Skip to main content
Experimental and Therapeutic Medicine logoLink to Experimental and Therapeutic Medicine
. 2019 Nov 29;19(1):557–568. doi: 10.3892/etm.2019.8261

The preventive effect of Apocynum venetum polyphenols on D-galactose-induced oxidative stress in mice

Huan Guo 1,*, Zhiping Kuang 1,*, Jing Zhang 2, Xin Zhao 3, Ping Pu 1,, Junfeng Yan 4,
PMCID: PMC6923744  PMID: 31897099

Abstract

Apocynum venetum is a traditional medicine that is rich in polyphenols. Apocynum venetum polyphenol extract (AVP) contains the active substances neochlorogenic acid, chlorogenic acid, rutin, isoquercitrin, astragaloside and rosmarinic acid. In the present study, the preventive effect of AVP against D-galactose-induced oxidative stress was studied in a mouse model. The sera, skin, livers and spleens of mice were examined using hematoxylin and eosin staining, reverse transcription-quantitative PCR and western blot analysis. The biochemical results showed that AVP improved the thymus, brain, heart, liver, spleen and kidney indices in a mouse model of oxidative stress. AVP was also able to reverse the reduction in levels of superoxide dismutase (SOD), glutathione peroxidase and glutathione, and increased the levels of nitric oxide and malondialdehyde identified in the serum, liver, spleen and brain of mice exposed to oxidative stress. Pathological observations confirmed that AVP could inhibit oxidative damage to the skin, liver and spleen of mice caused by D-galactose. Further molecular biological experiments also demonstrated that AVP increased the expression of neuronal nitric oxide synthase, endothelial nitric oxide synthase, Cu/Zn-SOD, Mn-SOD, catalase, heme oxygenase-1, nuclear factor-erythroid 2-related factor 2, γ-glutamylcysteine synthetase and NAD(P)H quinone dehydrogenase 1 and reduced the expression of inducible nitric oxide synthase in the liver and spleen of treated mice compared to controls. Notably, the preventive effect of AVP against D-galactose-induced oxidative damage in mice was better than that of the confirmed antioxidant vitamin C. In conclusion, AVP exhibited an antioxidant effect and the AVP-rich Apocynum venetum may be considered a plant resource with potential antioxidative benefits.

Keywords: Apocynum venetum, polyphenol, D-galactose, oxidation, Cu/Zn-superoxide dismutase expression

Introduction

Apocynum venetum L. (A. venetum), a genus of the plant family Apocynaceae, is distributed throughout the temperate regions of Eurasia and North America (1). The dried leaves of A. venetum are used as treatments in traditional Chinese medicine (TCM) and also as a tea. A. venetum leaves have been suggested to lower cholesterol and blood pressure, and are prescribed in TCM for sedation, as antidepressants and as anti-anxiety treatments, due to the reported action of A. venetum on the nervous system (2). A. venetum has also been reported to exert an antioxidative effect, the mechanism of which is thought to be related to free radical scavenging and diuresis (25). The polyphenols found in A. venetum leaves potentially represent a new class of active ingredients (2).

Oxidative stress is an endogenous process that gradually damages the body. Oxidative stress aggravates various diseases, including hypertension, type 2 diabetes mellitus, atherosclerosis and dementia (68). Excessive redox-active species and free radicals can also cause oxidative damage of biological macromolecules, which leads to oxidative stress in the body. Oxidative stress promotes the production of hydrogen peroxide in mitochondria, which in turn increases oxidative damage (9). Redox regulation is an important focus in the study of oxidative stress. Maintaining the redox balance and regulating redox-related genes are important strategies to alleviate oxidative stress (10).

D-galactose is a commonly used aging-inducing agent in research that can be used to establish animal models of oxidative stress. A small amount of D-galactose can be converted to glucose and metabolized by the body. However, excessive D-galactose leads to a disordered cellular metabolism, alters the activity of oxidase in tissues and cells, and produces a large number of superoxide anions and oxidative products, which results in oxidative damage to both the structure and function of biological macromolecules (11). The oxidation model of D-galactose has been established to verify the antioxidant effect of antioxidant active substances. This model has been utilized in the research and development of antioxidant health products (12).

A previous study indicated that plant polyphenols have antioxidant and free radical scavenging capacities, due to their structural characteristics. The phenolic hydroxyl structure, particularly the ortho-phenolic hydroxyl in catechol or pyrogallol, is easily oxidized to a quinone structure; this makes it capable of capturing free radicals, such as reactive oxygen species (2). This structure can reduce or prevent the oxidation reaction in tissues by binding to lipid free radicals produced in oxidation (13). Plant polyphenols have also been shown to exert antioxidative effects in animals and humans in clinical studies (14,15). Plant polyphenols act as antioxidants via increases in the activities of three important antioxidant enzymes: Superoxide dismutase (SOD), glutathione (GSH) peroxidase (GSH-Px) and catalase (CAT) (16).

In the present study, A. venetum polyphenol extract (AVP) was extracted and was administered to mice subjected to D-galactose-induced oxidative stress. The effects of AVP on the serum and tissues of oxidized mice were observed, and the mechanism of AVP-induced prevention of oxidation was studied through the detection of oxidative stress-related genes. This study provides a theoretical basis for further research into the use of AVP as a medical treatment.

Materials and methods

Extraction of AVP

Briefly, 500 g A. venetum (Huake Ecology Agriculture & Forestry Technology Co., Ltd.) was crushed into a fine powder. Ethanol solution (50 ml; volume ratio: 45%) was added to the powder for mixing and extraction at 90°C for 30 min using a vortex shaker (TRS 140, Shanghai Brave Construction Development Co., Ltd; Shanghai Dam Industrial Co., Ltd.). After three rounds of extraction and the mixing, the pH of the extract was adjusted to 6.0 using 2.877 mol/l HCl. A mixed precipitant of AlCl3 (30 g) and ZnCl2 (60 g) was added (in a volume of 800 ml) to the extract for precipitation, followed by centrifugal separation at 1,700 × g for 10 min at 25°C. Hydrochloric acid (volume ratio: 12%; 1 l) was added to the precipitate after centrifugation. The supernatant was separated using a separating funnel, and then, 100 ml ethyl acetate was added twice for extraction by vortex shaker. The extract was then subjected to rotary evaporation to obtain AVP, as previously reported (17).

High-performance liquid chromatography (HPLC)

HPLC was performed using the Ultimate 3000 system (Thermo Fisher Scientific, Inc.). The reference substances neochlorogenic acid, chlorogenic acid, rutin, isoquercitrin, astragaloside and rosmarinic acid (20 mg of each substance; Shanghai Yuanye Bio-Technology Co., Ltd.) were weighed and added to methanol at a chromatographic level of 2 ml. The reference substances were dissolved by full oscillation and reference substance reserve solutions were obtained. The two mobile phase solvents were: Mobile phase A, 0.5% acetic acid water; mobile phase B, acetonitrile. The flow rate was 0.5 ml/min. Accucore™ C18 chromatography columns (particle size 2.6 µm; dimensions, 4.6×150 mm; Thermo Fisher Scientific, Inc.) were used. The injection volume was 10 µl and the column temperature was 30°C. The detection wavelength was 328 nm and the gradient conditions 0–30 min, 12–45% (phase B); 30–35 min, 45–100% (phase B); 35–40 min, 100% (phase B) were used to determine the components of the AVP.

