Abstract
Premise
Microsatellite markers were developed for Labrador tea (Rhododendron groenlandicum, Ericaceae) to facilitate downstream genetic investigation of this species and the extremely closely related, circumboreal Rhododendron subsect. Ledum.
Methods and Results
Forty‐eight primer pairs were designed using Illumina data and screened for excellent amplification. Sixteen successful pairs were developed as microsatellite markers using fluorescently labeled amplification to generate chromatogram data. These data were evaluated for intrapopulation and interpopulation variability in three populations from Alaska and Maine, USA, and the Northwest Territories, Canada. Fourteen polymorphic markers genotyped reliably, each with one to eight alleles. Cluster analysis indicates that across the range, populations can be easily discriminated. Cross‐amplification in other Rhododendron subsect. Ledum species shows broad application of the developed markers within this small, well‐supported clade.
Conclusions
These microsatellite markers exhibit significant variability and will be useful in population genetics within R. groenlandicum and for investigation of species boundaries across Rhododendron subsect. Ledum.
Keywords: Ericaceae, Labrador tea, Rhododendron groenlandicum, Rhododendron subsect. Ledum, species boundaries
Rhododendron groenlandicum (Oeder) Kron & Judd (Labrador tea) is one of eight named species within Rhododendron subsect. Ledum (L.) Kron & Judd (Ericaceae). Rhododendron groenlandicum is widespread across northern North America in damp habitats such as bogs and rocky alpine slopes. Although the related species commonly known as Labrador tea were long considered closely related to Rhododendron, Kron and Judd (1990) first demonstrated, using morphological cladistic analyses, that these species should not be maintained as the separate genus Ledum, but included within Rhododendron. Hart et al. (2017) confirmed the monophyly of subsect. Ledum in a molecular phylogenetic study. However, this study also demonstrated clear conflict between the nuclear and chloroplast genomes, suggesting likely recent hybridization involving multiple species within this lineage. Indeed, the named species in subsect. Ledum have a complex nomenclatural history that mirrors this reticulate evolutionary history, with little consensus about what taxa should be recognized. Therefore, the evolutionary history of this lineage remains unclear, particularly at the population scale. Löve and Löve (1982) reported a sporophytic chromosome count of 2n = 26 for R. groenlandicum; however, recent flow cytometry data (K. T. Theqvist, unpublished) suggests that at least some populations may be tetraploid. A close relative, R. tomentosum Harmaja, was reported by Lantai and Kihlman (1995) to have populations of mixed ploidy (2n = 26, 52). Therefore, the possibility of tetraploid R. groenlandicum populations is reasonable.
Currently, there are no microsatellite markers available for use in any member of Rhododendron subsect. Ledum. The absence of rapidly evolving markers for this lineage limits our ability to investigate boundaries among these recently diverged and likely reticulate species. Because of the young age of this lineage and the high likelihood of hybridization, it is appropriate to investigate relationships among species at the population level by documenting population‐level ploidy, zones of hybridization, and genetic diversity alongside phylogenetic investigation. Development of microsatellite markers for R. groenlandicum, the most widespread species within subsect. Ledum, will likely provide novel tools for use across this entire closely related lineage.
METHODS AND RESULTS
All bioinformatics aspects of this project followed Gillespie et al. (2017). DNA from one R. groenlandicum individual (Appendix 1) was extracted following a modified cetyltrimethylammonium bromide (CTAB) approach (Doyle and Doyle, 1987) followed by CsCl2 purification (Palmer, 1986). A microsatellite sequencing library using the MiSeq v2 protocol and 2 × 250‐bp paired‐end sequencing was performed on an Illumina MiSeq at Cornell Life Sciences Sequencing and Genotyping Facility (Ithaca, New York, USA). Out of 3,882,418 raw sequence reads (GenBank Sequence Read Archive no. PRJNA577479) that were trimmed of vector and low‐quality sequence using the BBduk 1.0 plugin within Geneious 11.1.5 (Kearse et al., 2012; Biomatters Ltd., Auckland, New Zealand), 605,089 reads included microsatellite regions. Of this subset of reads, 16,420 permitted design of unique primers using MSATCOMMANDER (Faircloth, 2008) with mostly default settings, but mononucleotide motifs were excluded, primer length was 20–22 bp, and primer GC maximum content was 50%. A PIG‐tail sequence (Brownstein et al., 1996) was added to reverse primers for stability.
