Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2021 Mar 2.
Published in final edited form as: Prog Neuropsychopharmacol Biol Psychiatry. 2019 Nov 7;98:109812. doi: 10.1016/j.pnpbp.2019.109812

Adolescent forced swim stress increases social anxiety-like behaviors and alters kappa opioid receptor function in the basolateral amygdala of male rats

EI Varlinskaya 1, JM Johnson 1, KR Przybysz 1, T Deak 1, MR Diaz 1
PMCID: PMC6920550  NIHMSID: NIHMS1543150  PMID: 31707090

Abstract

Adolescence is a developmental period marked by robust neural alterations and heightened vulnerability to stress, a factor that is highly associated with increased risk for emotional processing deficits, such as anxiety. Stress-induced upregulation of the dynorphin/kappa opioid receptor (DYN/KOP) system is thought to, in part, underlie the negative affect associated with stress. The basolateral amygdala (BLA) is a key structure involved in anxiety, and neuromodulatory systems, such as the DYN/KOP system, can 1) regulate BLA neural activity in an age-dependent manner in stress-naïve animals and 2) underlie stress-induced anxiety in adults. However, the role of the DYN/KOP system in modulating stress-induced anxiety in adolescents is unknown. To test this, we examined the impact of an acute, 2-day forced swim stress (FSS – 10 min each day) on adolescent (~postnatal day (P) 35) and adult Sprague-Dawley rats (~P70), followed by behavioral, molecular and electrophysiological assessment 24 hours following FSS. Adolescent males, but not adult males or females of either age, demonstrated social anxiety-like behavioral alterations indexed via significantly reduced social investigation and preference when tested 24 hours following FSS. Conversely, adult males exhibited increased social preference. While there were no FSS-induced changes in expression of genes related to the DYN/KOP system in the BLA, these behavioral alterations were associated with alterations in BLA KOP function. Specifically, while GABA transmission in BLA pyramidal neurons from non-stressed adolescent males responded variably (potentiated, suppressed, or was unchanged) to the KOP agonist, U69593, U69593 significantly inhibited BLA GABA transmission in the majority of neurons from stressed adolescent males, consistent with the observed anxiogenic phenotype in stressed adolescent males. This is the first study to demonstrate stress-induced alterations in BLA KOP function that may contribute to stress-induced social anxiety in adolescent males. Importantly, these findings provide evidence for potential KOP-dependent mechanisms that may contribute to pathophysiological interactions with subsequent stress challenges.

Keywords: Stress, kappa opioid receptor, adolescent, amygdala, development, ontogeny

1.1. Introduction

Anxiety disorders are one of the most common and debilitating mental illnesses worldwide. In the US, the estimated lifetime prevalence of anxiety disorders rises dramatically from ~15% at age 6 to >30% by 18 years of age (Merikangas et al., 2010), reaching an average of 35.1% in adults (ages 30-44) (Kessler et al., 2005). Although our understanding of age-dependent behavioral changes is increasing, the neurobiological mechanisms that influence age disparities in anxiety disorders are not well understood. Importantly, adolescence is a developmental period in which the developing brain is highly vulnerable to stress (Bekhbat et al., 2018; Doremus-Fitzwater, Varlinskaya, & Spear, 2009; Hollenstein, McNeely, Eastabrook, Mackey, & Flynn, 2012; McCormick & Green, 2013; Tottenham & Galvan, 2016), which is associated with increased risk for emotional processing deficits, such as anxiety (Barrocas & Hankin, 2011; Grant et al., 2003). Preclinical studies have also shown a clear relationship between stress and the development of anxiety in adolescents. Specifically, various rodent models have demonstrated that exposure to stress during adolescence increased both non-social anxiety, as measured on an elevated plus maze (Caruso et al., 2018; Cotella et al., 2019; Page & Coutellier, 2018; Zhang & Rosenkranz, 2012) or light/dark box (Lovelock & Deak, 2019), and social anxiety, indexed via alterations in social behavior (Doremus-Fitzwater et al., 2009; Hodges, Baumbach, & McCormick, 2018; Varlinskaya, Spear, & Diaz, 2018). However, the underlying neurobiological mechanisms that drive these stress-induced alterations in anxiety-like behaviors in adolescents are not clear.

Activation of the dynorphin/kappa opioid receptor (DYN/KOP) system is associated with increased aversion, dysphoria, and anxiety that resemble the effects of stress (Hang, Wang, He, & Liu, 2015; Van’t Veer & Carlezon, 2013). Specifically, exposure to stressors can acutely activate the DYN/KOP system, which modulates stress effects, in addition to inducing adaptations in the DYN/KOP system that contribute to the expression of future anxiety-like behaviors [see reviews: (Bruchas, Land, & Chavkin, 2010; Chavkin & Ehrich, 2014; Crowley & Kash, 2015; Knoll & Carlezon, 2010; Tejeda, Shippenberg, & Henriksson, 2012; Van’t Veer & Carlezon, 2013)]. Although our general understanding of the aversive and anxiety-provoking effects of the DYN/KOP system is derived from studies in adults, mounting evidence indicates that the DYN/KOP system may be functionally different in early-life. For example, we recently found that juvenile and adolescent rats are less sensitive to the socially-aversive effects of a systemic KOP agonist relative to adults (Varlinskaya et al., 2018), consistent with previous reports of reduced sensitivity to KOP manipulations in young animals relative to adults in various aversive- and anxiety-like behavioral paradigms [see review: (Diaz, Przybysz, & Rouzer, 2018)]. Paradoxically, exposure to stress in adolescence leads to a KOP-mediated anxiolytic effect at low doses of a KOP agonist (Varlinskaya et al., 2018). Despite these findings, the neuroadaptations resulting from exposure to stress during adolescence are unknown.

The basolateral nucleus of the amygdala (BLA) is suitably situated within the anxiety circuit, where it receives and integrates executive and sensory information that is transferred to downstream brain regions involved in the physiological and psychological manifestations of anxiety. Specifically, while BLA activity, driven primarily by glutamatergic (excitatory) pyramidal neurons, is tightly associated with anxiety-like behaviors (increased excitatory drived→increased anxiety) (Janak & Tye, 2015; Wang et al., 2011), BLA excitability is heavily regulated by GABAergic (inhibitory) interneurons (Bueno, Zangrossi, & Viana, 2005; Lack, Diaz, Chappell, DuBois, & McCool, 2007). Importantly, shifts in the balance between excitatory and inhibitory systems that give rise to changes in anxiety-like behaviors (Janak & Tye, 2015) are regulated by neuromodulatory systems, including the DYN/KOP system. Although our limited knowledge of the BLA DYN/KOP system comes from studies in adults which show activation of this system following stress exposures (Bilkei-Gorzo et al., 2012; Bilkei-Gorzo, Mauer, Michel, & Zimmer, 2014; Bilkei-Gorzo et al., 2008; Bruchas, Land, Lemos, & Chavkin, 2009; Knoll et al., 2011), the effects of stress imposed during adolescence on the BLA DYN/KOP system have not been explored. We recently identified a potentially protective role for BLA KOPs in stress-naïve adolescents whereby KOP activation potentiated GABA transmission in adolescent males, with no effects evident in adult males (Przybysz, Werner, & Diaz, 2017). Our findings are consistent with previously reported KOP-mediated reduction in BLA excitability in adolescents (Huge, Rammes, Beyer, Zieglgansberger, & Azad, 2009). Ultimately, these neurophysiological effects would produce an anxiolytic effect in adolescents, consistent with previously demonstrated anxiolytic effects of KOP agonists in stress-naïve adolescents (Alexeeva, Nazarova, & Sudakov, 2012; Anderson, Morales, Spear, & Varlinskaya, 2014; Chen et al., 2015; Collins, Zavala, Nazarian, & McDougall, 2000; Cortez et al., 2010; Diaz et al., 2018; McDougall, Garmsen, Meier, & Crawford, 1997; Nizhnikov, Pautassi, Varlinskaya, Rahmani, & Spear, 2012; Privette & Terrian, 1995). Despite these intriguing findings, how the BLA DYN/KOP system responds to a stress exposure in adolescence is unknown.

