Abstract
Premise
Microsatellite primers were developed for Puya raimondii (Bromeliaceae), an endangered species distributed in the Andean Mountains of Bolivia and Peru.
Methods and Results
Genome skimming of P. raimondii, P. macrura, and P. hutchisonii resulted in the selection of 46 pairs of cross‐species microsatellite markers. Of these, 12 microsatellite primer pairs produced clear and polymorphic bands in P. raimondii. These primer sets were then used for the detection of potential polymorphisms in 84 P. raimondii individuals collected from four populations in Peru. The number of alleles per locus ranged from one to six, and the observed and expected levels of heterozygosity ranged from 0.000 to 0.8929 and from 0.000 to 0.7662, respectively.
Conclusions
The microsatellite markers developed in this study will be useful for future population genetic analyses and breeding system studies in P. raimondii.
Keywords: Bromeliaceae, codominant markers, genetic variability, genome skimming, next‐generation sequencing, Puya raimondii
Puya raimondii Harms (Bromeliaceae), also known as queen of the Andes or, locally, as titanka, grows between 3600 and 4400 m in high‐elevation grasslands and along rocky slopes. It is mostly found in scattered populations along the Andes of Peru and Bolivia, where it plays an important role, serving as a critical refuge, food source, and nesting place for a number of bird species (Salinas et al., 2007). Puya raimondii is the largest species in the Bromeliaceae, producing tens of thousands of flowers per inflorescence. Its stem can reach 5 m tall, on top of a rosette of hundreds of thorny leaves. Being monocarpic, the inflorescence is produced at the end of its life cycle (~100 years), reaching up to 8 m tall. With an estimated 800,000 individuals in Peru, and 30,000–35,000 individuals in Bolivia, the species is considered endangered (Lambe, 2009). The main threats to its survival are anthropogenic fire disturbance, climate change, and declining genetic diversity.
To date, accurate and comprehensive studies on the genetic structure of remaining P. raimondii populations are lacking. Although Sgorbati et al. (2004) found high levels of genetic similarity among eight populations of P. raimondii in Peru based on a combination of amplified fragment length polymorphism (AFLP), cpSSR, and random‐amplified polymorphic DNA (RAPD) analyses, a high ratio of polymorphic AFLP markers has also been reported for populations from the Huascarán National Park and neighboring areas (Hornung‐Leoni et al., 2013). In addition, Vadillo (2011) found significant morphological variation for the number of spines on the leaf apices of plants sampled from 15 populations located in the central and southern part of Peru. Collectively, these studies can provide some insight into the genetic structure of P. raimondii populations. However, some of the methods used (i.e., analyses based on morphological traits and dominant genetic markers) are not useful for assessing ecological or evolutionary processes that are critical to development of conservation strategies for the species, such as mating system investigations or parentage analysis.
Thus, there is an urgent need to develop codominant genetic markers that can be used to better assess the genetic and ecological impacts of small population size associated with the potential endangerment of P. raimondii. Next‐generation sequencing technology is now widely used in many areas of conservation biology, including for the development of microsatellite markers to assess the genetic structure of populations. In this study, we used next‐generation sequencing (i.e., genome skimming techniques) to develop a set of microsatellite markers for P. raimondii.
Methods and Results
To design primers for microsatellite markers in P. raimondii, one individual each of P. raimondii, P. macrura Mez, and P. hutchisonii L. B. Sm. was sampled for genome skimming. The latter two species and P. macropoda L. B. Sm. were used to conduct cross‐species screening of microsatellite markers in P. raimondii. Puya raimondii is closely related to P. macrura (Jabaily and Sytsma, 2010), whereas the phylogenetic relationship to P. hutchisonii and P. macropoda remains unknown. All four species are distributed in arid regions of the high Andes and are morphologically similar at the juvenile stage. For this study, plant material was collected from Peru: P. raimondii was collected from Chupaca, Lampa, and Bolognesi provinces; P. hutchisonii was collected from Huaylas Province; P. macrura was collected from Huari Province; and P. macropoda was collected from Yungay Province. Voucher specimens for each species were deposited in the Herbarium of the Museo de Historia Natural of Universidad Nacional Mayor de San Marcos (USM), Lima, Peru (Appendix 1).
