Skip to main content
The Journal of Biological Chemistry logoLink to The Journal of Biological Chemistry
. 2019 Nov 6;294(51):19785–19794. doi: 10.1074/jbc.RA119.010858

A conserved miRNA-183 cluster regulates the innate antiviral response

Ragunath Singaravelu ‡,1,2, Nadine Ahmed §,1,3, Curtis Quan §,4, Prashanth Srinivasan §,4, Christopher J Ablenas §, Dominic G Roy , John Paul Pezacki ‡,§,5
PMCID: PMC6926452  PMID: 31694919

Abstract

Upon immune recognition of viruses, the mammalian innate immune response activates a complex signal transduction network to combat infection. This activation requires phosphorylation of key transcription factors regulating IFN production and signaling, including IFN regulatory factor 3 (IRF3) and STAT1. The mechanisms regulating these STAT1 and IRF3 phosphorylation events remain unclear. Here, using human and mouse cell lines along with gene microarrays, quantitative RT-PCR, viral infection and plaque assays, and reporter gene assays, we demonstrate that a microRNA cluster conserved among bilaterian animals, encoding miR-96, miR-182, and miR-183, regulates IFN signaling. In particular, we observed that the miR-183 cluster promotes IFN production and signaling, mediated by enhancing IRF3 and STAT1 phosphorylation. We also found that the miR-183 cluster activates the IFN pathway and inhibits vesicular stomatitis virus infection by directly targeting several negative regulators of IRF3 and STAT1 activities, including protein phosphatase 2A (PPP2CA) and tripartite motif–containing 27 (TRIM27). Overall, our work reveals an important role of the evolutionarily conserved miR-183 cluster in the regulation of mammalian innate immunity.

Keywords: microRNA (miRNA), interferon, interferon regulatory factor (IRF), innate immunity, posttranscriptional regulation, antiviral signaling, IFN regulatory factor 3 (IRF3), miR-183 cluster, STAT1

Introduction

The innate immune system represents the immediate and nonspecific response to pathogens in almost all multicellular organisms (1). This first line of defense coordinates protection against a variety of both single-stranded and double-stranded DNA and RNA viruses as well as intracellular bacteria and parasites via the action of a class of cytokines called IFNs. Interferons induce the expression of numerous antiviral effector proteins, and IFN production relies on multiple phosphorylation events, including C-terminal phosphorylation of IFN regulatory factor 3 (IRF3) (2, 3), a transcription factor that regulates the expression of both type I and III IFNs (4). An integrated gene network of both positive and negative regulators is crucial for proper dynamic activation and resolution of IFN signaling.

Recent work has highlighted a group of small RNAs, called microRNAs (miRNAs)6 as key regulatory layer in cell intrinsic immunity and the inflammatory response (5). Generally, miRNAs posttranscriptionally regulate gene expression relevant to diverse cellular processes by base-pairing with the 3′ UTR of mRNAs and mediating mRNA destabilization and translational repression (6). MicroRNA expression can be modulated during viral infection or the innate immune response (5, 7) and can serve to either potentiate or dampen the immune response (8, 9, 10). The functional relevance of miRNAs in shaping the innate antiviral response is not completely understood.

When examining miRNA signatures associated with viral infection, we identified that the highly conserved miR-183 cluster (miR-96, miR-182, and miR-183; Fig. 1A) is dysregulated in the context of different viral infections, including both DNA and RNA viruses (1115). Furthermore, genetic variation in this miRNA cluster is associated with increased susceptibility to inflammatory and autoimmune disease (16). Despite these connections, the role of the miR-183 cluster in innate immunity is unclear.

Figure 1.

Figure 1.