To examine this, we utilized a forced swim stress (FSS) paradigm (two 10-minute swim exposures 24 hours apart), followed by behavioral, biochemical, and electrophysiological assessment 24 hours after the second swim exposure. Although best known as a behavioral test sensitive to anti-depressant activity (Cryan, Markou, & Lucki, 2002; Porsolt, Anton, Blavet, & Jalfre, 1978), various permutations of forced swim exposure have been utilized as an ethologically-relevant stress challenge that evokes robust activation of stress responsive systems, effects that are highly uniform across test subjects yet distinct in its neural circuitry (Dayas, Buller, Crane, Xu, & Day, 2001; Deak, Bellamy, & D’Agostino, 2003).

2.1. Methods

2.1.1. Experimental Subjects

Adolescent [postnatal day (P) 33-35] male and female Sprague-Dawley rats were obtained from an in-house breeding colony, with breeding pairs originating from Envigo (Indianapolis, IN). To avoid litter effects, no more than 1-2 pups from any litter were assigned to a given experimental group. At weaning, animals were pair-housed with same sex non-littermates and received food and water ad libitum. At all times, animals were treated in accordance with guidelines for animal care established by the National Institutes of Health under protocols approved by the Binghamton University Institutional Animal Care and Use Committee.

2.1.2. Drugs and chemicals

All chemicals were purchased from Sigma-Aldrich (St. Louis, MO, USA) unless noted. Kynurenic acid, DL-APV, and QX314-Cl were purchased from Tocris/R&D Systems (Bristol, UK). Chemicals purchased from other vendors are indicated below.

2.1.3. Forced Swim Stress

Experimental subjects were transported to the testing room on day of exposure (P33) between 0900 and 1000 h and a pair of cage-mates was simultaneously placed in individual polycarbonate cylinders (height = 45.72 cm, diameter = 20.32 cm) filled with water to a depth of 23 cm (25°C) for 10 minutes on two consecutive days (24 hours apart) (Fig. 1). After each FSS exposure, rats were dried with a towel and placed in a new cage for 30 minutes to allow additional drying time. Then they were placed in home cages and returned to colony. Water in cylinders was replaced with fresh water after each stress exposure. Controls were left non-manipulated in the home cage, with all animals in each home cage assigned to the same stressor condition.

Figure 1:

Figure 1:

Open in a new tab

Experimental timeline of forced swim stress (FSS) and subsequent analyses.

2.1.4. Social Interaction Test

Modified social interaction testing was conducted as previously described (Diaz, Mooney, & Varlinskaya, 2016; Varlinskaya et al., 2018). Briefly, all testing was conducted under dim light in Plexiglas (Binghamton Plate Glass, Binghamton, NY) test apparatuses (30 × 20 × 20 cm for adolescents and 45 × 30 × 20 cm for adults) containing clean shavings. Each test apparatus was divided into two equally sized compartments by a clear Plexiglas partition that contained an aperture (7×5 cm) to allow movement of the animals between compartments in a way that only one animal was able to move through the aperture at a time. On test day (24 hours after the second FSS exposure; Fig. 1), animals were taken from their home cage and placed individually in the testing apparatus for 30 min. A social partner of the same age and sex was then introduced for a 10-min test period. Partners were always unfamiliar with both the test apparatus and the experimental animal, that was not socially deprived prior to the test and was experimentally naïve. Weight differences between test subjects and their partners were minimized as much as possible, with weight difference not exceeding 10 g for adolescents and 20 g for adults, and test subjects always being heavier than their partners. In order to differentiate experimental animals from their social partners during the test, each experimental animal was marked with a vertical black line on the back. During the 10-min test session, the behavior of the animals was video recorded. All testing procedures were conducted between 0900 and 1100 h under dim light (15–20 lx). The frequencies of social investigation, contact behavior, and play fighting were analyzed from video recordings by a trained experimenter without knowledge of the experimental condition of any given animal. The frequencies, rather than time, were scored and analyzed, given that elementary behavioral acts and postures (i.e., ethogram) demonstrated by experimental subjects are discrete and extremely short lasting, especially during adolescence. Therefore, this analysis allows us to provide better comparisons between adolescent and adult rats.

Social investigation was defined as the sniffing of any part of the body of the partner. Contact behavior defined as crawling over and under the partner and social grooming. Play fighting was scored as the sum of the frequencies of the following behaviors: pouncing or playful nape attack (experimental subject lunges at the partner with its forepaws extended outward); following and chasing (experimental animal rapidly pursues the partner); and pinning (the experimental subject stands over the exposed ventral area of the partner, pressing it against the floor). Play fighting can be distinguished from serious fighting in the laboratory rat by the target of the attack—during play fighting, snout or oral contact is directed towards the partner’s nape, whereas during serious fighting the partner’s rump is the object of the attack. Aggressive behavior (serious fighting) was not analyzed in these experiments, since subjects did not exhibit serious attacks or threats. Modification of the social interaction test, allowing the experimental animal to freely move toward or away from a non-manipulated social partner in a 2-compartment testing apparatus, permitted assessment of social motivation via a preference/avoidance coefficient. The number of crossovers demonstrated by the experimental subject towards, as well as away from, the social partner was measured separately, and a coefficient of social preference/avoidance was then calculated [coefficient (%) = (crossovers to the partner − crossovers away from the partner)/(total number of crosses both to and away from the partner) × 100]. Social preference was defined by positive values of the coefficient, whereas social avoidance was associated with negative values. Total number of crossovers (movements between compartments) was used as an index of general locomotor activity under these circumstances.

2.1.5. RNA extraction and real time RT-PCR

In one subset of subjects, animals were euthanized 24 h following the second FSS exposure by rapid decapitation under deep anesthesia (250 mg/kg i.p. ketamine) (Fig. 1). In another group, animals were euthanized via the same procedure 30 min after undergoing social interaction testing (Fig. 1). Following decapitation, brains were quickly extracted and flash frozen in 2-methylbutane and stored at −80° C. The BLA and CeA were micro-punched (Fig. 2) in a cryostat and stored at −80C until RNA extractions were performed using procedures described elsewhere (Lovelock & Deak, 2017); punches were 1.22 mm diameter by 1 mm depth. Briefly, tissue punches were extracted with 500 μL Trizol® RNA reagent and homogenized using a Qiagen TissueLyser II™ (Qiagen, Valencia, CA) for 2-4 min at 20 Hz to ensure thorough homogenization of samples. Total cellular RNA was extracted using Qiagen RNeasy Mini kits and separated from the supernatant through chloroform extraction at 4°C. Equal volume of 70% ethanol was added to the collected RNA and purified through RNeasy mini columns. Columns were washed and eluted with 30 μL of RNase-free water (65°C). RNA yield and purity were determined using a NanoDrop 2000 spectrophotometer (NanoDrop, Wilmington, DE). RNA was stored at −80°C prior to cDNA synthesis. Synthesis of cDNA was performed on 0.3-1.0 μg of normalized total RNA from each sample using QuantiTect Reverse Transcription kit (Cat No. 205313, Qiagen, Valencia, CA) which included a DNase treatment step to remove any residual genomic DNA contamination. Probed cDNA amplification was performed in a 20 μL reaction and run in triplicate in a 384-well plate (BioRad Laboratories) using a BioRad CFX 384 Real Time System C1000 Thermal Cycler (BioRad Laboratories). Relative gene expression was quantified using the delta- delta (2-ΔΔCT) method relative to the stable housekeeping gene GAPDH (Livak & Schmittgen, 2001). In all cases, housekeeper genes were analyzed separately to ensure stability across experimental groups prior to use as a reference. Primer sequences are provided in Table 1.

Figure 2:

Figure 2:

Open in a new tab

Diagram from the Paxinos and Watson brain atlas depicting BLA and CeA punches.

Table 1:

Primer sequences used for real time RT-PCR reactions.