Total genomic DNA was extracted from silica‐dried leaves using a modified cetyltrimethylammonium bromide (CTAB) procedure (Doyle and Doyle, 1987; a higher concentration [3%] of beta‐mercaptoethanol was used in the extraction buffer) and sent to the Beijing Genomics Institute (BGI; Shenzhen, China) for library construction and sequencing. The genomic libraries were sequenced on an Illumina X Ten platform (Illumina, San Diego, California, USA) with a 150‐bp paired‐end strategy; approximately 10 million raw reads and 95,000 assembled contigs (longer than 590 bp) were generated for each species. The raw reads were deposited in the National Center for Biotechnology Information (NCBI) Sequence Read Archive (BioProject number: PRJNA562459, PRJNA562611); SRA number: SRR10023784, SRR10023783, SRR10028124; Appendix 1). The library reads of each of the three species were assembled using SPAdes 3.13.0 (Bankevich et al., 2012). Plastome contigs were identified by queries to GenBank based on BLASTX analysis and subsequently excluded in the assembled genomes. Microsatellite regions were screened in the assembled genome of P. raimondii by using the microsatellite search tool SciRoKo 3.4 (Kofler et al., 2007). PCR primer pairs for microsatellites were designed using Primer3web version 4.1.0 (Untergasser et al., 2012) with the default parameter settings. In total, 220 microsatellite loci from P. raimondii were identified. They belonged to di‐, tri‐, tetra‐, penta‐, and hexanucleotide repeats (50%, 22.7%, 11.3%, 9%, and 7%, respectively). Each locus was checked for homology in the assembled P. macrura and P. hutchisonii genomes using BioEdit version 7.0.9.0 (Hall, 1999). In total, 70 cross‐species microsatellite loci were selected for primer design and synthesis (Majorbio Company, Shanghai, China).
PCR amplification was performed with three primers: a sequence‐specific forward primer with an M13(−21) tail at its 5′ end, a sequence‐specific reverse primer, and the universal fluorescent‐labeled M13(–21) primer (FAM, HEX, or TAMRA; Invitrogen, Guangzhou, China) (Schuelke, 2000). Amplification was performed in 10‐μL reactions that include: 2 μL 5× buffer mix (TaKaRa Biotechnology Co., Dalian, China), 0.8 μL of dNTP, 0.1 μL of Taq (PrimeSTAR, TaKaRa Biotechnology Co.), 1 μL 0.2 mM aqueous solution for each of three primers (3 μL in total), 30–50 ng of template DNA in 1 μL of aqueous solution, and 3.1 μL of ddH2O. PCR conditions include: 3 min at 94°C, followed by 35 cycles of denaturation at 94°C for 3 min, denaturation of 94°C for 30 s, annealing of 60°C for 30 s, and DNA extension at 72°C for 5 min. The PCR products were scanned by an ABI PRISM 3100 Genetic Analyzer using GeneScan 500 LIZ internal size standard (Applied Biosystems, Waltham, Massachusetts, USA). The size of the alleles at each locus was scored by GeneMarker version 1.5 (SoftGenetics, State College, Pennsylvania, USA). Preliminary PCR screening resulted in the successful amplification of 46 of the 70 primer pairs; one clear band was generated for each of the 46 primer pairs in P. raimondii. These primer pairs (Table 1, Appendix 2) were then screened for polymorphisms across nine individuals selected from four different P. raimondii populations (Cachi, Huascar, Pachapaqui, and Choconchaca; Appendix 1). Twelve primer pairs (Table 1) producing clear and polymorphic bands were then used to screen 84 P. raimondii individuals collected from four populations in Peru (Table 2, Appendix 1).
Table 1.
Characteristics of 12 polymorphic microsatellite loci identified in Puya raimondii.
