IL-17A, OPG neutralization exhibited no effects on the expression of S100A8/A9, suggesting OPG may target other aspects of innate defense, such as apoptosis of infected cells. Indeed, in addition to binding RANKL, OPG also binds to and inhibits TRAIL (tumor necrosis factor-related apoptosis-inducing ligand). TRAIL is known to help to defend against microbial infections by inducing apoptosis of infected cells (60). It is plausible that OPG enhances the infection-induced inflammation by increasing IL-17A expression and inhibiting apoptosis of infected cells, resulting in increased pathology in PA keratitis. The link between IL-23 and IL-17 and involvement of OPG-RANK-RANKL and/or OPG-TRAIL pathways in PA keratitis warrant further investigation.

Our data generated using qRT-PCR revealed that IL-17, but not OPG, suppresses TH2 response in PA infected corneas at 3 dpi by which the adaptive immunity has begun to develop in the infected corneas. By comparing mice favoring Th1 (C57BL/6) versus Th2 (BALB/c) response development, mice strains favoring development of a Th1-type response are susceptible (cornea perforates) whereas strains favoring Th2 response development are resistant or protective (no corneal perforation) (61). On the other hand, in murine models of fungal keratitis, protective immunity was associated with temporal recruitment of IL-17-producing neutrophils, Th17 and Th1 cells and dependent on production of IL-17 but not IFN-gamma (62). We showed that neutralizing IL-17 increased TH2 response, resulting in a decrease in the severity of PA keratitis. Furthermore, we showed that targeting IL-17 and OPG augments IL-1RA expression while suppresses the expression of IL-1β, suggesting IL-17 and OPG skews the innate immune apparatus to a pro-inflammatory status. The effects of IL-17A on TH2-type immune response and on the balance expression of IL-1β and soluble IL-1Ra may be the underlying mechanisms for IL-17/IL-17R to play a detrimental role in PA keratitis.

Finally, we tested therapeutic potential of IL-17 neutralization on tempering down inflammation while the corneas were treated by topically antibiotics. Our previous studied showed that treating PA infected corneas with the fourth generation antibiotics ciprofloxacin within 16–24 h will resulted in eradication of invading pathogen while inflammation or corneal opacification remain 3 days after antibody treatment (also see Fig. 10). Our data showed that concurrently treating the infected corneas with ciprofloxacin and IL-17A neutralizing antibody reduced corneal inflammation associated with PA infection as assessed by clinical scores and MPO determination. We conclude that IL-17 neutralization, such as the use of Bimekizumab, which has been shown to be 100% response with 86.7% vs 0% improvement in Psoriasis Area and Severity Index criteria, sustained to week 20 without unexpected safety signals (63), may be safely used as topical adjunctive reagent to treat microbial keratitis.

Taken together, our study demonstrates that an increase in IL-23/17A/17R axis signaling may worsen PA keratitis in B6 mouse corneas. IL-17A functions in the pathogenesis of PA keratitis in part via induction of OPG. Additionally, IL-17A and/or OPG could be a potential therapeutic target for treating PA keratitis.

Supplementary Material

1

Figure 8. Blockade of either IL-17A or OPG attenuates the severity of PA keratitis in B6 mouse cornea at 3 dpi.

Figure 8.

Mice were subconjunctivally injected with either IL-17A neutralizing or OPG neutralizing antibody 4h before the inoculation with 1.0 × 104 CFU PA. Mouse IgG serves as control. (A) Mouse corneas were monitored and photographed (original magnification×10) at 3 dpi. The numbers within each eye micrograph are the clinical scores assigned and presented as median plus interquartile range. (B&C) At 3 dpi, the corneas were excised and subjected to bacterial plate counting (CFU per cornea) and MPO unit determination. (N=5) *p<0.05, **p<0.01 (One-way ANOVA).

Figure 9. Blockade of IL-17A, but not OPG, promotes Th2 response to PA infection in B6 mice.