Target gene Accession number Primer sequence
GAPDH (housekeeper) NM_017008 Forward: GTGCCAGCCTCGTCTCATAG
Reverse: AGAGAAGGCAGCCCTGGTAA
PDYN NM_019374.3 Forward: CCTCTGTGGCACTTCTCTGA
Reverse: TTCTGTATCACCCTTCCTGCTG
OPRK1 NM_001318742.1 Forward: CTCCAGCCATCCCTGTTATCATC
Reverse: TCTGGAAGGGCATAGTGGTAGT
cfos NM_022197.2 Forward: CCAAGCGGAGACAGATCAAC
Reverse: AAGTCCAGGGAGGTCACAGA
Open in a new tab

2.1.6. Whole-cell patch-clamp electrophysiology

All electrophysiological procedures were done as previously described (Przybysz et al., 2017). Briefly, in a different group of animals, 24 h following the second FSS (Fig. 1), rats were sedated with ketamine (250 mg/kg) and quickly decapitated. Brains were rapidly removed and immersed in ice-cold oxygenated (95% 02/5% CO2) sucrose artificial cerebrospinal fluid (ACSF) containing (in mM): sucrose (220), KCl (2), NaH2PO4 (1.25), NaHCO3 (26), glucose (10), MgSO4 (12), CaCl2 (0.2), and ketamine (0.43). BLA-containing coronal slices (300 μm) were made using a Vibratome (Leica Microsystems. Bannocknurn, IL, USA). Slices were incubated in normal ACSF containing (in mM): NaCl (126), KCl (2), NaH2PO4 (1.25), NaHCO3 (26), glucose (10), CaCl2 (2), MgSO4 (1), ascorbic acid (0.4), continuously bubbled at 95% O2/5% CO2 and allowed to stabilize for at least 40 min at 34 °C before recording, and all experiments were performed ~1-4 h after slice preparation.

Following incubation, slices were transferred to a recording chamber in which oxygenated ACSF was warmed to 32 °C and superfused over the submerged slice at 3 ml/min. Recordings were collected from pyramidal neurons in the BLA with patch pipettes filled with a KCl-based internal solution containing (in mM): KCl (135), HEPES (10), MgCl2 (2), EGTA (0.5), Mg-ATP (5), Na-GTP (1), and QX314-Cl (1). Data were acquired with a MultiClamp 700B (Molecular Devices, Sunnyvale, CA) at 10 kHz, filtered at 1 kHz, and stored for later analysis using pClamp software (Molecular Devices). BLA pyramidal neurons were visualized using infrared-differential interference contrast microscopy (Olympus America, Center Valley, PA) and identified based on morphology and capacitance (>150 pF), as previously described (Przybysz et al., 2017). For recordings of GABAA receptor-mediated spontaneous inhibitory postsynaptic currents (sIPSCs), we pharmacologically blocked AMPA and NMDA glutamate receptors using 1 mM kynurenic acid and 50 μM DL-APV, respectively.

Neurons were allowed to equilibrate for at least 5 min before a baseline was recorded. We recorded a baseline period of at least 2 min, followed by at least 3 min of continuous drug application, as we have previously shown that maximal effect of the KOP agonist, U69593, is stable after ~1 min (Przybysz et al., 2017), which is also shown in time-courses (Fig. 4). Only recordings where access resistance changed <20% were kept for analysis.

Figure 4:

Figure 4:

Open in a new tab

Effect of FSS on BLA KOP function in adolescent males. (A) Change from baseline (%) of sIPSC frequency following application of U69593 (1μM) for all cells. Bars depict mean ± SEM. * - p < 0.05, a significant difference between non-stressed and stressed. (B) Change from baseline (%) of sIPSC frequency following application of U69593 separated by directional change (blue = inhibition, red = no change, green = potentiation). * - p < 0.05, a significant change from baseline (0). Time-courses for U69593 application for (C) non-stressed and (D) stressed. (E) Change from baseline (%) of sIPSC amplitude following application of U69593 (1μM) for all cells.

2.1.7. Data Analyses

Behavioral data for males and females were analyzed separately, given that social interaction in males and females was assessed in two separate studies. For the SI test, levels of social investigation, contact behavior, play fighting, social preference, and overall number of crossovers were assessed using separate 2 (Age: adolescent, adult) x 2 (Stress Exposure: non-stressed, stressed) ANOVAs. Fisher’s planned pairwise comparison test was used to explore significant effects and interactions. For gene expression, all data were statistically analyzed using standard t-tests with Prizm 6 (GraphPad, San Diego, CA, USA). For electrophysiological analyses, data were analyzed using MiniAnalysis (SyanptoSoft, Inc.) and statistically analyzed using Prizm 6. Data were first analyzed with Pearson omnibus; if data followed a normal distribution, parametric t-tests were used – if not, nonparametric tests were used. For all electrophysiological experiments, the experimental unit (n = 1) is a cell. Given the high variability in basal spontaneous GABA transmission across all cells recorded, Kolmogorov-Smirnov (K-S) tests were run on each cell rather than in each group to determine if there was a significant effect of U69593. For time-courses, sIPSC frequency was averaged into 15 sec bins. In all cases, data are presented as mean ± SEM, with p ≤ 0.05 considered statistically significant.

3.1. Results

3.1.1. FSS effects on social behavior

Assessment of social behavior was conducted 24 hours after the second exposure to FSS. In males, the ANOVA of social investigation revealed a significant Age X Stress Exposure interaction, F(1, 26) = 8.403, p < 0.01 (Fig. 3A). Significant stress-induced decreases in social investigation were evident in adolescent, but not adult males, with non-stressed adolescents demonstrating significantly higher levels of social investigation than their adult counterparts. Contact behavior (Fig. 3B) was also significantly decreased by FSS in adolescent males only, as evidenced by an Age X Stress Exposure interaction, F(1,26) = 5.031, p < 0.05, with adult males in general demonstrating less contact behavior than their adolescent counterparts [main effect of Age, F(1,26) = 21.234, p < 0.0001]. A significant Age X Stress Exposure interaction, F(1,26) =10.456, p < 0.005, was evident for social preference (Fig. 3C). FSS significantly decreased social preference in adolescent males, while increasing it in adult males. In contrast, play fighting was not affected by FSS at either age, with adolescent males showing substantially higher play fighting frequency than adult males as evidenced by a significant main effect of age, F(1,26) = 34.127, p < 0.0001 (adolescents: 52.8 ± 3.6, adults: 25.3 ± 3.0). The analysis of general locomotor activity under social circumstances indexed via total number of crossovers between compartments revealed significant main effects of Age, F(1, 26) = 30.694, p < 0.0001, with adolescent males demonstrating more crossovers (58.4 ± 2.8) than their adult counterparts (36.2 ± 2.9).

Figure 3:

Figure 3:

Open in a new tab

Effect of FSS on social behavior. Male social investigation (A), contact behavior (B), and social preference (C). Female social investigation (D), contact behavior (E), and social preference (F). Asterisks (*) denote significant effect of stress within a given age. Data are expressed as mean ± SEM, p < 0.05.

In females, no main effects or interactions were evident for social investigation (Fig. 3D), contact behavior (Fig. 3E), or the coefficient (Fig. 3F). The ANOVA of play fighting revealed a significant main effect of age, F(1, 20) = 18.82, p < 0.001, with adolescent females showing significantly higher play fighting frequency (46.2 ± 4.6) than adult females (25.2 ± 2.1). A significant main effect of age was also evident for total number of crossovers, F(1,20) = 12.082, p < 0.01. Adolescent females demonstrated more crossovers between compartments (43.0 ± 2.6) relative to adult females (30.9 ± 2.2).

3.1.2. FSS effects on DYN/KOP mRNA

Exposure to stress has been shown to alter DYN/KOP gene expression, particularly within the BLA (Bruchas et al., 2009; Knoll et al., 2011). Given that only adolescent males demonstrated FSS-induced social anxiety-like behaviors, we quantified mRNA levels of pro-DYN (PDYN), KOP (OPRK1), and cFos (for general neuronal activation) from exposed adolescent males. Additionally, since synthesis and release of stress-related peptides usually occurs on demand following a behavioral stimulus (Schwarzer, 2009; Yakovleva et al., 2006), we examined gene expression in animals with and without social testing. We found no effect of FSS on PDYN or OPRK1 mRNA levels within the BLA of adolescent males regardless of having undergone social testing (Table 2, n = 8 per group). Interestingly, cFos mRNA was significantly decreased in the BLA of stressed adolescent males following social interaction (Table 2, n = 8).