| Locusa | Primer sequences (5′–3′) | Repeat motif | Allele size range (bp) | Fluorescent dye | GenBank accession no. |
|---|---|---|---|---|---|
| Puya‐002 | F: CTCTCTGCGCCATCACATTA | (GGT)8…(GGTGGA)6 | 199–216 | FAM | MN218732 |
| R: TCGTGATCGGGTTGATCTT | |||||
| Puya‐009 | F: TATGTACCCGATCCGAACC | (ATTTT)6…(TTCGGG)4 | 207–222 | FAM | MN218735 |
| R: TACCCGACCCGACCAAATA | |||||
| Puya‐012 | F: CTTTCGTATGGGAAGGTGA | (TAAAA)4…(CT)6 | 246–263 | HEX | MN218737 |
| R: CGAGCCAAGAAAGATGAAGG | |||||
| Puya‐016 | F: GTCCTCGACATCTTCCCAGA | (AAAG)5 | 180–194 | TAMRA | MN218740 |
| R: TGCGGAACGAAAAATAGATG | |||||
| Puya‐037 | F: GCTTTGGGTTCAACGGTCTA | (TTC)5…(GA)8 | 240–248 | HEX | MN218753 |
| R: GCGGAGACTAAGAGGACGAA | |||||
| Puya‐039 | F: GCCCATGTATGTGCGTGTAT | (GA)7 | 190–202 | FAM | MN218754 |
| R: CCCTCCTCCACTGCTTCC | |||||
| Puya‐042 | F: AAGGAATTATGAGCGCATGG | (AG)19 | 180–194 | HEX | MN218755 |
| R: TGTGAACCCACAGAATCAGC | |||||
| Puya‐046 | F: AGGGCTCCTTCTCTCTCCTG | (CT)12 | 200–213 | HEX | MN218756 |
| R: GGCCAGAGGTAAAGGGGTAG | |||||
| Puya‐049 | F: GCAAAATACACGAAGGAAGC | (TC)6 | 210–222 | HEX | MN218757 |
| R: GGGATGGTGAAGAAATGGTG | |||||
| Puya‐052 | F: TGCGGAAACAGAGAAGAACC | (CT)13 | 202–210 | TAMRA | MN218760 |
| R: CTGCTGCAGCTCCTCTTAGG | |||||
| Puya‐065 | F: TTGGGACTTCCAGGTCACTC | (CT)7…(CT)7 | 272–284 | FAM | MN218769 |
| R: GAGAGAAGGAGCCCTCATCA | |||||
| Puya‐069 | F: AGGGGAGCTCTCTTGGAGAC | (TA)7 | 187–212 | TAMRA | MN218772 |
| R: AAACAGAAACCAACCGCAAC |
Annealing temperature for all loci was 60°C.
Table 2.
Genetic diversity of 12 microsatellite loci in four populations of Puya raimondii.a
| Locus | Cachi (N = 15) | Huascar (N = 14) | Pachapaqui (N = 28) | Choconchaca (N = 27) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| A | H o | H e | f | A | H o | H e | f | A | H o | H e | f | A | H o | H e | f | |
| Puya‐002 | 2 | 0.0667 | 0.0667 | — | 3 | 0.2857 | 0.3148 | 0.0957 | 6 | 0.3214 | 0.4773 | 0.3306b | 2 | 0.0370 | 0.0370 | — |
| Puya‐009 | 2 | 0.0667 | 0.0667 | — | 3 | 0.2500 | 0.2355 | −0.0645 | 3 | 0.1071 | 0.2305 | 0.5398b | 3 | 0.0741 | 0.0734 | −0.0097 |
| Puya‐012 | 4 | 0.2000 | 0.3057 | 0.3538 | 2 | 0.0714 | 0.0714 | — | 3 | 0.1481 | 0.2048 | 0.2803 | 4 | 0.1111 | 0.1433 | 0.2277 |
| Puya‐016 | 1 | 0.0000 | 0.0000 | — | 1 | 0.0000 | 0.0000 | — | 3 | 0.1481 | 0.2621 | 0.4394b | 3 | 0.1111 | 0.1740 | 0.3659 |
| Puya‐037 | 1 | 0.0000 | 0.0000 | — | 2 | 0.0714 | 0.1984 | 0.6486 | 4 | 0.1786 | 0.2019 | 0.1176 | 3 | 0.1111 | 0.1754 | 0.3710 |
| Puya‐039 | 3 | 0.0667 | 0.1908 | 0.6585b | 4 | 0.2500 | 0.3080 | 0.1951 | 5 | 0.4583 | 0.5488 | 0.1678 | 2 | 0.0741 | 0.0727 | −0.0196 |