Figure 9.

Subconjunctivally injected with either IL-17A neutralizing or OPG neutralizing antibody 4h before the inoculation with 1.0 × 104 CFU PA. Whole corneas were collected at 3dpi, q-PCR analysis of (A) IL23/17 signaling cascade and (B) the expressions of Th1, Th2, Th17, Treg, and other cytokines were performed. Data are representative of three independent experiments with three corneas per group (mean ± SEM). (N=3) *p<0.05, **p<0.01 (One-way ANOVA).

Key points.

IL-23/17/17R signaling is upregulated in PA keratitis.

IL-17 suppresses TH2 response and upregulates Osteoprotegerin, worsens keratitis.

IL-17 could be a therapeutic target for treating PA keratitis.

Acknowledgement

The authors declare that there is no duality of interest associated with this manuscript.

The authors declare that there is no conflict of interest associated with this manuscript. We acknowledge support from NIH/NEI R01EY10869, EY17960 (to FSY), p30 EY04078 (NEI core to WSU), Research to Prevent Blindness (to Kresge Eye Institute). The information has previously been presented at the Annual Meeting of the Association for Research in Vision and Ophthalmology (May 2013, #1728)

References

  • 1.Al-Mujaini A, Al-Kharusi N, Thakral A, and Wali UK. 2009. Bacterial keratitis: perspective on epidemiology, clinico-pathogenesis, diagnosis and treatment. Sultan Qaboos Univ Med J 9: 184–195. [PMC free article] [PubMed] [Google Scholar]
  • 2.Cheng KH, Leung SL, Hoekman HW, Beekhuis WH, Mulder PG, Geerards AJ, and Kijlstra A. 1999. Incidence of contact-lens-associated microbial keratitis and its related morbidity. Lancet 354: 181–185. [DOI] [PubMed] [Google Scholar]
  • 3.Stapleton F, and Carnt N. 2012. Contact lens-related microbial keratitis: how have epidemiology and genetics helped us with pathogenesis and prophylaxis. Eye (Lond) 26: 185–193. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Slusher MM, Myrvik QN, Lewis JC, and Gristina AG. 1987. Extended-wear lenses, biofilm, and bacterial adhesion. Arch Ophthalmol 105: 110–115. [DOI] [PubMed] [Google Scholar]
  • 5.Konda N, Motukupally SR, Garg P, Sharma S, Ali MH, and Willcox MD. 2014. Microbial analyses of contact lens-associated microbial keratitis. Optom Vis Sci 91: 47–53. [DOI] [PubMed] [Google Scholar]
  • 6.Guembel HO, and Ohrloff C. 1997. Opportunistic infections of the eye in immunocompromised patients. Ophthalmologica 211 Suppl 1: 53–61. [DOI] [PubMed] [Google Scholar]
  • 7.Janeway CA Jr., and Medzhitov R. 2002. Innate immune recognition. Annu Rev Immunol 20: 197–216. [DOI] [PubMed] [Google Scholar]
  • 8.Sadikot RT, Blackwell TS, Christman JW, and Prince AS. 2005. Pathogen-host interactions in Pseudomonas aeruginosa pneumonia. Am J Respir Crit Care Med 171: 1209–1223. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Barbieri JT, and Sun J. 2004. Pseudomonas aeruginosa ExoS and ExoT. Rev Physiol Biochem Pharmacol 152: 79–92. [DOI] [PubMed] [Google Scholar]
  • 10.Hyndiuk RA 1981. Experimental Pseudomonas keratitis. Trans Am Ophthalmol Soc 79: 541–624. [PMC free article] [PubMed] [Google Scholar]