Table 2:

mRNA expression from the BLA.

BLA No social interaction Yes social interaction
Gene: Non-Stressed Stressed p Non-Stressed Stressed p
PDYN 125.44 ± 31.01 206.80 ±76.82 0.34 133.48 ± 40.89 388.92 ± 214.37 0.26
OPRK1 106.00 ± 13.37 98.59 ± 16.33 0.73 113.42 ± 17.91 305.88 ± 197.27 0.35
cFOS 107.12 ± 12.81 101.33 ± 16.24 0.78 101.59 ± 6.54 71.60 ± 6.66 0.006 *
Open in a new tab
*

- significantly different

Since the DYN/KOP system has also been shown to regulate CeA activity (Gilpin, Roberto, Koob, & Schweitzer, 2014; Kang-Park, Kieffer, Roberts, Siggins, & Moore, 2013, 2015; Kissler et al., 2014), we also measured PDYN, OPRK1, and cFos from CeA samples from the same animals. Surprisingly, we did not find any effect of stress on any of the genes of interest nor an effect of social testing in the CeA (Table 3, n = 8 per group).

Table 3:

mRNA expression from the CeA.

CeA No social interaction Yes social interaction
Gene: Non-Stressed Stressed p Non-Stressed Stressed p
PDYN 129.12 ± 33.22 164.27 ± 18.27 0.37 135.13 ± 38.84 130.85 ± 38.55 0.93
OPRK1 102.50 ± 8.07 103.08 ± 4.56 0.95 109.68 ± 16.54 102.62 ± 11.93 0.73
cFOS 101.79 ± 7.59 135.31 ± 25.31 0.22 115.57 ± 21.41 116.57 ± 19.02 0.97
Open in a new tab

3.1.3. FSS shifts KOP function in the BLA

We next performed electrophysiological experiments within the BLA of adolescent males that had not undergone social testing. First, assessment of basal GABAergic transmission within the BLA showed that FSS did not alter either sIPSC frequency (non-stress: 7.34 ± 1.18 Hz, n = 14; stress: 7.89 ± 2.04 Hz, n = 9; t = 0.25, df = 21, p > 0.05 by unpaired t-test) or amplitude (non-stress: 53.22 ± 12.22 pA, n = 14; stress: 71.27 ± 29.39 pA, n = 9; t = 0.65, df = 21, p > 0.05 by unpaired t-test).

When assessing the effect of U69593 (1 μM) on GABA transmission within the BLA, we found that as an average across all cells, U69593 did not affect sIPSC frequency in neurons from non-stressed adolescent males (Fig. 4A 4.37 ± 4.84% change from baseline, t = 0.96, df = 13, p > 0.05, one sample t-test , n = 14). Given that this data conflicted with our previous reports that showed a U69593-induced potentiation of sIPSC frequency in adolescent males (Przybysz et al., 2017), we ran K-S tests on individual recordings to determine whether there was a significant effect of U69593 in each cell. Interestingly, these analyses revealed that while sIPSC frequency was not significantly affected by U69593 in 9 out of 14 cells from non-stressed male subjects, sIPSC frequency was significantly inhibited in 2 cells and significantly potentiated in 3 cells (Fig. 4B shows averaged data and Fig. 4C shows time courses from these 3 groups). In contrast to non-stressed, application of U69593 (1 μM) to slices from stressed adolescent males led to a strong trend toward a reduction in sIPSC frequency when averaging all cells (Fig. 4A: −17.97 ± 8.22% change from baseline, t = 2.19, df = 8, p = 0.06, one sample t-test, n = 9). Furthermore, K-S analysis revealed that while only 4 out of 9 cells did not respond to U69593, sIPSC frequency was significantly inhibited by U69593 in 5 cells, with no cells being potentiated by U69593 (Fig. 4B). Time courses from these groups are shown in Fig. 4D. Interestingly, even when collapsing averaged change from baseline across stress groups (non-stressed vs. stressed), there was a significant difference between non-stressed and stressed (p < 0.05, t = 2.63, df = 21, unpaired t-test). sIPSC amplitude was not significantly changed by U69593 in either group (non-stressed: 10.82 ± 8.60% from baseline, n = 14; stressed: 4.27 ± 5.81% from baseline, n = 9; t = 0.55, df = 21, p > 0.05 by unpaired t-test). There was also no correlation between U69593-mediated change in sIPSC frequency and amplitude (data not shown).

Although we had previously found that BLA KOPs in stress-naïve adolescent males were not tonically activated (Przybysz et al., 2017), it has been suggested that long-term activation of KOPs is a stress-induced adaptation in the DYN/KOP system (Knoll & Carlezon, 2010). Therefore, we tested whether adolescent FSS led to tonic activation of KOPs in the BLA. Consistent with data from naïve animals, application of norBNI [1 μM, a concentration that we have shown to completely block the effect of 1 μM U69593 in the adolescent BLA (Przybysz et al., 2017)] had no effect on GABA transmission in non-stressed adolescent males (n = 5). Interestingly, there was also no effect of norBNI in stressed adolescent males (n = 7).

4.1. Discussion

Despite increasing evidence of age-dependent differences in DYN/KOP function, few studies have examined the effects of adolescent stress on the DYN/KOP system. Specifically, it is unknown how the BLA DYN/KOP system, which we have shown to differentially function in stress-naïve adolescents and adults (Przybysz et al., 2017), adapts to stress imposed during adolescence. As a first step toward understanding neuroadaptations within this system, we utilized a modified version of FSS over 2 consecutive days and found that 24 hours after FSS stressed adolescent males demonstrated social anxiety-like alterations indexed via significant decreases in social investigation and social preference, while stressed adult males showed increased social preference. In contrast, FSS had no apparent effect on female social behavior, regardless of age. Further investigation of stress-associated adaptations in the DYN/KOP system of adolescent males showed that although gene expression of the DYN/KOP system was largely unaffected by FSS, social testing engaged the BLA system less in stressed subjects relative to non-stressed counterparts, indicated by reduced cFos mRNA levels. More importantly, activation of KOPs produced a primarily suppressive effect on BLA GABA transmission in stressed adolescent males relative to their non-stressed counterparts. Taken together, these findings suggest that FSS produces age- and sex-dependent social anxiety-like alterations, potentially through adaptations in the BLA DYN/KOP system in adolescent males.

Human studies indicate that there are differential effects of stress depending on the age of exposure, suggesting that early-life adversity may have more detrimental and long-lasting effects (Andersen & Teicher, 2008; Callaghan & Tottenham, 2016; Tottenham & Galvan, 2016; Tottenham & Sheridan, 2009). While animal studies have been able to recapitulate many age-dependent behavioral alterations induced by stress, it has become apparent that numerous factors can influence the outcome of stress exposure, including the type of stressor employed (i.e. restraint, social defeat, social isolation, FSS, and footshock), the duration and frequency of exposure, the time point after stress cessation at which assessment occurs, the behavioral assay being used, and biological sex. For example, we recently showed that both adolescents and adults of similar ages as those used in the current study exhibited similar alterations in social behavior following 5 days of restraint stress, including reduced social investigation and social preference, with no apparent sex differences (Varlinskaya et al., 2018). Similarly, Doremus-Fitzwater and colleagues demonstrated that adolescents and adults showed similar anxiety-like alterations following repeated exposure to restraint (90 min/day, 5 days), with no such alterations evident following repeated (5 days) exposure to short-term (90 min/day) social deprivation (Doremus-Fitzwater et al., 2009). The current study shows that FSS reduced social investigation and social preference only in adolescent males, consistent with an increase in social anxiety-like behavior. Surprisingly, FSS increased social preference in adult males, without affecting any other behavior in the modified social interaction test. While it is unclear why adult males responded to FSS with an increased preference for social interaction, the finding that adolescent males exhibited signs of social anxiety-like behavior following FSS adds to the growing evidence of adolescent-typical enhanced vulnerability to stress. Additionally, unlike many previous studies that conduct behavioral assessment immediately after the stress exposure, the current findings suggest that there are effects that persist beyond the acute phase of the stress response. Whether the behavioral effects of an acute FSS exposure in adolescent males represent a transient effect that manifests solely within the post-stress recovery period or instead persists into adulthood is not yet known. Moreover, whether behavioral alterations in females become apparent later in life following adolescent FSS remains to be determined.