| Puya‐042 | 1 | 0.0000 | 0.0000 | — | 1 | 0.0000 | 0.0000 | — | 3 | 0.4286 | 0.5162 | 0.1724 | 4 | 0.1481 | 0.1433 | −0.0348 |
| Puya‐046 | 4 | 0.2667 | 0.2506 | −0.0667 | 5 | 0.3571 | 0.6138 | 0.4273b | 5 | 0.3571 | 0.4656 | 0.2362b | 1 | 0.0000 | 0.0000 | — |
| Puya‐049 | 2 | 0.1333 | 0.1287 | −0.0370 | 3 | 0.2143 | 0.2619 | 0.1875 | 6 | 0.8929 | 0.7662 | −0.1688 | 3 | 0.0741 | 0.0734 | −0.0097 |
| Puya‐052 | 2 | 0.1333 | 0.1287 | −0.0370 | 2 | 0.1667 | 0.1594 | −0.0476 | 3 | 0.4444 | 0.4354 | −0.0213 | 3 | 0.1538 | 0.2119 | 0.2780 |
| Puya‐065 | 2 | 0.0667 | 0.0667 | — | 3 | 0.0714 | 0.2619 | 0.7347b | 5 | 0.0714 | 0.2630 | 0.7320b | 1 | 0.0000 | 0.0000 | — |
| Puya‐069 | 3 | 0.1538 | 0.1508 | −0.0213 | 3 | 0.1818 | 0.2554 | 0.2982 | 2 | 0.0800 | 0.1502 | 0.4725 | 2 | 0.0370 | 0.0370 | — |
| Overall | 0.0961 | 0.1129 | 0.1558 | 0.1599 | 0.2234 | 0.3010 | 0.303 | 0.3768 | 0.1985 | 0.0776 | 0.0951 | 0.1820 | ||||
— = not applicable; A = number of alleles; f = inbreeding coefficient; H e = unbiased expected heterozygosity; H o = observed heterozygosity; N = number of individuals.
See Appendix 1 for locality and voucher information.
Deviation from Hardy–Weinberg equilibrium after Bonferroni correction (P < 0.05).
GenAlEx 6.51b2 (Peakall and Smouse, 2012) was used to calculate the number of alleles and the observed and expected levels of heterozygosity. The fixation index (F) was calculated using GENEPOP 4.3 (Rousset, 2008). The deviation from Hardy–Weinberg equilibrium and genotypic linkage disequilibrium among all pairs of loci within populations were estimated using GENEPOP 4.3 based on default parameter settings. We found no consistent deviation from Hardy–Weinberg equilibrium or linkage disequilibrium for any loci within the populations. The levels of observed heterozygosity and expected heterozygosity of the P. raimondii populations varied from 0.000 to 0.8929 and from 0.000 to 0.7662, respectively (Table 2). For the 12 polymorphic loci, the number of alleles per locus ranged from one to six (Table 2), with loci Puya‐002 and Puya‐049 having the highest number of alleles.
Cross‐species amplification success rates in P. hutchisonii, P. macropoda, and P. macrura indicate that 14–18 of the 46 microsatellite loci developed in P. raimondii could also be successfully amplified in this set of taxa (Table 3). Among these successfully cross‐amplified loci, six, 14, and 13 loci are polymorphic and 11, four, and two are monomorphic for P. hutchisonii, P. macropoda, and P. macrura, respectively. These results demonstrate that these primer pairs may be of broad utility throughout the genus Puya.
Table 3.