  • 11.Kumar A, Gao N, Standiford TJ, Gallo RL, and Yu FS. 2010. Topical flagellin protects the injured corneas from Pseudomonas aeruginosa infection. Microbes Infect 12: 978–989. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Yu FS, Cornicelli MD, Kovach MA, Newstead MW, Zeng X, Kumar A, Gao N, Yoon SG, Gallo RL, and Standiford TJ. 2010. Flagellin stimulates protective lung mucosal immunity: role of cathelicidin-related antimicrobial peptide. J Immunol 185: 1142–1149. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Strieter RM, Standiford TJ, Huffnagle GB, Colletti LM, Lukacs NW, and Kunkel SL. 1996. “The good, the bad, and the ugly.” The role of chemokines in models of human disease. J Immunol 156: 3583–3586. [PubMed] [Google Scholar]
  • 14.Hazlett LD 2004. Corneal response to Pseudomonas aeruginosa infection. Prog Retin Eye Res 23: 1–30. [DOI] [PubMed] [Google Scholar]
  • 15.Weiss SJ 1989. Tissue destruction by neutrophils. N Engl J Med 320: 365–376. [DOI] [PubMed] [Google Scholar]
  • 16.Smith JA 1994. Neutrophils, host defense, and inflammation: a double-edged sword. J Leukoc Biol 56: 672–686. [DOI] [PubMed] [Google Scholar]
  • 17.Thakur A, Barrett RP, Hobden JA, and Hazlett LD. 2004. Caspase-1 inhibitor reduces severity of pseudomonas aeruginosa keratitis in mice. Invest Ophthalmol Vis Sci 45: 3177–3184. [DOI] [PubMed] [Google Scholar]
  • 18.Rudner XL, Kernacki KA, Barrett RP, and Hazlett LD. 2000. Prolonged elevation of IL-1 in Pseudomonas aeruginosa ocular infection regulates macrophage-inflammatory protein-2 production, polymorphonuclear neutrophil persistence, and corneal perforation. J Immunol 164: 6576–6582. [DOI] [PubMed] [Google Scholar]
  • 19.Wonnenberg B, Bischoff M, Beisswenger C, Dinh T, Bals R, Singh B, and Tschernig T. 2016. The role of IL-1beta in Pseudomonas aeruginosa in lung infection. Cell Tissue Res 364: 225–229. [DOI] [PubMed] [Google Scholar]
  • 20.Gao N, Me R, Dai C, Seyoum B, and Yu FX. 2018. Opposing Effects of IL-1Ra and IL-36Ra on Innate Immune Response to Pseudomonas aeruginosa Infection in C57BL/6 Mouse Corneas. J Immunol 201: 688–699. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Gaffen SL, Jain R, Garg AV, and Cua DJ. 2014. The IL-23-IL-17 immune axis: from mechanisms to therapeutic testing. Nat Rev Immunol 14: 585–600. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Jin W, and Dong C. 2013. IL-17 cytokines in immunity and inflammation. Emerg Microbes Infect 2: e60. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Iwakura Y, Ishigame H, Saijo S, and Nakae S. 2011. Functional specialization of interleukin-17 family members. Immunity 34: 149–162. [DOI] [PubMed] [Google Scholar]
  • 24.Chang SH, and Dong C. 2011. Signaling of interleukin-17 family cytokines in immunity and inflammation. Cell Signal 23: 1069–1075. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Cua DJ, and Tato CM. 2010. Innate IL-17-producing cells: the sentinels of the immune system. Nat Rev Immunol 10: 479–489. [DOI] [PubMed] [Google Scholar]
  • 26.Gu C, Wu L, and Li X. 2013. IL-17 family: cytokines, receptors and signaling. Cytokine 64: 477–485. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Zepp JA, Liu C, Qian W, Wu L, Gulen MF, Kang Z, and Li X. 2012. Cutting edge: TNF receptor-associated factor 4 restricts IL-17-mediated pathology and signaling processes. J Immunol 189: 33–37. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Hartupee J, Liu C, Novotny M, Li X, and Hamilton T. 2007. IL-17 enhances chemokine gene expression through mRNA stabilization. J Immunol 179: 4135–4141. [DOI] [PubMed] [Google Scholar]