Animal oxidation experiment

A total of 50 specific-pathogen-free-grade Institute of Cancer Research mice (age, 6 weeks; weight, 25±2 g; 25 male and 25 female) were allowed 1 week to adapt to a temperature of 25±2°C and a relative humidity of 50±5%. All mice received a normal diet and food and water were freely available. The mice were then divided into the following five groups: Control group, model group, AVP low-concentration (AVP-L) group, AVP high-concentration (AVP-H) group, and vitamin C (Vc) group. There were 10 mice (5 male and 5 female) per group.

During the first 4 weeks, mice in the model group and the control group received normal diet and drinking water, and each mouse received 0.2 ml saline per day by gavage. Mice in the AVP-L and AVP-H groups were treated with AVP at 50 or 100 mg/kg once per day by gavage. Mice in the Vc group were treated with Vc (Hefei Bomei Biotechnology Co., Ltd.) at 100 mg/kg daily by gavage. After 4 weeks, mice in the groups other than the control group were intraperitoneally injected with D-galactose (Hefei Bomei Biotechnology Co., Ltd.) at a concentration of 120 mg/kg once per day for 6 weeks. At the same time, mice in the AVP-L, AVP-H and Vc groups were also treated with AVP and Vc once per day for 6 weeks by gavage, whereas mice in the model group and the control group received the equivalent dose of saline (12). At 10 weeks, all mice were sacrificed after 24 h of fasting. Mice were euthanized using cervical dislocation. Blood samples were collected from heart and liver tissues and stored until further experiments. The organ indices of the thymus, brain, heart, liver, spleen and kidney were measured, as follows: Organ index=organ mass (g)/body mass of mouse (kg) ×100. These experiments followed a protocol approved by the Animal Ethics Committee of Chongqing Collaborative Innovation Center for Functional Food (approval no. 200802002B).

Determination of nitric oxide (NO) and malondialdehyde (MDA) concentration, and SOD and GSH-Px activity in serum and liver tissues

Mouse blood (0.1 ml) was centrifuged at 2,100 × g for 10 min at 25°C and the serum was collected. The concentrations of NO (A012-1-2) and MDA (A003-1-2), and the activities of SOD (A001-3-2) and GSH-Px (A005-1-2) in the serum were determined using their respective kits, following the instructions of the manufacturers (Nanjing Jiancheng Bioengineering Institute). In addition, a total of 2 g liver and brain tissue was placed into a glass homogenate tube, 18 ml saline was added into the homogenate tube, and the homogenate was ground up and down at 2,100 r/min using a tissue masher (TENLIN-C; Jiangsu Tianling Instrument Co., Ltd.) for 10 min to produce a 10% homogenate of liver and brain tissues. The concentrations of NO and MDA, and the activities of SOD and GSH-Px were determined in these homogenates, using the aforementioned kits.

Observation of skin, liver and spleen tissues

Approximately 0.5 cm2 skin, liver and spleen tissues of mice were removed and fixed in 10% formalin solution for 48 h at 4°C. Skin, liver and spleen tissues were dehydrated gradually through 70, 80, 90% and anhydrous ethanol, and the tissues were paraffin wax embedded sectioned (10 µm) and permabilized for hematoxylin and eosin (H&E) staining for 25 min at 25°C. Morphological changes in the tissues were observed (×100) under an optical microscope (BX43; Olympus Corporation). A section was prepared from the skin, liver and kidney of each mouse and 3 fields of view were imaged per section.

Reverse transcription-quantitative PCR (RT-qPCR)

The skin, liver and spleen tissues (0.1g) of mice were crushed using a tissue masher (TENLIN-C, Jiangsu Tianling Instrument Co., Ltd.) RNAzol® (Sigma-Aldrich; Merck KGaA) was used to extract total RNA from tissues, and the concentration of the extracted total RNA was diluted to 1 µg/µl. Subsequently, 5 µl diluted total RNA solution was collected, and RT was conducted according to the instructions of the RT kit (Tiangen Biotech Co., Ltd.) to obtain the cDNA template at 25°C. cDNA template (2 µl) was mixed with 10 µl SYBR Green PCR Master Mix (Thermo Fisher Scientific, Inc.) and 1 µl upstream and downstream primers (Table I). The reaction conditions were as follows: 95°C for 60 sec, followed by 40 cycles of 95°C for 15 sec and 55°C for 30 sec followed by a final step at 72°C for 35 sec. A StepOnePlus Real-Time PCR system (Thermo Fisher Scientific, Inc.) was used for qPCR. GAPDH was used as an internal reference. The 2−ΔΔCq method was used to determine the relative gene expression (18).

Table I.

Primer sequences.

Gene name Sequence (5′-3′)
nNOS Forward: ACGGCAAACTGCACAAAGC
Reverse: CGTTCTCTGAATACGGGTTGTTG
eNOS Forward: TCAGCCATCACAGTGTTCCC
Reverse: ATAGCCCGCATAGCGTATCAG
iNOS Forward: GTTCTCAGCCCAACAATACAAGA
Reverse: GTGGACGGGTCGATGTCAC
Cu/Zn-SOD Forward: AACCAGTTGTGTTGTCAGGAC
Reverse: CCACCATGTTTCTTAGAGTGAGG
Mn-SOD Forward: CAGACCTGCCTTACGACTATGG
Reverse: CTCGGTGGCGTTGAGATTGTT
CAT Forward: GGAGGCGGGAACCCAATAG
Reverse: GTGTGCCATCTCGTCAGTGAA
HO-1 Forward: ACAGATGGCGTCACTTCG
Reverse: TGAGGACCCACTGGAGGA
Nrf2 Forward: CAGTGCTCCTATGCGTGAA
Reverse: GCGGCTTGAATGTTTGTC
γ-GCS Forward: GCACATCTACCACGCAGTCA
Reverse: CAGAGTCTCAAGAACATCGCC
NQO1 Forward: CTTTAGGGTCGTCTTGGC
Reverse: CAATCAGGGCTCTTCTCG
GAPDH Forward: AGGTCGGTGTGAACGGATTTG
Reverse: GGGGTCGTTGATGGCAACA

γ-GCS, γ-glutamylcysteine synthetase; CAT, catalase; eNOS, endothelial nitric oxide synthase; HO-1, heme oxygenase-1; iNOS, inducible nitric oxide synthase; nNOS, neuronal nitric oxide synthase; Nrf2, nuclear factor-erythroid 2 related factor 2 NQO1, NAD(P)H quinone dehydrogenase 1; SOD, superoxide dismutase.

Western blotting

Liver tissue (100 mg) was homogenized in 1 ml RIPA buffer (Thermo Fisher Scientific, Inc.) containing 10 µl phenylmethylsulfonyl fluoride, and centrifuged at 6,700 × g at 4°C for 5 min. The middle protein layer was taken to measure the protein concentration using a bicinchoninic acid kit (Bio-Rad Laboratories, Inc.). The samples were diluted to 50 µg/µl, mixed with sample buffer (4:1) and heated at 100°C for 5 min. SDS-PAGE (12%) was carried out and 10 µg of protein was loaded per lane and proteins were transferred onto a PVDF membrane. Membranes were blocked in TBS-0.05% Tween (TBST) containing 5% skim milk for 1 h at 25°C. After blocking, the membrane was incubated at 25°C for 2 h with primary antibodies against Cu/Zn-SOD (cat. no. PA5-270240; 1:1,000), Mn-SOD (cat. no. LF-MA0030; 1:1,000) and beta-actin (cat. no. MA5-15739; 1:1,000). The membrane was then washed with TBST and incubated at 25°C for 1 h with secondary antibody (cat. no. A32723; 1:500) (17). All antibodies were supplied by Thermo Fisher Scientific, Inc. SuperSignal™ West Pico Plus was used to visualize proteins by iBright FL1000 (both Thermo Fisher Scientific, Inc.). ImageJ version 1.44 (National Institutes of Health) was used for semi-quantitative analysis of protein expression.