Cross‐species amplification success of microsatellites developed in Puya raimondii in three related Puya species.a
| Locus | Puya macrura (N = 5) | Puya macropoda (N = 4) | Puya hutchisonii (N = 2) | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| A | H o | H e | Allele size range (bp) | A | H o | H e | Allele size range (bp) | A | H o | H e | Allele size range (bp) | |
| Puya‐002 | 6 | 1.0000 | 0.8889 | 209–224 | 2 | 0.5000 | 0.4286 | 210–213 | 1 | — | — | 215 |
| Puya‐004 | 7 | 0.8000 | 0.9111 | 197–227 | 3 | 0.5000 | 0.7143 | 209–215 | 2 | 1.0000 | 0.6667 | 211–213 |
| Puya‐008 | — | — | — | — | — | — | — | — | 2 | 1.0000 | 0.6667 | 244–248 |
| Puya‐014 | 3 | 0.2000 | 0.6000 | 263–271 | 2 | 1.0000 | 0.5714 | 263–267 | — | — | — | — |
| Puya‐015 | — | — | — | — | 1 | — | — | 214 | 1 | — | — | 210 |
| Puya‐016 | 2 | 0.2000 | 0.2000 | 242–246 | 2 | 1.0000 | 0.5714 | 242–246 | 2 | 1.0000 | 0.6667 | 242–246 |
| Puya‐017 | 2 | 0.5000 | 0.5000 | 244–248 | 1 | 0.0000 | 0.0000 | 244 | 1 | — | — | 246 |
| Puya‐022 | 3 | 0.2000 | 0.3778 | 163–193 | 6 | 0.7500 | 0.9286 | 169–202 | 2 | 1.0000 | 0.6667 | 182–188 |
| Puya‐028 | 3 | 0.6667 | 0.6000 | 208–226 | 3 | 0.0000 | 0.7143 | 220–226 | 1 | — | — | 221 |
| Puya‐030 | 5 | 0.8000 | 0.8444 | 243–250 | 5 | 0.7500 | 0.8571 | 240–254 | 1 | — | — | 246 |
| Puya‐031 | 4 | 0.6000 | 0.7778 | 260–269 | 2 | 0.3333 | 0.3333 | 260–263 | 1 | — | — | 259 |
| Puya‐033 | 1 | — | — | 306 | 1 | — | — | 306 | 1 | — | — | 305 |
| Puya‐034 | 1 | — | — | 243 | 1 | — | — | 243 | — | — | — | — |
| Puya‐037 | — | — | — | — | — | — | — | — | 1 | — | — | 245 |
| Puya‐042 | — | — | — | — | — | — | — | — | 2 | 1.0000 | 0.6667 | 177–181 |
| Puya‐049 | — | — | — | — | 2 | 0.5000 | 0.4286 | 213–215 | 1 | — | — | 215 |
| Puya‐052 | — | — | — | — | 2 | 0.0000 | 0.5714 | 240–242 | 2 | 1.0000 | 0.6667 | 227–241 |
| Puya‐053 | 2 | 0.0000 | 0.6667 | 266–268 | 3 | 0.5000 | 0.6786 | 264–270 | – | — | — | — |
| Puya‐054 | 4 | 0.4000 | 0.5333 | 198–208 | 3 | 0.2500 | 0.7500 | 206–209 | 1 | — | — | 207 |
| Puya‐055 | 4 | 0.4000 | 0.8000 | 172–184 | 3 | 0.5000 | 0.6071 | 175–184 | — | — | — | — |
| Puya‐067 | 5 | 0.8000 | 0.7556 | 254–266 | 2 | 0.2500 | 0.2500 | 254–258 | 1 | — | — | 257 |
| Overall | — | 0.3127 | 0.4026 | — | — | 0.3254 | 0.4002 | — | — | 0.2857 | 0.1905 | — |
— = not applicable; A = number of alleles; H e = unbiased expected heterozygosity; H o = observed heterozygosity; N = sample size.
See Appendix 1 for locality and voucher information.
Conclusions
The design of microsatellite primers for P. raimondii will greatly assist future efforts to assess the ecological and genetic ramifications of small population size in this species. This study not only contributes directly to the development of future conservation strategies for P. raimondii but also may benefit similar efforts in closely related taxa.
Author Contributions
X.J.G. and M.L.S. designed the experiment, L.T. and Y.Q.Z. conducted genetic work, and Z.F.W. and K.S.B. conducted genetic analyses. All authors assisted with manuscript preparation and approved the final manuscript.
Acknowledgments
The authors thank Dr. Mónica Arakaki for her help during the development of the work and Professor Asuncion Cano for field assistance and species identification. This study was financially supported by the International Partnership Program of the Chinese Academy of Sciences (grant no. GJHZ1620).
Appendix 1. Locality information of the four Puya species used for microsatellite primer design.