  • 29.Matsuzaki G, and Umemura M. 2018. Interleukin-17 family cytokines in protective immunity against infections: role of hematopoietic cell-derived and non-hematopoietic cell-derived interleukin-17s. Microbiol Immunol 62: 1–13. [DOI] [PubMed] [Google Scholar]
  • 30.Conti HR, and Gaffen SL. 2015. IL-17-Mediated Immunity to the Opportunistic Fungal Pathogen Candida albicans. J Immunol 195: 780–788. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Gladiator A, Wangler N, Trautwein-Weidner K, and LeibundGut-Landmann S. 2013. Cutting edge: IL-17-secreting innate lymphoid cells are essential for host defense against fungal infection. J Immunol 190: 521–525. [DOI] [PubMed] [Google Scholar]
  • 32.Huppler AR, Bishu S, and Gaffen SL. 2012. Mucocutaneous candidiasis: the IL-17 pathway and implications for targeted immunotherapy. Arthritis Res Ther 14: 217. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Happel KI, Zheng M, Young E, Quinton LJ, Lockhart E, Ramsay AJ, Shellito JE, Schurr JR, Bagby GJ, Nelson S, and Kolls JK. 2003. Cutting edge: roles of Toll-like receptor 4 and IL-23 in IL-17 expression in response to Klebsiella pneumoniae infection. J Immunol 170: 4432–4436. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Ye P, Garvey PB, Zhang P, Nelson S, Bagby G, Summer WR, Schwarzenberger P, Shellito JE, and Kolls JK. 2001. Interleukin-17 and lung host defense against Klebsiella pneumoniae infection. Am J Respir Cell Mol Biol 25: 335–340. [DOI] [PubMed] [Google Scholar]
  • 35.Amatya N, Garg AV, and Gaffen SL. 2017. IL-17 Signaling: The Yin and the Yang. Trends Immunol 38: 310–322. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Gurczynski SJ, and Moore BB. 2018. IL-17 in the lung: the good, the bad, and the ugly. Am J Physiol Lung Cell Mol Physiol 314: L6–L16. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Miossec P 2003. Interleukin-17 in rheumatoid arthritis: if T cells were to contribute to inflammation and destruction through synergy. Arthritis Rheum 48: 594–601. [DOI] [PubMed] [Google Scholar]
  • 38.Johansen C, Usher PA, Kjellerup RB, Lundsgaard D, Iversen L, and Kragballe K. 2009. Characterization of the interleukin-17 isoforms and receptors in lesional psoriatic skin. Br J Dermatol 160: 319–324. [DOI] [PubMed] [Google Scholar]
  • 39.Fujino S, Andoh A, Bamba S, Ogawa A, Hata K, Araki Y, Bamba T, and Fujiyama Y. 2003. Increased expression of interleukin 17 in inflammatory bowel disease. Gut 52: 65–70. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Wu TG, Wilhelmus KR, and Mitchell BM. 2003. Experimental keratomycosis in a mouse model. Invest Ophthalmol Vis Sci 44: 210–216. [DOI] [PubMed] [Google Scholar]