Details of both amplification and polymorphism screens followed Kasireddy et al. (2018). DNA from seven silica‐preserved R. groenlandicum individuals (Appendix 1) was extracted using a QIAGEN Plant Mini Kit (QIAGEN, Hilden, Germany) modified for use with herbarium material (Drábková et al., 2002). These seven DNAs were used to screen 48 markers representing diverse motifs and repeat numbers via PCR amplification (1× GoTaq Flexi Buffer, 2.5 mM MgCl2, 800 μM dNTPs, 0.5 μM of each primer, 0.5 units GoTaq Flexi DNA Polymerase [Promega Corporation, Madison, Wisconsin, USA], and ~20 ng DNA, in a 10‐μL reaction). Touchdown PCR (94°C for 5 min; followed by 13 cycles of 45 s at 94°C, 2 min at touchdown temperature [68–55°C], and 1 min at 72°C; followed by 24 cycles of 45 s at 94°C, 1 min at 55°C, and 1 min at 72°C; and followed by 5 min at 72°C) was employed.
After the amplification screen, 16 primer pairs (Table 1) that amplified exactly one distinct amplicon were genotyped at the Georgia Genomics and Bioinformatics Core (University of Georgia, Athens, Georgia, USA) and scored for polymorphisms using DNA of 68 well‐spaced individuals from three populations representing the broad range of R. groenlandicum (Sitka, Alaska, USA; Northwest Territories, Canada; and Washington County, Maine, USA). For PCR reactions used to genotype individuals, 50% of forward primer was replaced with fluorescently tagged (6‐FAM, VIC, NED, or PET; Life Technologies, Grand Island, New York, USA) M13 universal primers.
Table 1.
Characteristics of 16 microsatellite primer pairs developed for Rhododendron groenlandicum.
| Locus | Primer sequences (5′–3′)a | Repeat motif | Allele size range (bp) | T a (°C) | Fluorescent label | GenBank accession no. |
|---|---|---|---|---|---|---|
| RGROE001 | F: TTCACCCTCTTCAGATCTTCGG | (AAAAAC)6 | 149–167 | 59.2 | NED | MN428531 |
| R: GTTTACAACTCTAGACATCGGATCAC | ||||||
| RGROE002 | F: AGGCTTGTGGGAGTAGTAAGTG | (AAAAC)6 | 340–350 | 59.8 | PET | MN428532 |
| R: GTTTCTGCATAGTGTGTCCATGC | ||||||
| RGROE003 | F: AGGCTTGTGGGAGTAGTAAGTG | (AAAAC)6 | 340–350 | 60.1 | PET | MN428533 |
| R: GTTTCTGCGTAATGTGTCCATGC | ||||||
| RGROE004 | F: AATTTGGCTTTGTTCGGTAGC | (AAAACT)6 | 190–202 | 58.6 | NED | MN428534 |
| R: GTTTGGTTGTGTTTGGTTGGC | ||||||
| RGROE012 | F: AGGAAGTGTTTGAATGGGTTGG | (AAC)8 | 347–365 | 59.8 | VIC | MN428535 |
| R: GTTTCCTCGCCTTGATTTGTGC | ||||||
| RGROE015 | F: AAATTCGAAGCCACCATAGTTG | (AAG)8 | 139–160 | 58.1 | 6‐FAM | MN428536 |
| R: GTTTGTTGGCTATCCTCTTCCG | ||||||
| RGROE019 | F: TGAATGTTGAATCGGGTGCG | (AAGGAC)8 | NA | 59.1 | VIC | MN428537 |