| Species | Population name | Location | N | Geographic coordinates | Elevation (m) | Voucher (Herbarium)a | BioProject no.b |
|---|---|---|---|---|---|---|---|
| Puya hutchisonii L. B. Sm.* | — | Prov. Huaylas | 2 | 77.811W, 9.046S | 4250 | Xue‐Jun Ge et al. 221 (USM) | SRR10028124/PRJNA562611 |
| Puya macropoda L. B. Sm. | — | Prov. Yungay | 4 | 77.64W, 9.07S | 3850 | Xue‐Jun Ge et al. 32 (USM) | — |
| Puya macrura Mez* | — | Prov. Huari | 5 | 77.183W, 9.319S | 3450 | Xue‐Jun Ge et al. 165 (USM) | SRR10023783/PRJNA562459 |
| Puya raimondii Harms | Cachi | Prov. Chupaca, Yanacancha | 15 | 75.475W, 12.247S | 4124 | G. Prado et al. s.n. (USM‐315310) | — |
| Puya raimondii | Huascar | Prov. Chupaca, Yanacancha | 14 | 75.440W, 12.236S | 4170 | G. Prado et al. s.n. (USM‐315311) | — |
| Puya raimondii * | Pachapaqui | Prov. Bolognesi, Aquia | 28 | 77.088W, 9.958S | 3800 | M. Suni et al. s.n. (USM‐315307) | SRR10023784/PRJNA562459 |
| Puya raimondii | Choconchaca | Prov. Lampa, Lampa | 27 | 70.088W, 15.258S | 3962 | L. Tumi et al. s.n. (USM‐315308) | — |
N = number of individuals.
Vouchers are deposited at the Herbarium of the Museo de Historia Natural of Universidad Nacional Mayor de San Marcos (USM), Lima, Peru.
NCBI Sequence Read Archive (SRA)/BioProject no. for genome skimming data.
Species used for genome skimming.
Appendix 2. Characteristics of 34 monomorphic microsatellite loci identified in Puya raimondii.
| Locusa | Primer sequences (5′–3′) | Repeat motif | Allele size range (bp) | Fluorescent dye | GenBank accession no. |
|---|---|---|---|---|---|
| Puya‐004 | F: GTCCACGCAAAAAGGATCA | (TTCCCG)6…(CT)12 | 261 | TAMRA | MN218733 |
| R: GAGGGGAATTGGAAACCCTA | |||||
| Puya‐008 | F: AGAGGGTTCACCGTAGAGCA | (TATGTG)4 | 229 | FAM | MN218734 |
| R: CGCAGGTAGGAGAAGAGCTG | |||||
| Puya‐010 | F: AGAAAATTCCCAAGGCTGTG | (TCCTAT)7 | 237 | FAM | MN218736 |
| R: GGAATAGCCAGCCAAGGTAG | |||||
| Puya‐014 | F: TGAAGATGCTGTGTGCTGTG | (GCAA)4 | 244 | FAM | MN218738 |
| R: TTTGCCCTTTGGACTCATCT | |||||
| Puya‐015 | F: ACGCTTCAGAACTCAAGAATC | (TAAT)4 | 193 | FAM | MN218739 |
| R: CGACCGTAGGAGGAAGAGAA | |||||
| Puya‐017 | F: TCCCCTCCTTTTGCTAGAAC | (TTTC)4 | 228 | HEX | MN218741 |
| R: TCGGTGAAGCCCATATGAA | |||||
| Puya‐018 | F: CGCAACTCTGCGAACTGTAG | (AGAA)5 | 227 | FAM | MN218742 |
| R: GAAGGTTCTCCACCACCAAA | |||||
| Puya‐019 | F: CGGCAACCAGAAAGAAGAAG | (TTC)13 | 230 | FAM | MN218743 |
| R: TTCTCTCCCTTCTCTCGGCT | |||||
| Puya‐021 | F: ATGAGGAAGCAGCTCAAGGAGA | (TCG)5 | 240 | FAM | MN218744 |
| R: TATTTTGAACCGATCCGAGG | |||||
| Puya‐022 | F: ACTTGCACCTCGTCAGCAC | (CTC)7 | 156 | FAM | MN218745 |
| R: GGCGAAGCTTGATGAGAGAA | |||||
| Puya‐023 | F: AAAACGATACCAAAATCCATGT | (TCA)6 | 229 | FAM | MN218746 |