Although there are many mechanisms that may moderate ontogenetic differences in vulnerability to stress, the DYN/KOP system has stood out as a clear contender given that activation of this system mimics the anxiogenic effects of stress, including increased aversion, dysphoria, and anxiety-like behaviors (Hang et al., 2015; Van’t Veer & Carlezon, 2013), in addition to being engaged by stress. However, although it has been over-looked for many years, we have recently begun to recognize that the DYN/KOP system is developmentally regulated. For example, in contrast to the typical aversive, dysphoric, and anxiogenic effects produced by the DYN/KOP system in adults, activation of this system has been shown to produce appetitive and anxiolytic effects in neonates, juveniles, and even adolescents [see review: (Diaz et al., 2018)]. Although there are age-dependent differences in DYN/KOP system function under normal conditions, how this system adapts to early-life stress has not been well investigated. Neonatal stress has been shown to induce variable effects on the DYN/KOP system (Hays et al., 2012; Michaels & Holtzman, 2008), however, KOP levels do not appear to be affected by stress exposure in infant rodents (Ploj & Nylander, 2003). Social isolation during adolescence and into adulthood (P28 through ~110) has robust effects on the DYN/KOP system in the nucleus accumbens, wherein increased KOP sensitivity results in a hypodopaminergic state (Karkhanis, Huggins, Rose, & Jones, 2016) that is associated with numerous behavioral alterations in adults (Butler, Ariwodola, & Weiner, 2014; Butler, Karkhanis, Jones, & Weiner, 2016; Rau, Chappell, Butler, Ariwodola, & Weiner, 2015; Skelly, Chappell, Carter, & Weiner, 2015). A different group showed that a shorter isolation period during adolescence (P22-35) increased KOP levels throughout the CNS of adults (Van den Berg, Van Ree, Spruijt, & Kitchen, 1999). Interestingly, we recently found that 5 days of restraint stress alters the effects of KOP activation on social anxiety-like responses differently across ontogeny, with anxiolytic effects of a KOP agonist observed in stressed juveniles and adolescents, but not in adults (Varlinskaya et al., 2018). Although we did not perform pharmacological experiments in the current study, we found that mRNA levels of PDYN and OPRK1 were not different in either the BLA or the CeA of stressed adolescent males, regardless of having undergone social testing. The DYN/KOP system is known to be actively engaged and recruited as needed (Schwarzer, 2009; Yakovleva et al., 2006), which we speculated would manifest as changes in gene expression; however, this was not the case. While it is difficult to make definitive conclusions from gene expression analyses, it is possible that DYN and/or KOP protein expression could be altered in a cell-type specific manner and that such effects might have been diluted by whole punches of the BLA and CeA as we used here. Among possible future studies examining these possibilities, studies should more directly test the role of the DYN/KOP system in driving stress-induced alterations in social behavior, particularly within the BLA, such as using a KOP antagonist to block the effect of FSS on social anxiety-like responses in adolescent males.

The BLA is known to be a critical site for integration of sensory and executive information in order to initiate the expression of anxiety-like responses. Although the role of the DYN/KOP system within the BLA has been somewhat unexplored, there is some evidence that at least in adult males, stress exposure activates the BLA DYN/KOP system, and this contributes to stress-induced anxiety-like behaviors (Bruchas et al., 2009; Knoll et al., 2011). However, the functional role of the DYN/KOP system in adolescence and its responsiveness to stress is not well understood. It was previously shown that activation of KOPs suppresses field excitatory postsynaptic potentials and attenuates long-term potentiation in the BLA of late adolescent-young adult males (Huge et al., 2009), suggestive of a KOP-mediated reduction in BLA excitability. Consistent with these findings, we previously showed that KOP activation increases GABA, but not glutamate transmission in the BLA of adolescent males (P30-45), while not modulating either system in adult males (Przybysz et al., 2017). Given the role of the BLA in anxiety-like behavior, these mechanisms may underlie previously reported anxiolytic effects of KOP agonists in early-life (Alexeeva et al., 2012; Bilkei-Gorzo et al., 2008; Kudryavtseva, Gerrits, Avgustinovich, Tenditnik, & Van Ree, 2006; Privette & Terrian, 1995). To our surprise, we did not find a consistent effect of U69593 on sIPSC frequency in non-stressed adolescents, with the majority of cells being unresponsive to U69593. While this conflicts with our previous characterization of this system, an important distinction between our previous study and the current one is the age range of adolescent subjects, since we used animals from a larger range (P30-45) in the previous study, but only used animals at P35 in the current study. This is particularly important since our previous study included both pre- and likely post-pubertal subjects. Nevertheless, we did find a robust U69593-induced increase in sIPSC frequency in some cells from non-stressed animals, suggesting that there may be a developmental shift in the number of cells that are potentiated by KOPs. Importantly, FSS led to a change in BLA KOP function, with KOP activation primarily inhibiting action potential-dependent GABA transmission in FSS-exposed adolescent males, pushing the BLA to a hyperexcitable state. Although it is currently unknown what mechanism(s) underlie either the age-dependent shift in KOP function or the effect of FSS, our characterization of this system in naïve adolescent males indicated that KOP-mediated increase in GABA transmission was action potential-dependent, as this effect was absent in miniature IPSCs in the presence of TTX (Przybysz et al., 2017). Whether the KOP-mediated reduction in GABA transmission observed in some neurons from non-stressed or most neurons from stressed adolescent males is also through action potential-dependent mechanisms remains to be determined. Aside from the locus of KOP’s mechanism of action, one possibility that may underlie the switch in KOP function is that endogenous DYN release could be elevated thereby increasing tonic activation of KOPs. Since KOPs are known to desensitize after prolonged activation (Bruchas & Chavkin, 2010), additional exposure to KOP agonists could potentially desensitize KOPs during our recordings, leading to an apparent decrease in GABA transmission. Desensitization of KOPs has been shown following prolonged application of KOP agonists, such as 10 minutes in Xenopus oocytes (Appleyard et al., 1999) and over an hour in AtT-20 and HEK293 cells (McLaughlin, Marton-Popovici, & Chavkin, 2003; McLaughlin, Xu, Mackie, & Chavkin, 2003). However, since KOP-mediated suppression of GABA transmission was stable within ~3 minutes of drug application, it is unlikely that the effect that we found was due to desensitization of these receptors. Additionally, since the selective KOP antagonist norBNI did not alter basal GABA transmission in either stress or non-stressed adolescent males, it is not likely that KOPs are tonically activated in either group. While the mechanisms involved in FSS-induced alterations in KOP function are currently unknown, studies are underway to determine the processes involved in these adaptations to the BLA DYN/KOP system resulting from adolescent FSS.

It is worth noting that although FSS-exposed adolescent males exhibited social anxiety-like alterations and KOP agonist-induced reduction in GABA transmission presumably resulting in increased BLA excitability, these animals also had significantly lower cFos levels in the BLA, but not the CeA. While it is difficult to determine the cause of this effect based on the current findings, it is possible that this reduction in cFos is related to the reduced excitability of GABAergic neurons following endogenous KOP activation after social testing, since we had previously shown that the effect of KOP activation on the GABA system in stress-naïve adolescent males is action potential-dependent (i.e. through changes in GABAergic neuron excitability) (Przybysz et al., 2017). Nevertheless, the direct link between the BLA DYN/KOP system and social behavior, and stress-induced alterations in this system and social behavior need to be directly examined in future studies.