  • 41.Taylor PR, Roy S, Leal SM Jr., Sun Y, Howell SJ, Cobb BA, Li X, and Pearlman E. 2014. Activation of neutrophils by autocrine IL-17A-IL-17RC interactions during fungal infection is regulated by IL-6, IL-23, RORgammat and dectin-2. Nat Immunol 15: 143–151. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Gao N, Kumar A, and Yu FS. 2015. Matrix Metalloproteinase-13 as a Target for Suppressing Corneal Ulceration Caused by Pseudomonas aeruginosa Infection. J Infect Dis 212: 116–127. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Oppmann B, Lesley R, Blom B, Timans JC, Xu Y, Hunte B, Vega F, Yu N, Wang J, Singh K, Zonin F, Vaisberg E, Churakova T, Liu M, Gorman D, Wagner J, Zurawski S, Liu Y, Abrams JS, Moore KW, Rennick D, de Waal-Malefyt R, Hannum C, Bazan JF, and Kastelein RA. 2000. Novel p19 protein engages IL-12p40 to form a cytokine, IL-23, with biological activities similar as well as distinct from IL-12. Immunity 13: 715–725. [DOI] [PubMed] [Google Scholar]
  • 44.Uhlig HH, McKenzie BS, Hue S, Thompson C, Joyce-Shaikh B, Stepankova R, Robinson N, Buonocore S, Tlaskalova-Hogenova H, Cua DJ, and Powrie F. 2006. Differential activity of IL-12 and IL-23 in mucosal and systemic innate immune pathology. Immunity 25: 309–318. [DOI] [PubMed] [Google Scholar]
  • 45.Berndt BE, Zhang M, Owyang SY, Cole TS, Wang TW, Luther J, Veniaminova NA, Merchant JL, Chen CC, Huffnagle GB, and Kao JY. 2012. Butyrate increases IL-23 production by stimulated dendritic cells. Am J Physiol Gastrointest Liver Physiol 303: G1384–1392. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Li Y, Zhu L, Chu Z, Yang T, Sun HX, Yang F, Wang W, Hou Y, Wang P, Zhao Q, Tao Y, Zhang L, Zhang X, and Zhao Y. 2018. Characterization and biological significance of IL-23-induced neutrophil polarization. Cell Mol Immunol 15: 518–530. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Zaidi TS, Zaidi T, Pier GB, and Priebe GP. 2012. Topical neutralization of interleukin-17 during experimental Pseudomonas aeruginosa corneal infection promotes bacterial clearance and reduces pathology. Infect Immun 80: 3706–3712. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Wolf L, Sapich S, Honecker A, Jungnickel C, Seiler F, Bischoff M, Wonnenberg B, Herr C, Schneider-Daum N, Lehr CM, Bals R, and Beisswenger C. 2016. IL-17A-mediated expression of epithelial IL-17C promotes inflammation during acute Pseudomonas aeruginosa pneumonia. Am J Physiol Lung Cell Mol Physiol 311: L1015–L1022. [DOI] [PubMed] [Google Scholar]
  • 49.Lore NI, Cigana C, Riva C, De Fino I, Nonis A, Spagnuolo L, Sipione B, Cariani L, Girelli D, Rossi G, Basso V, Colombo C, Mondino A, and Bragonzi A. 2016. IL-17A impairs host tolerance during airway chronic infection by Pseudomonas aeruginosa. Sci Rep 6: 25937. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Wang GQ, Wang L, Zhang HL, Dong YQ, and Yang YX. 2015. Stimulation of bacterial biofilms on Th17 immune cells. Genet Mol Res 14: 7721–7726. [DOI] [PubMed] [Google Scholar]
  • 51.Eyerich K, Dimartino V, and Cavani A. 2017. IL-17 and IL-22 in immunity: Driving protection and pathology. Eur J Immunol 47: 607–614. [DOI] [PubMed] [Google Scholar]
  • 52.Conaway EA, de Oliveira DC, McInnis CM, Snapper SB, and Horwitz BH. 2017. Inhibition of Inflammatory Gene Transcription by IL-10 Is Associated with Rapid Suppression of Lipopolysaccharide-Induced Enhancer Activation. J Immunol 198: 2906–2915. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Ross BX, Gao N, Cui X, Standiford TJ, Xu J, and Yu FX. 2017. IL-24 Promotes Pseudomonas aeruginosa Keratitis in C57BL/6 Mouse Corneas. J Immunol 198: 3536–3547. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Wilson SE, Mohan RR, Netto M, Perez V, Possin D, Huang J, Kwon R, Alekseev A, and Rodriguez-Perez JP. 2004. RANK, RANKL, OPG, and M-CSF expression in stromal cells during corneal wound healing. Invest Ophthalmol Vis Sci 45: 2201–2211. [DOI] [PubMed] [Google Scholar]