| R: GGTGGTGCAATTAATTTGGTG | |||||
| Puya‐025 | F: TTCATGTTGCATTGTGCTGA | (TTG)7 | 152 | FAM | MN218747 |
| R: TGAACCCATGCAGAACAAAC | |||||
| Puya‐028 | F: TGATCAGCCGAATACATTGC | (TTC)10 | 205 | FAM | MN218748 |
| R: GCCAATGCAATTCCCTTCTA | |||||
| Puya‐030 | F: AATTCGATTCCCCAAAGTCC | (GTC)8 | 232 | TAMRA | MN218749 |
| R: GACTCGTCGTTGAGGAGCAC | |||||
| Puya‐031 | F: ATTCGGCTGAAGGTGCAGTA | (CTT)12 | 235 | TAMRA | MN218750 |
| R: ATGCGAGCTTGTAAGGAAGC | |||||
| Puya‐033 | F: CCGAATTTGCCACAAATCTT | (AGA)5 | 291 | TAMRA | MN218751 |
| R: AAAGGGTTCAGGCGATGTTA | |||||
| Puya‐034 | F: ATAGAGGCGACCATTTGTCA | (GAT)7 | 226 | FAM | MN218752 |
| R: TTGCTTGTGGTGCTATTTGC | |||||
| Puya‐040 | F: AAGGAATTATGAGCGCATGG | (AG)19 | 182 | FAM | MN218755 |
| R: TGTGAACCCACAGAATCAGC | |||||
| Puya‐044 | F: AGGGCTCCTTCTCTCTCCTG | (CT)12 | 205 | FAM | MN218756 |
| R: GGCCAGAGGTAAAGGGGTAG | |||||
| Puya‐048 | F: TGCAAAATACACGAAGGAAGC | (TC)6 | 216 | FAM | MN218757 |
| R: GGGATGGTGAAGAAATGGTG | |||||
| Puya‐050 | F: TGTATTATCCCTTCAGAACTTGC | (CT)7 | 181 | FAM | MN218758 |
| R: TCGCATACATAGGACGAGTCA | |||||
| Puya‐051 | F: AACACCGAAGGTGGTTCTTG | (TG)12 | 199 | FAM | MN218759 |
| R: GCCTAGTTGCTTCGCATTTC | |||||
| Puya‐053 | F: GTTTTCGATGCCGATTGATT | (AT)9 | 246 | TAMRA | MN218761 |
| R: GTCTTTGTGGCTGAGCGATT | |||||
| Puya‐054 | F: TCTTTACGTCCACACCTCCA | (CA)7 | 190 | FAM | MN218762 |
| R: TCTCTTCATCAGCGGGATCT | |||||
| Puya‐055 | F: AGCTCGGAGGAGGGTCTTAG | (CTC)8 | 160 | FAM | MN218763 |
| R: CGAGATGAGCCTCAGAATCC | |||||
| Puya‐057 | F: ACGGCAGCTCTATCCTCGTA | (TCG)8 | 181 | TAMRA | MN218764 |
| R: GAGGACGTGAAGGTGTGGAT | |||||
| Puya‐059 | F: ATCCGTTGTCGTCGGAATAG | (GCC)5 | 234 | FAM | MN218765 |
| R: CTCCCTCTCTCTGTGGTTCG | |||||
| Puya‐060 | F: CTACCGTTGATTCCCTGGAC | (TTC)8 | 228 | FAM | MN218766 |
| R: CTCCGCCTACGAACAAAAAC | |||||
| Puya‐062 | F: CCTTCCAACTCCTCAGCTTG | (TTG)9 | 246 | FAM | MN218767 |
| R: CAATCACTCTGGCTCACGAC | |||||
| Puya‐064 | F: GGTGTGTGGTGTTGTCAAGG | (AGG)11 | 226 | FAM | MN218768 |
| R: GCTTCAAGATTTGTGCAGATG | |||||
| Puya‐066 | F: TTGGGACTTCCAGGTCACTC | (CT)7…(CT)7 | 272 | FAM | MN218769 |
| R: GAGAGAAGGAGCCCTCATCA | |||||
| Puya‐067 | F: TCAGCGTTTGCTTATCGTTG | (AG)6 | 236 | TAMRA | MN218770 |
| R: TTTCCAGTGATTTGGGGTGT | |||||
| Puya‐068 | F: GGAAATGAGGTGTCGGTTGT | (AT)11 | 170 | FAM | MN218771 |
| R: GCTTGCTTTGTTCTTTGGCT | |||||
| Puya‐070 | F: ATCCTGCAACCAAACAGGAC | (TA)12 | 205 | FAM | MN218773 |
Annealing temperature for all loci was 60°C.
Tumi, L. , Zhang Y.‐Q., Wang Z.‐F., Suni M. L., Burgess K. S., and Ge X.‐J.. 2019. Microsatellite markers for the endangered Puya raimondii in Peru. Applications in Plant Sciences 7(12): e11308.