Statistical analysis

Serum and tissue experiments were conducted three times in parallel with each mouse, and the mean values were obtained. SAS® version 9.1 statistical software (SAS Institute, Inc.) was used to analyze the data. One-way ANOVA followed by Tukey's test was used for multiple comparisons. P<0.05 (alpha level) was considered to indicate a statistically significant difference (19).

Results

AVP component analysis

Analysis by HPLC identified that AVP contained six known chemical constituents, namely neochlorogenic acid, chlorogenic acid, rutin, isoquercitrin, astragalin and rosmarinic acid (Fig. 1). Among them, isoquercitrin made up the greatest proportion, followed by neochlorogenic acid and chlorogenic acid (Table II).

Figure 1.

Figure 1.

Constituents of Apocynum venetum polyphenol extract. (A) Standard chromatogram. (B) AVP chromatogram. 1, neochlorogenic acid; 2, chlorogenic acid; 3, rutin; 4, isoquercitrin; 5, astragalin; 6, rosmarinic acid; AVP, Apocynum venetum.

Table II.

Constituents of Apocynum venetum polyphenol extract.

Substance Concentration (mg/ml)
Neochlorogenic acid   9.98
Chlorogenic acid   4.94
Rutin   0.81
Isoquercitrin 10.87
Astragalin   0.78
Rosmarinic acid   0.21

Organ indices of mice

As shown in Table III, mice in the control group had the highest indices in the thymus, brain, heart, liver, spleen and kidney, whereas mice in the model group had the lowest organ indices. Both AVP and Vc significantly increased organ indices when compared with the model group (P<0.05). The effect of AVP appeared superior to that of Vc at the same concentration. These data suggested that AVP could inhibit the decline of organ indices caused by oxidative stress-induced tissue atrophy.

Table III.

Organ indices of mice in each group (n=10).

Group Thymus index Brain index Cardiac index Liver index Spleen index Kidney index
Normal 0.29±0.04b 5.13±0.22b 3.57±0.19b 23.12±1.13b 1.65±0.11a 4.50±0.30b
Model 0.16±0.3 3.34±0.20 1.95±0.19 17.17±0.97 1.00±0.10 2.79±0.17
Vc 0.23±0.02a 4.43±0.20b 2.88±0.09a 20.90±0.90a 1.45±0.10a 3.89±0.15a
AVP-L 0.20±0.04a 3.79±0.16a 2.46±0.10a 19.47±1.05a 1.32±0.08a 3.54±0.23a
AVP-H 0.26±0.02a 4.75±0.22b 3.14±0.16b 21.92±0.98a 1.54±0.08a 4.13±0.17b

Values are presented as the mean ± standard deviation (N=10/group).

a

P<0.05

b

P<0.01 vs. the model group. Vc, mice treated with Vc (100 mg/kg); AVP-L, mice treated with a low concentration of AVP (50 mg/kg); AVP-H, mice treated with a high concentration of AVP (100 mg/kg). AVP, Apocynum venetum polyphenol extract; Vc, vitamin C.

Levels of NO, SOD, GSH-Px, GSH and MDA

As shown in Tables IVVII, mice in the control group exhibited the strongest SOD, GSH-Px and GSH activity, and the lowest NO and MDA levels in the serum, liver, spleen and brain compared with the other groups. Mice in the model group had the lowest levels compared with the other groups. Following AVP treatment, SOD, GSH-Px and GSH activities in mice were significantly increased compared with the model group (P<0.05), whereas NO and MDA levels were significantly decreased (P<0.05). The aforementioned indicators improved until they were close to those of the control group following AVP-H treatment, and the effect was markedly better than that of Vc.

Table IV.

Levels of NO, SOD, GSH-Px, GSH and MDA in the serum of mice (n=10).

Group NO (µmol/l) SOD (U/ml) GSH-Px (U/ml) GSH (mg/l) MDA (nmol/ml)
Normal 19.90±0.62b 220.71±8.13b 212.09±5.05b 46.07±2.60b 3.91±0.36b
Model 60.83±1.04 65.20±1.44 73.39±3.11 11.41±0.56 41.60±1.29
Vc 34.47±0.80b 159.41±4.17b 136.67±4.26a 29.80±0.91a 19.03±1.17b
AVP-L 47.89±0.40a 97.60±3.41a 102.97±3.32a 20.69±0.71a 28.61±1.33a
AVP-H 26.42±0.44b 190.37±4.77b 175.63±4.43b 37.02±1.64b 11.03±0.20b

Values are presented as the mean ± standard deviation (n=10/group).

a

P<0.05

b

P<0.01 vs. the model group. Vc, mice treated with Vc (100 mg/kg); AVP-L, mice treated with low concentration of AVP (50 mg/kg); AVP-H, mice treated with a high concentration of AVP (100 mg/kg). AVP, Apocynum venetum polyphenol extract; GSH, glutathione; GSH-Px, glutathione peroxidase; MDA, malondialdehyde; NO, nitric oxide; SOD, superoxide dismutase; Vc, vitamin C.

Table VII.

Levels of NO, SOD, GSH-Px, GSH and MDA in the brains of mice (n=10).

Group NO (µmol/l) SOD (U/ml) GSH-Px (U/ml) GS (mg/l) MDA (nmol/ml)
Normal 4.62±0.21b 127.26±6.32b 166.39±7.52b 13.89±0.45b 0.42±0.11b
Model 12.50±0.61 35.10±1.25 41.10±2.49 2.17±0.18 6.32±0.43
Vc 7.15±0.19a 79.36±2.89a 115.25±5.88a 8.33±0.37a 1.57±0.10a
AVP-L 9.17±0.44a 61.25±3.05a 79.82±4.30a 4.29±0.31a 4.08±0.36a
AVP-H 6.03±0.32a 92.65±4.86b 137.86±5.38b 11.27±0.32b 0.79±0.12b

Values are presented as the mean ± standard deviation (N=10/group).

a

P<0.05

b

P<0.01 vs. the model group. Vc, mice treated with Vc (100 mg/kg); AVP-L, mice treated with low concentration of AVP (50 mg/kg); AVP-H, mice treated with a high concentration of AVP (100 mg/kg). AVP, Apocynum venetum polyphenol extract; GSH, glutathione; GSH-Px, glutathione peroxidase; MDA, malondialdehyde; NO, nitric oxide; SOD, superoxide dismutase; Vc, vitamin C.

Observation of the mice livers and spleens

As shown in Fig. 2, the epidermal structure of normal mice was complete and clear, and the dermis was rich in collagen fibers. The boundary between the dermis and epidermis was clear and the number of fat vacuoles was normal. In the model group, the amount of collagen fibers in the skin was very low and numerous fat vacuoles were visible. The dermis was inflammatory cells infiltrated, and the boundary between the dermis and the epidermis was unclear. AVP treatment reduced the large number of fat vacuoles caused by D-galactose, alleviated the phenomenon of infiltration, and allowed the boundary between epidermis and dermis to remain clear.