5.1. Conclusions

Overall, the current study found that behaviorally, adolescent males demonstrated reduced social behavior in response to FSS, reminiscent of social anxiety-like alterations. These stress-induced social anxiety-like alterations were associated with alterations in BLA KOP function. Specifically, our data suggest that an increase in KOP-mediated suppression of BLA GABA transmission following adolescent FSS would result in increased excitability of the BLA, and ultimately an increase in anxiety-like behaviors, consistent with our social behavior data. While this study provides us with further insight into the development and vulnerability of the DYN/KOP system, it also raises numerous additional questions and potentially novel areas of research that require further investigation. For example, it would be worth determining whether alterations in the BLA DYN/KOP system also occurred following FSS in adulthood, since stressed adult males demonstrated social facilitation, indicated by increased social preference. Additionally, given the differences in body mass/fat composition across ages and sexes, whether the intensity of the stress challenge was equally demanding across groups requires further investigation. Related, it would also be interesting to examine the effects of FSS on the BLA DYN/KOP system immediately after, and the persistence of these effects beyond the 24-hour window used in the current study. Finally, given that the role of the BLA DYN/KOP system in females is unknown and that we did not find any behavioral effects of FSS in females regardless of age of exposure suggests that other mechanisms may be involved in females, particularly since the DYN/KOP system in females may function different (Chartoff & Mavrikaki, 2015). Nevertheless, our understanding of how the adolescent brain responds to insults, such as stress, particularly through alterations in the DYN/KOP system, can pave the way toward better and novel therapeutic interventions for this highly vulnerable population.

Highlights.

  • Adolescents and adults are differentially vulnerable to stress

  • Dynorphin/kappa opioid receptor (DYN/KOP) system adapts to stress

  • Forced swim stress increases social anxiety only in adolescent males

  • DYN/KOP gene expression is not affected by stress within the basolateral amygdala

  • Basolateral amygdala KOP function is altered by stress in adolescent males

Acknowledgements:

The authors would like to thank Tanner McNamara for technical assistance with a portion of the work presented here. This work was supported by NIAAA grants R03AA024890, P50AA017823, and the Psychology Department at Binghamton University.