Contributor Information
Mery L. Suni, Email: msunin@unmsm.edu.pe.
Xue-jun Ge, Email: xjge@scbg.ac.cn.
Data Availability
All primer sequences developed for this study have been deposited to the National Center for Biotechnology Information (NCBI) GenBank database; accession numbers are listed in Table 1 (polymorphic loci) and Appendix 2 (monomorphic loci). The raw reads were deposited to the NCBI Sequence Read Archive (BioProject number: PRJNA562459, PRJNA562611; SRA number: SRR10023784, SRR10023783, SRR10028124).
Literature Cited
- Bankevich, A. , Nurk S., Antipov D., Gurevich A. A., Dvorkin M., Kulikov A. S., Lesin V. M., et al. 2012. SPAdes: A new genome assembly algorithm and its applications to single‐cell sequencing. Journal of Computational Biology 19: 455–477. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Doyle, J. J. , and Doyle J. L.. 1987. A rapid DNA isolation procedure for small quantities of leaf tissue. Phytochemical Bulletin 19: 11–15. [Google Scholar]
- Hall, T. A. 1999. BioEdit: A user‐friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symposium Series 41: 95–98. [Google Scholar]
- Hornung‐Leoni, C. T. , Sosa V., Simpson J., and Gil K.. 2013. Genetic variation in the emblematic Puya raimondii (Bromeliaceae) from Huascarán National Park, Peru. Crop Breeding and Applied Biotechnology 13: 67–74. [Google Scholar]
- Jabaily, R. S. , and Sytsma K. J.. 2010. Phylogenetics of Puya (Bromeliaceae): Placement, major lineages, and evolution of Chilean species. American Journal of Botany 97(2): 337–356. [DOI] [PubMed] [Google Scholar]
- Kofler, R. , Schlotterer C., and Lelley T.. 2007. SciRoKo: A new tool for whole genome microsatellite search and investigation. Bioinformatics 23(13): 1683–1685. [DOI] [PubMed] [Google Scholar]
- Lambe, A. 2009. Puya raimondii The IUCN Red List of Threatened Species 2009: e.T168358A6482345. Website https://www.iucnredlist.org/species/168358/6482345 [accessed 15 November 2019].
- Peakall, R. , and Smouse P. E.. 2012. GenAlEx 6.5: Genetic analysis in Excel. Population genetic software for teaching and research–an update. Bioinformatics 28(19): 2537–2539. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Rousset, F. 2008. GENEPOP'007: A complete re‐implementation of the GENEPOP software for Windows and Linux. Molecular Ecology Resources 8: 103–106. [DOI] [PubMed] [Google Scholar]
- Salinas, L. , Arana C., and Suni M.. 2007. El néctar de especies de Puya como recurso para picaflores Altoandinos de Ancash, Perú. Revista Peruana de Biologia 14(1): 129–134. [Google Scholar]
- Schuelke, M. 2000. An economic method for the fluorescent labeling of PCR fragments. Nature Biotechnology 18: 233–234. [DOI] [PubMed] [Google Scholar]
- Sgorbati, S. , Labra M., Grugni E., Barcaccia G., Galasso G., Boni U., Mucciarelli M., et al. 2004. A survey of genetic diversity and reproductive biology of Puya raimondii (Bromeliaceae), the endangered queen of the Andes. Plant Biology 6(2): 222–230. [DOI] [PubMed] [Google Scholar]
- Untergasser, A. , Cutcutache I., Koressaar T., Ye J., Faircloth B. C., Remm M., and Rozen S. G.. 2012. Primer3—New capabilities and interfaces. Nucleic Acids Research 40: e115. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Vadillo, G. 2011. Bases para la Conservación de P. raimondii Harms (Bromeliaceae). Master's thesis, Universidad Nacional Mayor de San Marcos, Lima, Peru. [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
All primer sequences developed for this study have been deposited to the National Center for Biotechnology Information (NCBI) GenBank database; accession numbers are listed in Table 1 (polymorphic loci) and Appendix 2 (monomorphic loci). The raw reads were deposited to the NCBI Sequence Read Archive (BioProject number: PRJNA562459, PRJNA562611; SRA number: SRR10023784, SRR10023783, SRR10028124).