Figure 2.

Figure 2.

Hematoxylin and eosin staining of mouse skin. Magnification, ×100. Vc, mice treated with 100 mg/kg Vc; AVP-L, mice treated with a low concentration (50 mg/kg) of AVP; AVP-H, mice treated with a high concentration (100 mg/kg) of AVP. AVP, Apocynum venetum polyphenol extract; Vc, vitamin C. Arrows indicate inflammed tissue.

As shown in Fig. 3, in the control group, hepatic cell chords were radially arranged around the central vein, with a regular morphology and uniformly sized hepatocytes. Aggregation of inflammatory cells could not be seen. In the model group, the hepatic cells were disordered, with irregular cellular morphology. The cellular boundaries in this group were unclear. Cells appeared swollen and several cells exhibited incomplete nuclei, while a large number of cells presented inflammatory infiltration. AVP treatment appeared to promote order of hepatocytes and neatly arranged hepatic cords, protected the hepatocytes from damage and allowed the cell structure to remain clear in mice subjected to oxidative stress. The hepatic morphology of oxidative stress-treated mice became close to that of the normal group after AVP-H treatment.

Figure 3.

Figure 3.

Hematoxylin and eosin staining of mouse liver. Magnification, ×100. Vc, mice treated with 100 mg/kg Vc; AVP-L, mice treated with a low concentration (50 mg/kg) of AVP; AVP-H, mice treated with a high concentration (100 mg/kg) of AVP. AVP, Apocynum venetum polyphenol extract; Vc, vitamin C. Arrow indicates inflammed tissue.

As shown in Fig. 4, the spleen tissues of normal mice were complete, the corticomedullary junction was clear and the cells were neatly arranged. In the model group, the spleen structure was unclear as the shape had become irregular. The red medullary sinus had expanded and was filled with a large number of red cells. The white medullary lymphocytes were reduced in number when compared with the control group, with narrowed red medullary cords and sparsely arranged cells. AVP effectively alleviated the changes in spleen tissue morphology caused by D-galactose-induced oxidative stress and led to normal spleen morphology. The histomorphological observations of the skin, liver and spleen indicated that AVP could inhibit the histopathological changes caused by oxidation, and may serve a preventive and protective role. The effect of AVP exceeded that of the antioxidant Vc.

Figure 4.

Figure 4.

Hematoxylin and eosin staining of mouse spleen. Magnification, ×100. Vc, mice treated with 100 mg/kg Vc; AVP-L, mice treated with a low concentration (50 mg/kg) of AVP; AVP-H, mice treated with a high concentration (100 mg/kg) of AVP. AVP, Apocynum venetum polyphenol extract; Vc, vitamin C. Arrow indicates inflammed tissue.

CAT, Cu/Zn-SOD and Mn-SOD expression in liver and spleen tissues of mice

As shown in Figs. 5 and 6, the expression levels of Cu/Zn-SOD, Mn-SOD and CAT were strongest in the liver and spleen tissues of mice in the control group compared with the other groups. Mice in the model group exhibited the opposite trend to the normal group; Cu/Zn-SOD, Mn-SOD and CAT expression was the lowest in the liver and spleen tissues of these mice compared with the other groups. After AVP and Vc administration, the expression levels of Cu/Zn-SOD, Mn-SOD and CAT were significantly increased in the liver and spleen tissues compared with the model group (P<0.05). Expression levels of these indicators in the liver and spleen tissues of oxidative stress-induced mice became close to those of normal mice after AVP-H treatment.

Figure 5.

Figure 5.

Cu/Zn-SOD and Mn-SOD protein expression in the (A) liver and (B) spleen of mice. *P<0.05 and **P<0.01 vs. the model group. Vc, mice treated with 100 mg/kg Vc; AVP-L, mice treated with a low concentration (50 mg/kg) of AVP; AVP-H, mice treated with a high concentration (100 mg/kg) of AVP. AVP, Apocynum venetum polyphenol extract; SOD, superoxide dismutase; Vc, vitamin C.

Figure 6.

Figure 6.

Cu/Zn-SOD, Mn-SOD and catalase mRNA expression in the (A) liver and (B) spleen of mice. *P<0.05 and **P<0.01 vs. the model group. Vc, mice treated with 100 mg/kg vitamin C; AVP-L, mice treated with a low concentration (50 mg/kg) of AVP; AVP-H, mice treated with a high concentration (100 mg/kg) of AVP. AVP, Apocynum venetum polyphenol extract; SOD, superoxide dismutase; Vc, vitamin C.

mRNA expression levels of neuronal nitric oxide synthase (nNOS), endothelial nitric oxide synthase (eNOS) and inducible nitric oxide synthase (iNOS) in the liver and spleen tissues of mice

As shown in Fig. 7, the mRNA expression levels of nNOS and eNOS in the liver and spleen tissues in the control group were significantly higher than those in the other groups (P<0.05), whereas iNOS expression was significantly lower compared with the other groups (P<0.05). D-galactose-induced oxidation significantly reduced nNOS and eNOS expression, and increased iNOS expression in the liver and spleen tissues of mice in the model group compared with the control group. AVP significantly inhibited the alterations in mRNA expression induced by D-galactose (P<0.05) and normalized mRNA expression in the liver and spleen tissues of oxidative stress-induced mice. The effect was better than that of Vc at the same concentration.

Figure 7.

Figure 7.

nNOS, eNOS and iNOS mRNA expression in the (A) liver and (B) spleen of mice. *P<0.05 and **P<0.01 vs. the model group. Vc, mice treated with 100 mg/kg Vc; AVP-L, mice treated with a low concentration (50 mg/kg) of AVP; AVP-H, mice treated with a high concentration (100 mg/kg) of AVP. AVP, Apocynum venetum polyphenol extract; eNOS, endothelial NOS; iNOS, inducible NOS; nNOS, neuronal NOS; NOS, nitric oxide synthase; Vc, vitamin C.

mRNA expression levels of heme oxygenase-1 (HO-1), nuclear factor-erythroid 2-related factor 2 (Nrf2), γ-glutamylcysteine synthetase (γ-GCS) and NAD(P)H quinone dehydrogenase 1 (NQO1) in the liver and spleen tissues of mice

As shown in Fig. 8, the mRNA expression levels of HO-1, Nrf2, γ-GCS and NQO1 in the liver and spleen tissues were significantly higher in the control group than those in the other groups (P<0.05), whereas mice in the model group exhibited the weakest mRNA expression levels in the liver and spleen tissues. The expression levels of HO-1, Nrf2, γ-GCS and NQO1 in the liver and spleen tissues of mice were significantly increased following treatment with AVP and Vc compared with the model group (P<0.05); the upregulating effect of AVP-H on these genes was stronger than that of AVP-L and Vc.

Figure 8.

Figure 8.