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

References

  1. Alexeeva EV, Nazarova GA, & Sudakov SK (2012). Effects of peripheral mu, delta, and Kappa-opioid receptor agonists on the levels of anxiety and motor activity of rats. Bull Exp Biol Med, 153(5), 720–721. [DOI] [PubMed] [Google Scholar]
  2. Andersen SL, & Teicher MH (2008). Stress, sensitive periods and maturational events in adolescent depression. Trends Neurosci, 31(4), 183–191. doi: 10.1016/j.tins.2008.01.004 [DOI] [PubMed] [Google Scholar]
  3. Anderson RI, Morales M, Spear LP, & Varlinskaya EI (2014). Pharmacological activation of kappa opioid receptors: aversive effects in adolescent and adult male rats. Psychopharmacology (Berl), 231(8), 1687–1693. doi: 10.1007/s00213-013-3095-8 [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Appleyard SM, Celver J, Pineda V, Kovoor A, Wayman GA, & Chavkin C (1999). Agonist-dependent desensitization of the kappa opioid receptor by G protein receptor kinase and beta-arrestin. J Biol Chem, 274(34), 23802–23807. [DOI] [PubMed] [Google Scholar]
  5. Barrocas AL, & Hankin BL (2011). Developmental pathways to depressive symptoms in adolescence: a multi-wave prospective study of negative emotionality, stressors, and anxiety. J Abnorm Child Psychol, 39(4), 489–500. doi: 10.1007/s10802-010-9482-2 [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Bekhbat M, Howell PA, Rowson SA, Kelly SD, Tansey MG, & Neigh GN (2018). Chronic Adolescent Stress Sex-Specifically Alters Central and Peripheral Neuro-Immune Reactivity in Rats. Brain Behav Immun. doi: 10.1016/j.bbi.2018.12.005 [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Bilkei-Gorzo A, Erk S, Schurmann B, Mauer D, Michel K, Boecker H, … Zimmer A (2012). Dynorphins regulate fear memory: from mice to men. J Neurosci, 32(27), 9335–9343. doi: 10.1523/JNEUROSCI.1034-12.2012 [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Bilkei-Gorzo A, Mauer D, Michel K, & Zimmer A (2014). Dynorphins regulate the strength of social memory. Neuropharmacology, 77, 406–413. doi: 10.1016/j.neuropharm.2013.10.023 [DOI] [PubMed] [Google Scholar]
  9. Bilkei-Gorzo A, Racz I, Michel K, Mauer D, Zimmer A, Klingmuller D, & Zimmer A (2008). Control of hormonal stress reactivity by the endogenous opioid system. Psychoneuroendocrinology, 33(4), 425–436. doi: 10.1016/j.psyneuen.2007.12.010 [DOI] [PubMed] [Google Scholar]
  10. Bruchas MR, & Chavkin C (2010). Kinase cascades and ligand-directed signaling at the kappa opioid receptor. Psychopharmacology (Berl), 210(2), 137–147. doi: 10.1007/s00213-010-1806-y [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Bruchas MR, Land BB, & Chavkin C (2010). The dynorphin/kappa opioid system as a modulator of stress-induced and pro-addictive behaviors. Brain Res, 1314, 44–55. doi: 10.1016/j.brainres.2009.08.062 [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Bruchas MR, Land BB, Lemos JC, & Chavkin C (2009). CRF1-R activation of the dynorphin/kappa opioid system in the mouse basolateral amygdala mediates anxiety-like behavior. PLoS One, 4(12), e8528. doi: 10.1371/journal.pone.0008528 [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Bueno CH, Zangrossi H Jr., & Viana MB (2005). The inactivation of the basolateral nucleus of the rat amygdala has an anxiolytic effect in the elevated T-maze and light/dark transition tests. Braz J Med Biol Res, 38(11), 1697–1701. doi:/S0100-879X2005001100019 [DOI] [PubMed] [Google Scholar]
  14. Butler TR, Ariwodola OJ, & Weiner JL (2014). The impact of social isolation on HPA axis function, anxiety-like behaviors, and ethanol drinking. Front Integr Neurosci, 7, 102. doi: 10.3389/fnint.2013.00102 [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Butler TR, Karkhanis AN, Jones SR, & Weiner JL (2016). Adolescent Social Isolation as a Model of Heightened Vulnerability to Comorbid Alcoholism and Anxiety Disorders. Alcohol Clin Exp Res, 40(6), 1202–1214. doi: 10.1111/acer.13075 [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Callaghan BL, & Tottenham N (2016). The Stress Acceleration Hypothesis: Effects of early-life adversity on emotion circuits and behavior. Curr Opin Behav Sci, 7, 76–81. doi: 10.1016/j.cobeha.2015.11.018 [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Caruso MJ, Seemiller LR, Fetherston TB, Miller CN, Reiss DE, Cavigelli SA, & Kamens HM (2018). Adolescent social stress increases anxiety-like behavior and ethanol consumption in adult male and female C57BL/6J mice. Sci Rep, 8(1), 10040. doi: 10.1038/s41598-018-28381-2 [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Chartoff EH, & Mavrikaki M (2015). Sex Differences in Kappa Opioid Receptor Function and Their Potential Impact on Addiction. Front Neurosci, 9, 466. doi: 10.3389/fnins.2015.00466 [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Chavkin C, & Ehrich JM (2014). How does stress-induced activation of the kappa opioid system increase addiction risk? Biol Psychiatry, 76(10), 760–762. doi: 10.1016/j.biopsych.2014.08.015 [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Chen Z, Tang Y, Tao H, Li C, Zhang X, & Liu Y (2015). Dynorphin activation of kappa opioid receptor reduces neuronal excitability in the paraventricular nucleus of mouse thalamus. Neuropharmacology, 97, 259–269. doi: 10.1016/j.neuropharm.2015.05.030 [DOI] [PubMed] [Google Scholar]
  21. Collins RL, Zavala AR, Nazarian A, & McDougall SA (2000). Kappa-Opioid receptors in the substantia nigra pars reticulata mediate the U-50,488-induced locomotor activity of preweanling rats. Brain Res Dev Brain Res, 119(1), 97–103. [DOI] [PubMed] [Google Scholar]
  22. Cortez AM, Charntikov S, Der-Ghazarian T, Horn LR, Crawford CA, & McDougall SA (2010). Age-dependent effects of kappa-opioid receptor stimulation on cocaine-induced stereotyped behaviors and dopamine overflow in the caudate-putamen: an in vivo microdialysis study. Neuroscience, 169(1), 203–213. doi: 10.1016/j.neuroscience.2010.04.052 [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Cotella EM, Gomez AS, Lemen P, Chen C, Fernandez G, Hansen C, … Paglini MG (2019). Long-term impact of chronic variable stress in adolescence versus adulthood. Prog Neuropsychopharmacol Biol Psychiatry, 88, 303–310. doi: 10.1016/j.pnpbp.2018.08.003 [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Crowley NA, & Kash TL (2015). Kappa opioid receptor signaling in the brain: Circuitry and implications for treatment. Prog Neuropsychopharmacol Biol Psychiatry. doi: 10.1016/j.pnpbp.2015.01.001 [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Cryan JF, Markou A, & Lucki I (2002). Assessing antidepressant activity in rodents: recent developments and future needs. Trends Pharmacol Sci, 23(5), 238–245. [DOI] [PubMed] [Google Scholar]
  26. Dayas CV, Buller KM, Crane JW, Xu Y, & Day TA (2001). Stressor categorization: acute physical and psychological stressors elicit distinctive recruitment patterns in the amygdala and in medullary noradrenergic cell groups. Eur J Neurosci, 14(7), 1143–1152. [DOI] [PubMed] [Google Scholar]
  27. Deak T, Bellamy C, & D’Agostino LG (2003). Exposure to forced swim stress does not alter central production of IL-1. Brain Res, 972(1-2), 53–63. [DOI] [PubMed] [Google Scholar]
  28. Diaz MR, Mooney SM, & Varlinskaya EI (2016). Acute prenatal exposure to ethanol on gestational day 12 elicits opposing deficits in social behaviors and anxiety-like behaviors in Sprague Dawley rats. Behav Brain Res, 310, 11–19. doi: 10.1016/j.bbr.2016.05.003 [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Diaz MR, Przybysz KR, & Rouzer SK (2018). Age as a factor in stress and alcohol interactions: A critical role for the kappa opioid system. Alcohol, 72, 9–18. doi: 10.1016/j.alcohol.2017.10.002 [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Doremus-Fitzwater TL, Varlinskaya EI, & Spear LP (2009). Social and non-social anxiety in adolescent and adult rats after repeated restraint. Physiol Behav, 97(3-4), 484–494. doi: 10.1016/j.physbeh.2009.03.025 [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Gilpin NW, Roberto M, Koob GF, & Schweitzer P (2014). Kappa opioid receptor activation decreases inhibitory transmission and antagonizes alcohol effects in rat central amygdala. Neuropharmacology, 77, 294–302. doi: 10.1016/j.neuropharm.2013.10.005 [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Grant KE, Compas BE, Stuhlmacher AF, Thurm AE, McMahon SD, & Halpert JA (2003). Stressors and child and adolescent psychopathology: moving from markers to mechanisms of risk. Psychol Bull, 129(3), 447–466. [DOI] [PubMed] [Google Scholar]
  33. Hang A, Wang YJ, He L, & Liu JG (2015). The role of the dynorphin/kappa opioid receptor system in anxiety. Acta Pharmacol Sin, 36(7), 783–790. doi: 10.1038/aps.2015.32 [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Hays SL, McPherson RJ, Juul SE, Wallace G, Schindler AG, Chavkin C, & Gleason CA (2012). Long-term effects of neonatal stress on adult conditioned place preference (CPP) and hippocampal neurogenesis. Behav Brain Res, 227(1), 7–11. doi: 10.1016/j.bbr.2011.10.033 [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Hodges TE, Baumbach JL, & McCormick CM (2018). Predictors of social instability stress effects on social interaction and anxiety in adolescent male rats. Dev Psychobiol, 60(6), 651–663. doi: 10.1002/dev.21626 [DOI] [PubMed] [Google Scholar]
  36. Hollenstein T, McNeely A, Eastabrook J, Mackey A, & Flynn J (2012). Sympathetic and parasympathetic responses to social stress across adolescence. Dev Psychobiol, 54(2), 207–214. doi: 10.1002/dev.20582 [DOI] [PubMed] [Google Scholar]
  37. Huge V, Rammes G, Beyer A, Zieglgansberger W, & Azad SC (2009). Activation of kappa opioid receptors decreases synaptic transmission and inhibits long-term potentiation in the basolateral amygdala of the mouse. Eur J Pain, 13(2), 124–129. doi: 10.1016/j.ejpain.2008.03.010 [DOI] [PubMed] [Google Scholar]