| R: GTTTAGTGGATGGGACTTGTTCTTC | ||||||
| RGROE020 | F: TGCGCAATATGTGGACGTAC | (AAGGAG)6 | 233–275 | 59.6 | PET | MN428538 |
| R: GTTTGTTCAATGGCGGAGTGG | ||||||
| RGROE021 | F: TGCAGTAGACTCATTGCAGC | (AAT)9 | 115–130 | 59.1 | 6‐FAM | MN428539 |
| R: GTTTCCTCGGTGCCAAGAATTG | ||||||
| RGROE027 | F: GCGACACGTATAGGCAAATTG | (ACC)8 | 245–260 | 58.9 | PET | MN428540 |
| R: GTTTGGTGATTTCTTGGCCGATC | ||||||
| RGROE036 | F: CAAGGCGTTGTAAAGGATTTCC | (AG)36 | 305–377 | 58.8 | PET | MN428541 |
| R: GTTTCCCTCTGGTTTGGTGTG | ||||||
| RGROE041 | F: AGCAACTATAATGGCGGAGG | (AGG)8 | 119–125 | 58.4 | 6‐FAM | MN428542 |
| R: GTTTAACTAGAGCCAAGACTGCG | ||||||
| RGROE042 | F: ACAATTGTCAGTGGCCAGAAC | (AGG)11 | NA | 60.1 | 6‐FAM | MN428543 |
| R: GTTTCAACACCCATGGCAAGTG | ||||||
| RGROE045 | F: TGTCGCCGTTATAACCATCG | (AT)21 | 343–357 | 60.0 | VIC | MN428544 |
| R: GTTTACACGCAACTCCACTGATC | ||||||
| RGROE046 | F: TGGTTGGAGGCCTATGGTTATC | (ATC)9 | 212–236 | 60.0 | NED | MN428545 |
| R: GTTTGTCGGAGTGGTTGCTATG | ||||||
| RGROE047 | F: AACCATTGACAAGCAGCATTAC | (ATCC)6 | 160–176 | 58.4 | NED | MN428546 |
| R: GTTTACCATTCTTGACCCTGCTAG |
NA = markers did not genotype well and are not included in analyses; T a = annealing temperature.
Pigtail sequence is underlined on reverse primers.
Resulting chromatograms were manually scored using Geneious 11.1.5. We employed strict criteria for calling peaks. First, a peak was called only if the relative fluorescence unit (RFU) was ≥3000 and exhibited little background noise relative to signal. Additionally, a second peak (i.e., a heterozygote) was called only if the secondary peak's RFU was ≥90% of the first peak. Consequently, our measurements of genetic diversity are conservative. Descriptive statistics, including Hardy–Weinberg equilibrium (HWE) deviations, multilocus matches analysis (MMA) and principal coordinate analysis (PCoA) (Orloci, 1978), were calculated using GenAlEx version 6.503 (Peakall and Smouse, 2006, 2012). Two markers, RGROE019 and RGROE042, did not genotype consistently and were not developed further.
Although some past studies have allowed the possibility that R. groenlandicum is polyploid, 14 loci revealed chromatograms with one to two peaks per individual. Our scoring of peaks is conservative in terms of genetic diversity, and therefore may underscore alleles associated with dosage differences. Although there was very little background noise/stutter in our data set, failure to detect polyploidy using this methodology is acknowledged. Overall, however, we conclude that individuals sampled here are diploid.