HO-1, Nrf2, γ-GCS and NQO1 mRNA expression in the (A) liver and (B) spleen of mice. *P<0.05 and **P<0.01 vs. the model group. Vc, mice treated with 100 mg/kg Vc; AVP-L, mice treated a low concentration (50 mg/kg) of AVP; AVP-H, mice treated with a high concentration (100 mg/kg) of AVP. γ-GCS, γ-glutamylcysteine synthetase; AVP, Apocynum venetum polyphenol extract; HO-1, heme oxygenase-1; Nrf2, nuclear factor-erythroid 2-related factor 2; NQO1, NAD(P)H quinone dehydrogenase 1; Vc, vitamin C.

Discussion

Organ weight and organ indices are indicators of the status of the animal body. Changes in organ weight and organ indices can reflect oxidative stress in the body; for example, when oxidative stress occurs, the thymus and brain will atrophy more obviously than other organs (20). The liver and kidneys are the main metabolic organs of mice. A decrease in organ weight and indices will directly affect the metabolic capacity of animals. Furthermore, the liver is also an important immune organ (17). A change in the hepatic index suggests that the immunity of the body has been affected (21). The spleen is related to the cellular immune system in the body and serves an important role in the immune mechanism. A decline in the quality of the spleen indicates atrophy of the organ, which can reduce its immune function (13). Therefore, determining the spleen index can directly reflect structural and functional changes in the organ, and therefore has importance for evaluating the successful establishment of a mouse model of oxidative stress (22). The results of this study indicated that D-galactose could reduce the organ indices of mice under oxidative stress and AVP could alleviate the decrease of organ indices caused by D-galactose, thus preventing oxidative stress in mice.

The increased release of excitatory amino acids, such as glutamic acid, activates NMDA receptors to induce Ca2+ influx. When intracellular Ca2+ concentration increases, activated NOS generates large amounts of NO, which accelerates Ca2+ influx and causes an overload of intracellular Ca2+, directly inhibiting mitochondrial energy production. Furthermore, the generation of free radicals O2 and ·OH will be triggered, which aggravates the damage of brain cells (13). NO and O2 react with each other to form peroxynitrite anions that decompose into highly toxic OH and NO2, which further accelerates cell death (23). Repeated infections in the body, even if not directly related to the central nervous system, can lead to synthesis of iNOS mRNA and can result in the production of a large amount of NO, which causes neuronal death in the hippocampus and memory damage, and accelerates the deterioration of aging neuronal lesions, such as those found in Alzheimer's disease (17). The synthesis of iNOS mRNA in the anterior pituitary and pineal glands produces NO, which can deteriorate the resistance to infections and reduce the production of melatonin, thus leading to brain aging (24). These studies support the hypothesis that the regulation of NO levels and the prevention of excessive NO serve a significant role in controlling aging. Studies have shown that eNOS in mouse aortic endothelial cells is significantly reduced under oxidative stress (17,19). eNOS can inhibit the aging of blood vessels caused by oxidative stress, as well as dilate and protect blood vessels (25). Under normal physiological conditions, the nervous system has mechanisms that precisely regulate NO production, release, diffusion and inactivation, mainly by regulating the activation and deactivation of nNOS. In addition to its important function in the nervous system, nNOS is also expressed in skeletal muscles, the myocardium and smooth muscle cells, where NO has an important role in regulating blood flow and muscle contraction (26). A decrease in the levels of nNOS leads to excessive NO production, which may lead to the occurrence of neurological diseases, such as cerebral ischemia injury, Alzheimer's disease and Parkinson's disease (27). The results of the present study suggested that AVP may possess the ability to influence the levels of NO, nNOS, eNOS and iNOS, helping to maintain these at normal levels and to avoid an imbalance of NO, nNOS, eNOS and iNOS due to oxidative stress.

SOD is a type of metal enzyme widely distributed throughout the biological world. It is a key line of defense against reactive oxygen species. SOD can be generally divided into three types depending on the metal co-factors: Cu/Zn-SOD, Mn-SOD and Fe-SOD. Cu/Zn-SOD is an enzyme that can be predominantly found in the cytoplasm and chloroplast matrix of eukaryotic cells. In addition, Cu/Zn-SOD is present in the blood and viscera of animals (17). Mn-SOD predominantly exists in prokaryotic cells, eukaryotic cells and the mitochondrial matrix, whereas Fe-SOD mainly exists in prokaryotic cells and plants (26). SOD has an effective role in the prevention and treatment of diseases associated with superoxide free radicals. When in excess, superoxide anion radicals cause oxidative stress; in addition, when SOD concentration is low, oxidative stress may be induced (27). Levels of Cu/Zn-SOD and Mn-SOD decrease when the body is under oxidative stress (28). CAT is an antioxidant enzyme, which is abundant in erythrocytes, the cells of numerous tissue types, mitochondria and the cytoplasm (29). During normal oxidative respiration, organisms constantly produce reactive oxygen species, which contain unpaired electrons, and can be removed by CAT, SOD, GSH-Px and other enzymatic systems. As the first line of defense against reactive oxygen species, SOD converts O2 into H2O2, whereas CAT increases the cellular oxygen content by catalyzing the decomposition of H2O2 into H2O (30). GSH is an important antioxidant in mammals that can scavenge free radicals produced in cells, thus alleviating cell membrane damage caused by the formation of reactive oxygen species during lipid peroxidation (31). GSH is either directly or indirectly involved in numerous microbial cell activities. Notably, GSH is able to build a strong defense against oxidative stress together with related metabolic enzymes. One of the GSH reductions is composed of γ-glutamate-cysteine ligase (GSH1), GSH synthetase (GSH2), GSH reductase, GSH-Px and NADPH. The interaction of various factors in the system can inhibit oxidative stress and slow down oxidation (32) MDA is a lipid peroxide formed by oxidation; the levels of MDA in vivo directly reflect the degree of oxidation (33). In this study, AVP significantly regulated the oxidation, increased the levels of SOD, CAT, GSH (GSH1 and GSH2) and GSH-Px, and reduced the levels of MDA, thus effectively alleviating oxidative stress caused by D-galactose in mice.

As a stress protein, HO-1 is involved in anti-inflammatory and antioxidative processes, in addition to heme metabolism, and exerts strong protective effects on the cardiovascular and nervous systems. It has been reported that HO-1 has an antioxidant efficacy in vascular diseases, such as atherosclerosis, myocardial ischemic injury and hypertension, as well as neurological diseases, such as Alzheimer's disease, Parkinson's disease and cerebral ischemic injury (34). Nrf2 is important for the integrity of the vascular endothelium. A decline in Nrf2 function under oxidative stress is closely associated with the dysfunction of vascular endothelial cells. When the level of oxidative stress increases, Nrf2 is dissociated to promote the transcription and expression of HO-1, SOD and CAT, thus improving the ability to scavenge oxygen free radicals in the body (35). Nrf2 also has the function of regulating γ-GCS. Nrf2 is activated and promotes the expression of γ-GCS when a large quantity of reactive oxygen species is generated, and γ-GCS stimulates the synthesis and activation of GSH, which exerts an antioxidant role (36). When cells are subjected to oxidative stress, Nrf2 can uncouple from Keapl, which can be activated and transferred into the nucleus, bind to antioxidant response elements, regulate the expression of the downstream antioxidant enzyme gene NQO1, and enhance the tolerance of cells to oxidative stress. The Nrf2/NQO1 signaling pathway is known to be associated with oxidative stress, and active substances can exert their antioxidative effects by regulating the Nrf2/NQO1 signaling pathway (37). In this study, AVP could upregulate the expression levels of oxidized Nrf2, and further enhance the expression of HO-1, γ-GCS and NQO1, thus protecting oxidized mice and preventing oxidative stress.