  38. Janak PH, & Tye KM (2015). From circuits to behaviour in the amygdala. Nature, 517(7534), 284–292. doi: 10.1038/nature14188 [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Kang-Park M, Kieffer BL, Roberts AJ, Siggins GR, & Moore SD (2013). kappa-Opioid receptors in the central amygdala regulate ethanol actions at presynaptic GABAergic sites. J Pharmacol Exp Ther, 346(1), 130–137. doi: 10.1124/jpet.112.202903 [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Kang-Park M, Kieffer BL, Roberts AJ, Siggins GR, & Moore SD (2015). Interaction of CRF and kappa opioid systems on GABAergic neurotransmission in the mouse central amygdala. J Pharmacol Exp Ther, 355(2), 206–211. doi: 10.1124/jpet.115.225870 [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Karkhanis AN, Huggins KN, Rose JH, & Jones SR (2016). Switch from excitatory to inhibitory actions of ethanol on dopamine levels after chronic exposure: Role of kappa opioid receptors. Neuropharmacology, 110(Pt A), 190–197. doi: 10.1016/j.neuropharm.2016.07.022 [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Kessler RC, Berglund P, Demler O, Jin R, Merikangas KR, & Walters EE (2005). Lifetime prevalence and age-of-onset distributions of DSM-IV disorders in the National Comorbidity Survey Replication. Arch Gen Psychiatry, 62(6), 593–602. doi: 10.1001/archpsyc.62.6.593 [DOI] [PubMed] [Google Scholar]
  43. Kissler JL, Sirohi S, Reis DJ, Jansen HT, Quock RM, Smith DG, & Walker BM (2014). The one-two punch of alcoholism: role of central amygdala dynorphins/kappa-opioid receptors. Biol Psychiatry, 75(10), 774–782. doi: 10.1016/j.biopsych.2013.03.014 [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Knoll AT, & Carlezon WA Jr. (2010). Dynorphin, stress, and depression. Brain Res, 1314, 56–73. doi: 10.1016/j.brainres.2009.09.074 [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Knoll AT, Muschamp JW, Sillivan SE, Ferguson D, Dietz DM, Meloni EG, … Carlezon WA Jr. (2011). Kappa opioid receptor signaling in the basolateral amygdala regulates conditioned fear and anxiety in rats. Biol Psychiatry, 70(5), 425–433. doi: 10.1016/j.biopsych.2011.03.017 [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Kudryavtseva N, Gerrits MA, Avgustinovich DF, Tenditnik MV, & Van Ree JM (2006). Anxiety and ethanol consumption in victorious and defeated mice; effect of kappa-opioid receptor activation. Eur Neuropsychopharmacol, 16(7), 504–511. doi: 10.1016/j.euroneuro.2006.01.002 [DOI] [PubMed] [Google Scholar]
  47. Lack AK, Diaz MR, Chappell A, DuBois DW, & McCool BA (2007). Chronic ethanol and withdrawal differentially modulate pre- and postsynaptic function at glutamatergic synapses in rat basolateral amygdala. J Neurophysiol, 98(6), 3185–3196. doi: 10.1152/jn.00189.2007 [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Livak KJ, & Schmittgen TD (2001). Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods, 25(4), 402–408. doi: 10.1006/meth.2001.1262 [DOI] [PubMed] [Google Scholar]
  49. Lovelock DF, & Deak T (2019). Acute stress imposed during adolescence yields heightened anxiety in Sprague Dawley rats that persists into adulthood: Sex differences and potential involvement of the Medial Amygdala. Brain Res, 1723, 146392. doi: 10.1016/j.brainres.2019.146392 [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. McCormick CM, & Green MR (2013). From the stressed adolescent to the anxious and depressed adult: investigations in rodent models. Neuroscience, 249, 242–257. doi: 10.1016/j.neuroscience.2012.08.063 [DOI] [PubMed] [Google Scholar]
  51. McDougall SA, Garmsen GM, Meier TL, & Crawford CA (1997). Kappa opioid mediated locomotor activity in the preweanling rat: role of pre- and postsynaptic dopamine receptors. Psychopharmacology (Berl), 133(1), 62–68. [DOI] [PubMed] [Google Scholar]
  52. McLaughlin JP, Marton-Popovici M, & Chavkin C (2003). Kappa opioid receptor antagonism and prodynorphin gene disruption block stress-induced behavioral responses. J Neurosci, 23(13), 5674–5683. [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. McLaughlin JP, Xu M, Mackie K, & Chavkin C (2003). Phosphorylation of a carboxyl-terminal serine within the kappa-opioid receptor produces desensitization and internalization. J Biol Chem, 278(36), 34631–34640. doi: 10.1074/jbc.M304022200 [DOI] [PubMed] [Google Scholar]
  54. Merikangas KR, He JP, Burstein M, Swanson SA, Avenevoli S, Cui L, … Swendsen J (2010). Lifetime prevalence of mental disorders in U.S. adolescents: results from the National Comorbidity Survey Replication--Adolescent Supplement (NCS-A). J Am Acad Child Adolesc Psychiatry, 49(10), 980–989. doi: 10.1016/j.jaac.2010.05.017 [DOI] [PMC free article] [PubMed] [Google Scholar]
  55. Michaels CC, & Holtzman SG (2008). Early postnatal stress alters place conditioning to both mu- and kappa-opioid agonists. J Pharmacol Exp Ther, 325(1), 313–318. doi: 10.1124/jpet.107.129908 [DOI] [PubMed] [Google Scholar]
  56. Nizhnikov ME, Pautassi RM, Varlinskaya EI, Rahmani P, & Spear NE (2012). Ontogenetic differences in ethanol’s motivational properties during infancy. Alcohol, 46(3), 225–234. doi: 10.1016/j.alcohol.2011.09.026 [DOI] [PMC free article] [PubMed] [Google Scholar]
  57. Page CE, & Coutellier L (2018). Adolescent Stress Disrupts the Maturation of Anxiety-related Behaviors and Alters the Developmental Trajectory of the Prefrontal Cortex in a Sex- and Age-specific Manner. Neuroscience, 390, 265–277. doi: 10.1016/j.neuroscience.2018.08.030 [DOI] [PubMed] [Google Scholar]
  58. Ploj K, & Nylander I (2003). Long-term effects on brain opioid and opioid receptor like-1 receptors after short periods of maternal separation in rats. Neurosci Lett, 345(3), 195–197. [DOI] [PubMed] [Google Scholar]
  59. Porsolt RD, Anton G, Blavet N, & Jalfre M (1978). Behavioural despair in rats: a new model sensitive to antidepressant treatments. Eur J Pharmacol, 47(4), 379–391. [DOI] [PubMed] [Google Scholar]
  60. Privette TH, & Terrian DM (1995). Kappa opioid agonists produce anxiolytic-like behavior on the elevated plus-maze. Psychopharmacology (Berl), 118(4), 444–450. [DOI] [PubMed] [Google Scholar]
  61. Przybysz KR, Werner DF, & Diaz MR (2017). Age-dependent regulation of GABA transmission by kappa opioid receptors in the basolateral amygdala of Sprague-Dawley rats. Neuropharmacology, 117, 124–133. doi: 10.1016/j.neuropharm.2017.01.036 [DOI] [PMC free article] [PubMed] [Google Scholar]
  62. Rau AR, Chappell AM, Butler TR, Ariwodola OJ, & Weiner JL (2015). Increased Basolateral Amygdala Pyramidal Cell Excitability May Contribute to the Anxiogenic Phenotype Induced by Chronic Early-Life Stress. J Neurosci, 35(26), 9730–9740. doi: 10.1523/JNEUROSCI.0384-15.2015 [DOI] [PMC free article] [PubMed] [Google Scholar]
  63. Schwarzer C (2009). 30 years of dynorphins--new insights on their functions in neuropsychiatric diseases. Pharmacol Ther, 123(3), 353–370. doi: 10.1016/j.pharmthera.2009.05.006 [DOI] [PMC free article] [PubMed] [Google Scholar]
  64. Skelly MJ, Chappell AE, Carter E, & Weiner JL (2015). Adolescent social isolation increases anxiety-like behavior and ethanol intake and impairs fear extinction in adulthood: Possible role of disrupted noradrenergic signaling. Neuropharmacology, 97, 149–159. doi: 10.1016/j.neuropharm.2015.05.025 [DOI] [PMC free article] [PubMed] [Google Scholar]
  65. Tejeda HA, Shippenberg TS, & Henriksson R (2012). The dynorphin/kappa-opioid receptor system and its role in psychiatric disorders. Cell Mol Life Sci, 69(6), 857–896. doi: 10.1007/s00018-011-0844-x [DOI] [PMC free article] [PubMed] [Google Scholar]
  66. Tottenham N, & Galvan A (2016). Stress and the adolescent brain: Amygdala-prefrontal cortex circuitry and ventral striatum as developmental targets. Neurosci Biobehav Rev, 70, 217–227. doi: 10.1016/j.neubiorev.2016.07.030 [DOI] [PMC free article] [PubMed] [Google Scholar]
  67. Tottenham N, & Sheridan MA (2009). A review of adversity, the amygdala and the hippocampus: a consideration of developmental timing. Front Hum Neurosci, 3, 68. doi: 10.3389/neuro.09.068.2009 [DOI] [PMC free article] [PubMed] [Google Scholar]
  68. Van’t Veer A, & Carlezon WA Jr. (2013). Role of kappa-opioid receptors in stress and anxiety-related behavior. Psychopharmacology (Berl), 229(3), 435–452. doi: 10.1007/s00213-013-3195-5 [DOI] [PMC free article] [PubMed] [Google Scholar]
  69. Van den Berg CL, Van Ree JM, Spruijt BM, & Kitchen I (1999). Effects of juvenile isolation and morphine treatment on social interactions and opioid receptors in adult rats: behavioural and autoradiographic studies. Eur J Neurosci, 11(9), 3023–3032. [DOI] [PubMed] [Google Scholar]
  70. Varlinskaya EI, Spear LP, & Diaz MR (2018). Stress alters social behavior and sensitivity to pharmacological activation of kappa opioid receptors in an age-specific manner in Sprague Dawley rats. Neurobiol Stress, 9, 124–132. doi: 10.1016/j.ynstr.2018.09.003 [DOI] [PMC free article] [PubMed] [Google Scholar]
  71. Wang DV, Wang F, Liu J, Zhang L, Wang Z, & Lin L (2011). Neurons in the amygdala with response-selectivity for anxiety in two ethologically based tests. PLoS One, 6(4), e18739. doi: 10.1371/journal.pone.0018739 [DOI] [PMC free article] [PubMed] [Google Scholar]
  72. Yakovleva T, Bazov I, Cebers G, Marinova Z, Hara Y, Ahmed A, … Bakalkin G (2006). Prodynorphin storage and processing in axon terminals and dendrites. FASEB J, 20(12), 2124–2126. doi: 10.1096/fj.06-6174fje [DOI] [PubMed] [Google Scholar]
  73. Zhang W, & Rosenkranz JA (2012). Repeated restraint stress increases basolateral amygdala neuronal activity in an age-dependent manner. Neuroscience, 226, 459–474. doi: 10.1016/j.neuroscience.2012.08.051 [DOI] [PMC free article] [PubMed] [Google Scholar]

RESOURCES