Fourteen polymorphic loci exhibited one to eight alleles per population (mean 2.81) (Table 2). No more than two peaks per individual were observed. Observed heterozygosity ranged from 0.000–0.636 (mean 0.125). HWE expectations were not met for 11 loci (78.6%) in at least one population including RGROE045, which violated HWE assumptions in all three sampled populations. The 14 polymorphic loci easily differentiated the populations, demonstrated by genetic distance followed by PCoA (not shown). The first three axes of the PCoA explained 52.61% of the variation and showed a clear division between the Sitka, Alaska, USA, population and the other two populations, which were moderately differentiated. The MMA of the 14 polymorphic loci revealed two sets of identical individuals within the Sitka population, suggesting limited clonality. The MMA and PCoA results together suggest considerable population structure within R. groenlandicum. The 14 developed markers were cross‐amplified within a phylogenetic context following Hart et al. (2017). This included 12 individuals from Rhododendron subsect. Ledum (five R. columbianum (Piper) Harmaja, three R. tomentosum, and one each of R. diversipilosum (Nakai) Harmaja, R. hypoleucum (Kom.) Harmaja, R. palustre (L.) Kron & Judd, and R. tolmachevii (Tolm.) Harmaja). Amplification of all developed markers (Table 3) was successful in all species except marker RGROE002, which failed to amplify in any R. tomentosum individual.
Table 2.
Descriptive statistics for 14 microsatellite loci developed for Rhododendron groenlandicum.a
| Locus | NW Territory, Canada (N = 24) | Sitka Co., AK (N = 22) | Washington Co., ME (N = 22) | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| A | H o | H e | HWEb | A | H o | H e | HWEb | A | H o | H e | HWEb | |
| RGROE001 | 2 | 0.174 | 0.287 | NS | 1 | 0.000 | 0.000 | M | 2 | 0.091 | 0.087 | NS |
| RGROE002 | 3 | 0.188 | 0.498 | ** | 2 | 0.091 | 0.087 | NS | 3 | 0.095 | 0.316 | ** |
| RGROE003 | 3 | 0.100 | 0.515 | *** | 2 | 0.053 | 0.049 | NS | 2 | 0.000 | 0.245 | *** |
| RGROE004 | 2 | 0.050 | 0.049 | NS | 1 | 0.000 | 0.000 | M | 1 | 0.000 | 0.000 | M |
| RGROE012 | 2 | 0.125 | 0.117 | NS | 2 | 0.636 | 0.496 | NS | 3 | 0.143 | 0.125 | NS |
| RGROE015 | 2 | 0.083 | 0.153 | * | 4 | 0.273 | 0.674 | *** | 4 | 0.381 | 0.690 | * |
| RGROE020 | 2 | 0.150 | 0.219 | NS | 4 | 0.000 | 0.449 | *** | 2 | 0.000 | 0.397 | *** |
| RGROE021 | 2 | 0.042 | 0.041 | NS | 2 | 0.000 | 0.091 | *** | 1 | 0.000 | 0.000 | M |
| RGROE027 | 3 | 0.042 | 0.322 | *** | 3 | 0.048 | 0.291 | *** | 3 | 0.182 | 0.169 | NS |
| RGROE036 | 8 | 0.238 | 0.773 | *** | 7 | 0.333 | 0.373 | NS | 7 | 0.429 | 0.532 | *** |
| RGROE041 | 2 | 0.000 | 0.080 | *** | 1 | 0.000 | 0.000 | M | 1 | 0.000 | 0.000 | M |
| RGROE045 | 5 | 0.000 | 0.753 | *** | 2 | 0.000 | 0.408 | *** | 6 | 0.238 | 0.706 | *** |
| RGROE046 | 3 | 0.000 | 0.277 | *** | 4 | 0.545 | 0.518 | NS | 3 | 0.455 | 0.577 | NS |
| RGROE047 | 2 | 0.042 | 0.043 | NS | 3 | 0.045 | 0.208 | *** | 1 | 0.000 | 0.000 | M |
| Mean | 2.929 | 0.088 | 0.295 | 2.714 | 0.144 | 0.260 | 2.786 | 0.144 | 0.275 | |||
A = number of alleles detected across all individuals; H e = expected heterozygosity; H o = observed heterozygosity; HWE = Hardy–Weinberg equilibrium.