Phenolic compounds have phenolic hydroxyl groups, so they have a strong antioxidant effect, the phenolic hydroxyl group can provide hydrogen to react with free radicals to form inert products or more stable free radicals, thus interrupting or slowing down the chain reaction of free radicals (38). Studies have shown that the antioxidant activity of polyphenol is much better in a number of plants than that of Vc (3941). The difference in the antioxidant activity of plant polyphenol is not only due to the molecular structure, but also due to the different three-dimensional conformation (42,43). A. venetum contains the active substance of AVP that has a strong antioxidant effect. This study also confirmed that the antioxidant effect of AVP was stronger than that of Vc at the same concentration; therefore, A. venetum could serve a preventive role against oxidative stress with its active ingredient AVP.

Neochlorogenic acid and chlorogenic acid are found in numerous types of TCM, and are reported to be beneficial in TCM treatment of inflammation and diabetes (44,45). Chlorogenic acid has also been suggested to have an inhibitory effect on lung cancer, gastric cancer and colon cancer (46,47). In addition to the suggestion that it has anticancer effects, rutin is believed to enhance the anticancer effect of other drugs and active substances (oxaliplatin, paeonol) used in TCM (48,49). In vitro studies have indicated that isoquercetin has inhibitory effect on gastric cancer cell proliferation (50,51). Astragalin and rosmarinic acid have been suggested to possess antioxidant activity and are bioactive substances (52,53). AVP contains neochlorogenic acid, chlorogenic acid, rutin, isoquercitrin, astragalin and rosmarinic acid. It is unclear whether the effect of the mixture of these six substances is due to their respective effective effects or combined effects, and further research is needed to clarify their underlying mechanism of action.

The results of the present study suggested that AVP may prevent D-galactose-induced oxidation in mice, and may return serum, skin, liver and spleen indices of mice under oxidative stress to close to their normal state. This effect was stronger than that of the well-known antioxidant Vc. In vivo experiments suggested that AVP is worthy of further study. The present preliminary study has begun to elucidate the mechanism of AVP activity; however, further human studies are required to verify its precise mechanism. In addition, the specific chemical composition of AVP needs to be further studied to clarify the direct relationship between the efficacy of AVP and its components.

Table V.

Levels of NO, SOD, GSH-Px, GSH and MDA in the liver of mice (n=10).

Group NO (µmol/l) SOD (U/ml) GSH-Px (U/ml) GS (mg/l) MDA (nmol/ml)
Normal 2.12±0.06b 95.49±2.63b 204.82±17.28b 9.57±0.48b 1.13±0.09b
Model 9.34±0.17 22.86±1.21 71.20±5.18 3.20±0.21 8.95±0.20
Vc 5.48±0.29a 52.94±1.81a 125.92±2.85a 6.33±0.15a 3.05±0.12a
AVP-L 7.26±0.29a 34.92±1.95a 89.89±1.85a 4.59±0.26a 5.49±0.33a
AVP-H 3.98±0.08a 75.86±2.01b 148.54±2.13b 7.56±0.28b 2.19±0.14b

Values are presented as the mean ± standard deviation (N=10/group).

a

P<0.05

b

P<0.01 vs. the model group. Vc, mice treated with Vc (100 mg/kg); AVP-L, mice treated with low concentration of AVP (50 mg/kg); AVP-H, mice treated with a high concentration of AVP (100 mg/kg). AVP, Apocynum venetum polyphenol extract; GSH, glutathione; GSH-Px, glutathione peroxidase; MDA, malondialdehyde; NO, nitric oxide; SOD, superoxide dismutase; Vc, vitamin C.

Table VI.

Levels of NO, SOD, GSH-Px, GSH and MDA in the spleens of mice (n=10).

Group NO (µmol/l) SOD (U/ml) GSH-Px (U/ml) GS (mg/l) MDA (nmol/ml)
Normal 1.56±0.06b 81.32±2.18b 117.59±8.06b 6.68±0.20a 0.55±0.07b
Model 8.71±0.23 18.24±0.89 38.93±1.48 2.00±0.15 4.70±0.15
Vc 5.52±0.12a 48.38±2.12a 69.69±3.27a 4.23±0.15a 2.13±0.07a
AVP-L 6.91±0.09a 28.87±1.18a 55.87±2.59a 3.21±0.15a 3.43±0.22a
AVP-H 4.20±0.16a 70.69±2.22b 92.62±2.67b 5.37±0.20a 1.12±0.05a

Values are presented as the mean ± standard deviation (N=10/group).

a

P<0.05

b

P<0.01 vs. the model group. Vc, mice treated with Vc (100 mg/kg); AVP-L, mice treated with low concentration of AVP (50 mg/kg); AVP-H, mice treated with a high concentration of AVP (100 mg/kg). AVP, Apocynum venetum polyphenol extract; GSH, glutathione; GSH-Px, glutathione peroxidase; MDA, malondialdehyde; NO, nitric oxide; SOD, superoxide dismutase; Vc, vitamin C.

Acknowledgements

Not applicable.

Funding

This research was funded by Chongqing scientific research institute performance incentive guidance project (cstc2018jxjlX0003), China.

Availability of data and materials

The datasets used and/or analyzed during the present study are available from the corresponding author on reasonable request.

Authors' contributions

JZ and XZ performed the experiments. PP and JY designed and directed the experiments. HG and ZK fed the animals, performed the experiments and wrote the manuscript. All authors approved the final manuscript for publication.

Ethics approval and consent to participate

This study followed a protocol approved by the Animal Ethics Committee of Chongqing Collaborative Innovation Center for Functional Food (approval no. 200802002B).