  • 55.Simonet WS, Lacey DL, Dunstan CR, Kelley M, Chang MS, Luthy R, Nguyen HQ, Wooden S, Bennett L, Boone T, Shimamoto G, DeRose M, Elliott R, Colombero A, Tan HL, Trail G, Sullivan J, Davy E, Bucay N, Renshaw-Gegg L, Hughes TM, Hill D, Pattison W, Campbell P, Sander S, Van G, Tarpley J, Derby P, Lee R, and Boyle WJ. 1997. Osteoprotegerin: a novel secreted protein involved in the regulation of bone density. Cell 89: 309–319. [DOI] [PubMed] [Google Scholar]
  • 56.Yasuda H, Shima N, Nakagawa N, Mochizuki SI, Yano K, Fujise N, Sato Y, Goto M, Yamaguchi K, Kuriyama M, Kanno T, Murakami A, Tsuda E, Morinaga T, and Higashio K. 1998. Identity of osteoclastogenesis inhibitory factor (OCIF) and osteoprotegerin (OPG): a mechanism by which OPG/OCIF inhibits osteoclastogenesis in vitro. Endocrinology 139: 1329–1337. [DOI] [PubMed] [Google Scholar]
  • 57.Lubberts E, van den Bersselaar L, Oppers-Walgreen B, Schwarzenberger P, Coenen-de Roo CJ, Kolls JK, Joosten LA, and van den Berg WB. 2003. IL-17 promotes bone erosion in murine collagen-induced arthritis through loss of the receptor activator of NF-kappa B ligand/osteoprotegerin balance. J Immunol 170: 2655–2662. [DOI] [PubMed] [Google Scholar]
  • 58.Maruyama K, Takada Y, Ray N, Kishimoto Y, Penninger JM, Yasuda H, and Matsuo K. 2006. Receptor activator of NF-kappa B ligand and osteoprotegerin regulate proinflammatory cytokine production in mice. J Immunol 177: 3799–3805. [DOI] [PubMed] [Google Scholar]
  • 59.Milanova V, Ivanovska N, and Dimitrova P. 2014. TLR2 elicits IL-17-mediated RANKL expression, IL-17, and OPG production in neutrophils from arthritic mice. Mediators Inflamm 2014: 643406. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60.Kobayashi MT, Riyoko & Kiyoura Yusuke. 2015. Beyond bone remodeling–emerging functions of osteoprotegerin in host defense and microbial infection Integrative Molecular Medicine. [Google Scholar]
  • 61.Hazlett LD, McClellan S, Kwon B, and Barrett R. 2000. Increased severity of Pseudomonas aeruginosa corneal infection in strains of mice designated as Th1 versus Th2 responsive. Invest Ophthalmol Vis Sci 41: 805–810. [PubMed] [Google Scholar]
  • 62.Taylor PR, Leal SM Jr., Sun Y, and Pearlman E. 2014. Aspergillus and Fusarium corneal infections are regulated by Th17 cells and IL-17-producing neutrophils. J Immunol 192: 3319–3327. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 63.Glatt S, Baeten D, Baker T, Griffiths M, Ionescu L, Lawson ADG, Maroof A, Oliver R, Popa S, Strimenopoulou F, Vajjah P, Watling MIL, Yeremenko N, Miossec P, and Shaw S. 2018. Dual IL-17A and IL-17F neutralisation by bimekizumab in psoriatic arthritis: evidence from preclinical experiments and a randomised placebo-controlled clinical trial that IL-17F contributes to human chronic tissue inflammation. Ann Rheum Dis 77: 523–532. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

1

RESOURCES