Voucher and locality information are provided in Appendix 1.
Asterisks (*) indicate statistically significant deviation from HWE (*P < 0.05; **P < 0.01; ***P < 0.001). M = monomorphic marker; NS = not statistically significant.
Table 3.
Cross‐amplification of 14 primer pairs developed for Rhododendron groenlandicum in representatives from Rhododendron subsect. Ledum.a
| Locus | Rcol1 | Rcol2 | Rcol3 | Rcol4 | Rcol5 | Rtom1 | Rtom2 | Rdiv | Rhyp | Rpal | Rtol |
|---|---|---|---|---|---|---|---|---|---|---|---|
| RGROE001 | 149 | 155 | 143 | 149 | 149 | 149 | 149 | 155 | 155 | 149 | 161 |
| RGROE002 | 340 | — | — | 345 | 345 | — | — | 345 | 335 | 335 | 340 |
| RGROE003 | 345 | — | — | 340 | 335 | — | 350 | 335 | 345 | 355 | 345 |
| RGROE004 | 202 | — | — | 202 | 196 | 202 | 196 | 184 | 196 | 184 | 184 |
| RGROE012 | 353 | 350 | — | 344 | 350 | 356 | 353 | 350 | 356 | 356 | 347 |
| RGROE015 | 133 | — | — | 136 | 133 | 133 | 133 | 136 | 136 | 142 | 133 |
| RGROE020 | 236 | 248 | 272 | 245 | 257 | 253 | 257 | 257 | 263 | 248 | 263 |
| RGROE021 | — | 112 | 115 | 124 | 115 | 112 | 127 | 133 | 127 | 130 | 124 |
| RGROE027 | 260 | 248 | 257 | 242 | 248 | 245 | 242 | 242 | 242 | 248 | 254 |
| RGROE036 | 311 | 323 | 309 | 367 | 365 | 311 | 325 | 305 | 307 | 313 | 311 |
| RGROE041 | 116 | 131 | 116 | 116 | 116 | 125 | 113 | 110 | 116 | 116 | 131 |
| RGROE045 | 343 | 349 | 343 | 345 | 345 | — | 349 | 341 | 349 | 341 | 341 |
| RGROE046 | 215 | 209 | 215 | 212 | 212 | 218 | 212 | 212 | 215 | 215 | 221 |
| RGROE047 | 160 | 160 | 160 | 164 | 168 | 168 | 160 | 172 | 172 | 160 | 164 |
— = no observable amplification; Rcol = Rhododendron columbianum; Rtom = Rhododendron tomentosum; Rdiv = Rhododendron diversipilosum; Rhyp = Rhododendron hypoleucum; Rpal = Rhododendron palustre; Rtol = Rhododendron tolmachevii.
Ranges of allele sizes are given when at least two individuals per species were sampled.
CONCLUSIONS
These newly developed microsatellite markers represent the first such tool for use in Labrador tea and its close relatives. The markers will allow population‐level investigation within R. groenlandicum but are likely to also aid in clarifying the evolutionary history of Rhododendron subsect. Ledum, including investigation of species boundaries and putative hybridization events. The markers presented here are collectively able to demonstrate considerable genetic structure in just three populations of R. groenlandicum and genotype well in all sampled species within Rhododendron subsect. Ledum, likely because of inter‐species similarity resulting from recent and ongoing divergence of these species.
AUTHOR CONTRIBUTIONS
K.L.L. and E.M. conducted all fieldwork (but see Acknowledgments). E.L.G. carried out all bioinformatics and project design aspects and analyzed the data. M.L.S. conducted the majority of the lab work with assistance from E.L.G. M.L.S. drafted the manuscript for submission, and all co‐authors commented on and edited the manuscript.