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

  • 1.Grundmann O, Nakajima J, Seo S, Butterweck V. Anti-anxiety effects of Apocynum venetum L. in the elevated plus maze test. J Ethnopharmacol. 2007;110:406–411. doi: 10.1016/j.jep.2006.09.035. [DOI] [PubMed] [Google Scholar]
  • 2.Tan X, Peng Y. Research progress of Apocynum venetum tea. Mod Chinese Med. 2014;16:666–673. [Google Scholar]
  • 3.Kim DW, Yokozawa T, Hattori M, Kadota S, Namba T. Inhibitory effects of an aqueous extract of Apocynum venetum leaves and its constituents on Cu(2+)-induced oxidative modification of low density lipoprotein. Phytother Res. 2000;14:501–504. doi: 10.1002/1099-1573(200011)14:7<501::AID-PTR655>3.0.CO;2-B. [DOI] [PubMed] [Google Scholar]
  • 4.Xiong Q, Fan W, Tezuka Y, Adnyana IK, Stampoulis P, Hattori M, Namba T, Kadota S. Hepatoprotective effect of Apocynum venetum and its active constituents. Planta Med. 2000;66:127–133. doi: 10.1055/s-2000-11135. [DOI] [PubMed] [Google Scholar]
  • 5.Xie W, Zhang X, Wang T, Hu J. Botany, traditional uses, phytochemistry and pharmacology of Apocynum venetum L. (Luobuma): A review. J Ethnopharmacol. 2012;141:1–8. doi: 10.1016/j.jep.2012.02.003. [DOI] [PubMed] [Google Scholar]
  • 6.Buford TW. Hypertension and aging. Ageing Res Rev. 2016;26:96–111. doi: 10.1016/j.arr.2016.01.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Chard S, Harris-Wallace B, Roth EG, Girling LM, Rubinstein R, Reese AM, Quinn CC, Eckert JK. Successful aging among african american older adults with type 2 diabetes. J Gerontol B Psychol Sci Soc Sci. 2017;72:319–327. doi: 10.1093/geronb/gbw119. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Kitada M, Ogura Y, Koya D. The protective role of Sirt1 in vascular tissue: Its relationship to vascular aging and atherosclerosis. Aging (Albany NY) 2016;8:2290–2307. doi: 10.18632/aging.101068. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Rao KS. Free radical induced oxidative damage to DNA: Relation to brain aging and neurological disorders. Indian J Biochem Biophys. 2009;46:9–15. [PubMed] [Google Scholar]
  • 10.Hohensinner PJ, Kaun C, Ebenbauer B, Hackl M, Demyanets S, Richter D, Prager M, Wojta J, Rega-Kaun G. Reduction of premature aging markers after gastric bypass surgery in morbidly obese patients. Obes Surg. 2018;28:2804–2810. doi: 10.1007/s11695-018-3247-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Li L, Xu M, Shen B, Li M, Gao Q, Wei SG. Moderate exercise prevents neurodegeneration in D-galactose-induced aging mice. Neural Regen Res. 2016;11:807–815. doi: 10.4103/1673-5374.182709. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Qian Y, Zhang J, Zhou X, Yi R, Mu J, Long X, Pan Y, Zhao X, Liu W. Lactobacillus plantarum CQPC11 isolated from Sichuan pickled cabbages antagonizes d-galactose-induced oxidation and aging in mice. Molecules. 2018;23(pii):E3026. doi: 10.3390/molecules23113026. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Li HY, Xia JQ, Yang LY, Zhong RZ. Plant polyphenols: Antioxidant capacity and application in animal production. China J Anim Nutr. 2013;25:2529–2534. [Google Scholar]
  • 14.Carluccio MA, Siculella L, Ancora MA, Massaro M, Scoditti E, Storelli C, Visioli F, Distante A, De Caterina R. Olive oil and red wine antioxidant polyphenols inhibit endothelial activation: Antiatherogenic properties of Mediterranean diet phytochemicals. Arterioscler Thromb Vasc Biol. 2003;23:622–629. doi: 10.1161/01.ATV.0000062884.69432.A0. [DOI] [PubMed] [Google Scholar]
  • 15.Sharma S, Rana S, Patial V, Gupta M, Bhushan S, Padwad YS. Antioxidant and hepatoprotective effect of polyphenols from apple pomace extract via apoptosis inhibition and Nrf2 activation in mice. Hum Exp Toxicol. 2016;35:1264–1275. doi: 10.1177/0960327115627689. [DOI] [PubMed] [Google Scholar]
  • 16.Delwing-Dal Magro D, Roecker R, Junges GM, Rodrigues AF, Delwing-de Lima D, da Cruz JGP, Wyse ATS, Pitz HS, Zeni ALB. Protective effect of green tea extract against proline-induced oxidative damage in the rat kidney. Biomed Pharmacother. 2016;83:1422–1427. doi: 10.1016/j.biopha.2016.08.057. [DOI] [PubMed] [Google Scholar]
  • 17.Pan Y, Long X, Yi R, Zhao X. Polyphenols in Liubao tea can prevent CCl4-induced hepatic damage in mice through its antioxidant capacities. Nutrients. 2018;10:1280. doi: 10.3390/nu10091280. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 2001;25:402–408. doi: 10.1006/meth.2001.1262. [DOI] [PubMed] [Google Scholar]
  • 19.Li GJ, Wang J, Cheng YJ, Tan X, Zhai YL, Wang Q, Gao FJ, Liu GL, Zhao X, Wang H. Prophylactic effects of polymethoxyflavone-rich orange peel oil on Nω-Nitro-L-arginine-induced hypertensive rats. Appl Sci. 2018;8:752. doi: 10.3390/app8050752. [DOI] [Google Scholar]
  • 20.Tang T, He B. Treatment of D-galactose induced mouse aging with Lycium barbarum polysaccharides and its mechanism study. Afr J Tradit Complement Altern Med. 2013;10:12–17. doi: 10.4314/ajtcam.v10i4.3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Khan SS, Singer BD, Vaughan DE. Molecular and physiological manifestations and measurement of aging in humans. Aging Cell. 2017;16:624–633. doi: 10.1111/acel.12601. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Manini TM. Energy expenditure and aging. Ageing Res Rev. 2010;9:1. doi: 10.1016/j.arr.2009.08.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Tessari P. Nitric oxide in the normal kidney and in patients with diabetic nephropathy. J Nephrol. 2015;28:257–268. doi: 10.1007/s40620-014-0136-2. [DOI] [PubMed] [Google Scholar]
  • 24.Wells SM, Holian A. Asymmetric dimethylarginine induces oxidative and nitrosative stress in murine lung epithelial cells. Am J Respir Cell Mol Biol. 2007;36:520–528. doi: 10.1165/rcmb.2006-0302SM. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Fukai T, Siegfried MR, Ushio-Fukai M, Cheng Y, Kojda G, Harrison DG. Regulation of the vascular extracellular superoxide dismutase by nitric oxide and exercise training. J Clin Invest. 2000;105:1631–1639. doi: 10.1172/JCI9551. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Bonthius DJ, Jr, Winters Z, Karacay B, Bousquet SL, Bonthius DJ. Importance of genetics in fetal alcohol effects: Null mutation of the nNOS gene worsens alcohol-induced cerebellar neuronal losses and behavioral deficits. Neurotoxicology. 2015;46:60–72. doi: 10.1016/j.neuro.2014.11.009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Lee MH, Hyun DH, Jenner P, Halliwell B. Effect of proteasome inhibition on cellular oxidative damage, antioxidant defences and nitric oxide production. J Neurochem. 2001;78:32–41. doi: 10.1046/j.1471-4159.2001.00416.x. [DOI] [PubMed] [Google Scholar]
  • 28.Kosenko EA, Tikhonova LA, Alilova GA, Montoliu C, Barreto GE, Aliev G, Kaminsky YG. Portacaval shunting causes differential mitochondrial superoxide production in brain regions. Free Radic Biol Med. 2017;113:109–118. doi: 10.1016/j.freeradbiomed.2017.09.023. [DOI] [PubMed] [Google Scholar]