ACKNOWLEDGMENTS
The authors acknowledge Ms. Gail Beaulieu and Ms. Suzanne Carriere (Government of Northwest Territories) for collections from Northwest Territories, Canada. Startup funding to E.L.G. was provided by Butler University and Marshall University. We acknowledge iNaturalist (http://www.iNaturalist.org) for publicly available observation data that were critical in identifying localities and collaborators to accomplish field collections for this widespread species.
APPENDIX 1. Voucher information for Rhododendron individuals included in this study.
| Species | Geographic coordinates | ||||||
|---|---|---|---|---|---|---|---|
| Voucher (Herbarium) | Latitude | Longitude | Elevation (m) | State (Country) | County/unit | N | |
| Rhododendron groenlandicum (Oeder) Kron & Judd | Antieau 01‐29 (WTU)a | 47.40 | −121.92 | 228 | Washington (USA) | King | 1 |
| Rhododendron groenlandicum | Beaulieu s.n. (BUT)b | 61.17 | −113.68 | 158 | NW Territories (CAN) | Fort Smith | 24 |
| Rhododendron groenlandicum | LaBounty s.n. (BUT)b | 57.06 | −135.19 | 151 | Alaska (USA) | Sitka | 22 |
| Rhododendron groenlandicum | Mitchell 473 (BUT)b | 44.56 | −67.61 | 8 | Maine (USA) | Washington | 22 |
| Rhododendron columbianum (Piper) Harmaja | Arnot 73 (WTU)c | 48.52 | −120.67 | 1654 | Washington (USA) | Chelan | 1 |
| Rhododendron columbianum | Denton 4271 (WTU)c | 41.01 | −123.08 | 1584 | California (USA) | Trinity | 1 |
| Rhododendron columbianum | Denton 3144 (WTU)c | 42.04 | −123.02 | 938 | Oregon (USA) | Curry | 1 |
| Rhododendron columbianum | Smith 3172 (WTU)c | 45.63 | −115.68 | 1615 | Idaho (USA) | Valley | 1 |
| Rhododendron columbianum | Kruckeberg 6547 (WTU)c | 48.96 | −119.80 | 2134 | Washington (USA) | Okanogen | 1 |
| Rhododendron tomentosum Harmaja | Putnam 24 (WTU)c | 70.48 | −155.06 | 1 | Alaska (USA) | North Slope | 1 |
| Rhododendron tomentosum | LaBounty s.n. (WTU)c | 59.26 | −135.84 | 244 | Alaska (USA) | Haines | 1 |
| Rhododendron tomentosum | Gustafsen s.n. (WTU)c | 69.361 | −145.08 | 866 | Alaska (USA) | North Slope | 1 |
| Rhododendron diversipilosum (Nakai) Harmaja | Kihlman 20040770 (ARS)c | 43.35 | −142.91 | 837 | Hokkaido (Japan) | NA | 1 |
| Rhododendron hypoleucum (Kom.) Harmaja | Larsen 87/04 (ARS)c | — | — | — | — | NA | 1 |
| Rhododendron palustre (L.) Kron & Judd | Chase MWC869 (K)c | 50.14 | −86.30 | 1052 | Siberia (Russia) | Kurai | 1 |
| Rhododendron tolmachevii (Tolm.) Harmaja | Theqvist 20040806 (ARS)c | 53.56 | −127.41 | 365 | Amur (Russia) | NA | 1 |
— = horticulture specimen of uncertain provenance; N = number of individuals; NA = not available; ARS = American Rhododendron Society Rhododendron Species Botanical Garden, Federal Way, WA; BUT = Friesner Herbarium (Butler University); K = Royal Botanic Garden Kew Herbarium; WTU = Burke Museum (University of Washington).
Voucher for Illumina sequencing.
Voucher for marker development (separate collection effort).
Voucher for cross‐amplification.
Sheik, M. L. , LaBounty K. L., Mitchell E., and Gillespie E. L.. 2019. Fourteen polymorphic microsatellite markers for the widespread Labrador tea (Rhododendron groenlandicum). Applications in Plant Sciences 7(12): e11306.