  • 29.Selvaratnam JS, Robaire B. Effects of aging and oxidative stress on spermatozoa of superoxide-dismutase 1- and catalase-null mice. Biol Reprod. 2016;95:60. doi: 10.1095/biolreprod.116.141671. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Pawlak W, Kedziora J, Zolynski K, Kedziora-Kornatowska K, Blaszczyk J, Witkowski P, Zieleniewski J. Effect of long term bed rest in men on enzymatic antioxidative defence and lipid peroxidation in erythrocytes. J Gravit Physiol. 1998;5:P163–P164. [PubMed] [Google Scholar]
  • 31.Berndt C, Lillig CH. Glutathione, glutaredoxins, and iron. Antioxid Redox Signal. 2017;27:1235–1251. doi: 10.1089/ars.2017.7132. [DOI] [PubMed] [Google Scholar]
  • 32.Vázquez-Medina JP, Zenteno-Savín T, Forman HJ, Crocker DE, Ortiz1 RM. Prolonged fasting increases glutathione biosynthesis in postweaned northern elephant seals. J Exp Biol. 2011;214:1294–1299. doi: 10.1242/jeb.054320. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Hosen MB, Islam MR, Begum F, Kabir Y, Howlader MZ. Oxidative stress induced sperm DNA damage, a possible reason for male infertility. Iran J Reprod Med. 2015;13:525–532. [PMC free article] [PubMed] [Google Scholar]
  • 34.Sue YM, Cheng CF, Chang CC, Chou Y, Chen CH, Juan SH. Antioxidation and anti-inflammation by haem oxygenase-1 contribute to protection by tetramethylpyrazine against gentamicin-induced apoptosis in murine renal tubular cells. Nephrol Dial Transplant. 2009;24:769–777. doi: 10.1093/ndt/gfn545. [DOI] [PubMed] [Google Scholar]
  • 35.Hong C, Cao J, Wu CF, Kadioglu O, Schüffler A, Kauhl U, Klauck SM, Opatz T, Thines E, Paul NW, Efferth T. The Chinese herbal formula Free and Easy Wanderer ameliorates oxidative stress through KEAP1-NRF2/HO-1 pathway. Sci Rep. 2017;7:11551. doi: 10.1038/s41598-017-10443-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Iwayama K, Kusakabe A, Ohtsu K, Nawano T, Tatsunami R, Ohtaki KI, Tampo Y, Hayase N. Long-term treatment of clarithromycin at a low concentration improves hydrogen peroxide-induced oxidant/antioxidant imbalance in human small airway epithelial cells by increasing Nrf2 mRNA expression. BMC Pharmacol Toxicol. 2017;18:15. doi: 10.1186/s40360-017-0119-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Jiang XP, Tang JY, Xu Z, Han P, Qin ZQ, Yang CD, Wang SQ, Tang M, Wang W, Qin C, et al. Sulforaphane attenuates di-N-butylphthalate-induced reproductive damage in pubertal mice: Involvement of the Nrf2-antioxidant system. Environ Toxicol. 2017;32:1908–1917. doi: 10.1002/tox.22413. [DOI] [PubMed] [Google Scholar]
  • 38.Wang SX, Li AM, Zhang JJ, Ou SY, Huang XS, Zhang GW. HPLC-ESI-MS analysis of phenolic compounds in different solvent fractions of ethanol extract of longan seeds and their antioxidant activities. Food Sci. 2011;32:196–203. [Google Scholar]
  • 39.Ramful D, Tarnus E, Aruoma OI, Bourdon E, Bahorun T. Polyphenol composition, vitamin C content and antioxidant capacity of Mauritian citrus fruit pulps. Food Res Int. 2011;44:2088–2099. doi: 10.1016/j.foodres.2011.03.056. [DOI] [Google Scholar]
  • 40.Wittayarat M, Kimura T, Kodama R, Namula Z, Chatdarong K, Techakumphu M, Sato Y, Taniguchi M, Otoi T. Long-term preservation of chilled canine semen using vitamin C in combination with green tea polyphenol. Cryo Lett. 2012;33:318–326. [PubMed] [Google Scholar]
  • 41.Bai JW, Gao ZJ, Xiao HW, Wang XT. Polyphenol oxidase inactivation and vitamin C degradation kinetics of Fuji apple quarters by high humidity air impingement blanching. Int J Food Sci Technol. 2013;48:1135–1141. doi: 10.1111/j.1365-2621.2012.03193.x. [DOI] [Google Scholar]
  • 42.Yilixiati XKY, Li XJ. Inhibitory effect of epigallocatechin gallate on the proliferation of lewis lung cancer mice and A549 and Calu-3 lung cancer cells. Chin Pharm J. 2012;47:585–589. [Google Scholar]
  • 43.Shen SR, Jin CF, Yang XQ, Zhao BL. Study on the scavenging effects of EGCG and GCG on singlet oxygen with ESR method. J Tea Sci. 2000;20:19–21. [Google Scholar]
  • 44.Zhang LW, Ji T, Su SL, Shang RX, Guo S, Guo JM, Qian DW, Duan JA. Pharmacokinetics of Mori Folium flavones and alkaloids in normal and diabetic rats. Zhongguo Zhong Yao Za Zhi. 2017;42:4218–4225. doi: 10.19540/j.cnki.cjcmm.20170901.008. (In Chinese) [DOI] [PubMed] [Google Scholar]
  • 45.Hou N, Liu N, Han J, Yan Y, Li J. Chlorogenic acid induces reactive oxygen species generation and inhibits the viability of human colon cancer cells. Anticancer Drugs. 2017;28:59–65. doi: 10.1097/CAD.0000000000000430. [DOI] [PubMed] [Google Scholar]
  • 46.Yamagata K, Izawa Y, Onodera D, Tagami M. Chlorogenic acid regulates apoptosis and stem cell marker-related gene expression in A549 human lung cancer cells. Mol Cell Biochem. 2018;441:9–19. doi: 10.1007/s11010-017-3171-1. [DOI] [PubMed] [Google Scholar]
  • 47.Lukitasari M, Nugroho DA, Widodo N. Chlorogenic acid: The conceivable chemosensitizer leading to cancer growth suppression. J Evid Based Integr Med. 2018;23:2515690X18789628. doi: 10.1177/2515690X18789628. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Li Q, Ren LQ, Wang YD, Chen XX. Effects of rutin combined with oxaliplatin on the proliferation and apoptosis of human gastric cancer SGC-7901 cells. Chin J Clin Pharm Ther. 2017;22:1099–1105. [Google Scholar]
  • 49.Zhan P, Peng XS, Xu XM, Zhou YF, Zhang XP, He R, Zhou G. The anti-cancer study on combinating paeonol and rutin. Chin Arch Tradit Chin Med. 2010;28:1710–1712. [Google Scholar]
  • 50.Liu KY, Liu HJ, Wu JZ, Zhang TJ. Studies on inhibitory effect of active constituents from Tussilago farfara L. on lung cancer cells LA795 proliferation. J Fudan Univ (Nat Sci) 2009;48:125–129. [Google Scholar]
  • 51.Li YY, Zhao SJ, Bai CZ, Zhang LW, Wang ZH. Effect of isoquercetin from Fagopyrum tataricum on the proliferation and apoptosis of human gastric carcinoma cell line SGC-7901. Food Sci. 2014;35:193–197. [Google Scholar]
  • 52.Kim MS, Kim SH. Inhibitory effect of astragalin on expression of lipopolysaccharide-induced inflammatory mediators through NF-κB in macrophages. Arch Pharm Res. 2011;34:2101–2107. doi: 10.1007/s12272-011-1213-x. [DOI] [PubMed] [Google Scholar]
  • 53.Tepe B, Eminagaoglu O, Akpulat HA, Aydin E. Antioxidant potentials and rosmarinic acid levels of the methanolic extracts of Salvia verticillata (L.) subsp. Verticillataand S. verticillata (L.) subsp. Amasiaca (Freyn & Bornm.) Bornm. Food Chem. 2007;100:985–989. doi: 10.1016/j.foodchem.2005.10.062. [DOI] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

The datasets used and/or analyzed during the present study are available from the corresponding author on reasonable request.


Articles from Experimental and Therapeutic Medicine are provided here courtesy of Spandidos Publications

RESOURCES