DATA AVAILABILITY
The raw sequence reads are deposited in the National Center for Biotechnology Information (NCBI; GenBank Sequence Read Archive accession no. PRJNA577479). Sequence information for the developed primers has been deposited to NCBI; accession numbers are provided in Table 1.
LITERATURE CITED
- Brownstein, M. J. , Carpten J. D., and Smith J. R.. 1996. Modulation of non‐templated nucleotide addition by Taq DNA polymerase: Primer modifications that facilitate genotyping. BioTechniques 20: 1004–1006, 1008–1010. [DOI] [PubMed] [Google Scholar]
- Doyle, J. J. , and Doyle J. L.. 1987. A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochemical Bulletin 19: 11–15. [Google Scholar]
- Drábková, L. , Kirschner J., and Vlček Č.. 2002. Comparison of seven DNA extraction and amplification protocols in historical herbarium specimens in Juncaceae. Plant Molecular Biology Reporter 20: 161–175. [Google Scholar]
- Faircloth, B. C. 2008. MSATCOMMANDER: Detection of microsatellite repeat arrays and automated, locus‐specific primer design. Molecular Ecology Resources 8: 92–94. [DOI] [PubMed] [Google Scholar]
- Gillespie, E. L. , Pauley A. G., Haffner M. L., Hay N. M., Estep M. C., and Murrell Z. E.. 2017. Fourteen polymorphic microsatellite markers for a widespread limestone endemic, Carex eburnea (Cyperaceae: Carex sect. Albae). Applications in Plant Sciences 5(8): 1700031. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Hart, A. , Kron K., and Gillespie E. L.. 2017. Molecular phylogenetic analysis of the north‐temperate Labrador Teas (Ericaceae: Rhododendron subsect. Ledum) suggests a complex genetic history. Journal of the Botanical Institute of Texas 11(1): 53–65. [Google Scholar]
- Kasireddy, V. , Mitchell E., Murrell Z. E., and Gillespie E. L.. 2018. Fifteen microsatellite markers for the Appalachian rockcap fern, Polypodium appalachianum (Polypodiaceae), and its relatives. Applications in Plant Sciences 6(11): e1195. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kearse, M. , Moir R., Wilson A., Stones‐Havas S., Cheung M., Sturrock S., Buxton S., et al. 2012. Geneious Basic: An integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics 28(12): 1647–1649. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kron, K. A. , and Judd W. S.. 1990. Phylogenetic relationships within the Rhodoreae (Ericaceae) with specific comments on the place of Ledum . Systematic Botany 15(1): 57–68. [Google Scholar]
- Lantai, K. , and Kihlman B.. 1995. The chromosome number of Ledum palustre ssp. decumbens and of some related taxa. Hereditas 122: 181–184. [Google Scholar]
- Löve, A. , and Löve D.. 1982. IOPB chromosome number reports LXXV. Taxon 31(2): 344–360. [Google Scholar]
- Orloci, L. 1978. Multivariate analysis in vegetation research. Dr. W. Junk B. V., The Hague, The Netherlands. [Google Scholar]
- Palmer, J. D. 1986. Isolation and structural analysis of chloroplast DNA. Methods in Enzymology 118: 167–186. [Google Scholar]
- Peakall, R. , and Smouse P. E.. 2006. GenAlEx 6: Genetic analysis in Excel. Population genetic software for teaching and research. Molecular Ecology Notes 6: 288–295. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Peakall, R. , and Smouse P. E.. 2012. GenAlEx 6.5: Genetic analysis in Excel. Population genetic software for teaching and research—an update. Bioinformatics 28: 2537–2539. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
The raw sequence reads are deposited in the National Center for Biotechnology Information (NCBI; GenBank Sequence Read Archive accession no. PRJNA577479). Sequence information for the developed primers has been deposited to NCBI; accession numbers are provided in Table 1.