An immune-regulated miRNA cluster inhibits viral infection. A, schematic depicting the immunoregulatory role of the miR-183 cluster. Conservation of miR-96, miR-182, and miR-183 is shown below. B and C, HepG2 cells were transfected with mimics of miR-96, miR-182, or miR-183, along with a negative control mimic at a final concentration of 50 nm. 48 h post-transfection, cells were infected with VSV-GFP (multiplicity of infection = 0.01) for 24 h. The effects of the miRNAs on virus production were assessed by plaque assays for VSV-GFP (B) and VSV-GFP–infected cells (C) and visualized 72 h post-transfection and 24 h post-infection using fluorescence microscopy; representative images are shown for Con-miR– and miR-183–transfected cells. Scale bar = 100 μm. D and E, plaque assay results showing the influence of miR-183 cluster mimics (D) and inhibitors (E) on VSV-GFP production in MCF7 breast cancer cells 72 h post-transfection with miRNA mimics or inhibitors and 24 h after infection. In B and E, error bars represent mean ± S.E. from three independent experiments. In D, data represent the means ± S.E. of two biological replicates.

Here, we examined the role of the miR-183 cluster in the innate immune response. We found that all three miRNAs encoded in the cluster promoted IFN signaling and production through repression of key negative regulators of IRF3 and STAT1 signaling. Our work demonstrates a novel role of this miRNA cluster in cooperative regulation of the IFN pathway.

Results

The miR-183 cluster suppresses viral replication

To characterize the miR-183 cluster's role in the innate antiviral response, we first examined the influence of the cluster on virus production. As previous work has shown dysregulation of the cluster's expression in the context of viral infection of the liver (13, 14, 17), we performed our initial studies in IFN signaling–competent HepG2 hepatoma cells (18). We transfected HepG2 cells with mimics of each miRNA in the cluster and subsequently infected the cells with GFP-encoding vesicular stomatitis virus (VSV-GFP). miR-183 mimics transfection elicited the most potent antiviral effect, inducing a more than 2-log drop in virus production (Fig. 1B). Fluorescence microscopy confirmed decreased GFP production in miR-183–transfected cells infected with the VSV reporter virus (Fig. 1C). We also observed an analogous antiviral effect in MCF7 breast cancer cells (Fig. 1D) and immortalized mouse embryonic fibroblasts (Fig. S1), suggesting that the cluster's antiviral effects are conserved across mice and humans. A comparison of the cluster's inhibitory effects against VSV in the three tested models revealed that miR-183 was consistently the most potent antiviral miRNA. To further confirm the miR-183 cluster's antiviral effects, we examined VSV production in miRNA inhibitor–treated MCF7 cells, as breast cancers cells are known to express up-regulated levels of the miR-183 family (19). Consistent with our mimics experiments, inhibition of each miRNA individually during VSV infection produced an approximately 1-log increase in viral titer (Fig. 1E), reinforcing a shared function of miR-183, miR-182, and miR-96 in antiviral defense.

The miR-183 cluster promotes IFN signaling

To delineate the mechanism by which the miR-183 cluster mediates its antiviral effects, we performed gene expression profiling on HepG2 cells treated with miR-183 cluster mimics and subsequently immunostimulated with poly(I:C) (a viral dsRNA analog) complexed with the transfection reagent LyoVec. This poly(I:C)/LyoVec complex acts as an agonist of the cytoplasmic sensor of viral RNA, retinoic acid-inducible gene I (RIG-I). Among the genes activated by more than 8-fold by each miR-96/182/183 mimics independently were several well-established interferon-stimulated genes (ISGs), including OAS2, RSAD2, DDX60, and IFITM1 (Fig. 2A).

Figure 2.

Figure 2.

The miR-183 cluster regulates IFN signaling. A, HepG2 cells were transfected with Con-miR, miR-96, miR-182, or miR-183 mimics independently at 50 nm final concentration. 48 h post transfection, cells were immunostimulated with poly(I:C)/LyoVec (500 ng/ml) for 24 h. The heatmap shows genes differentially expressed by more than 8-fold (up or down) under each treatment condition relative to Con-miR–transfected HepG2 cells. -Fold changes in gene expression relative to the control are shown. B, gene ontology analysis classifying activated genes (≥1.5-fold increase) in miR-183 cluster–treated HepG2 cells by biological process. The top three gene ontology terms, all IFN-I–related processes, are shown for each examined condition. C and D, qPCR analysis of relative IFN expression (C, IFNB1 and IFNL1) and ISG expression (D; RSAD2, STAT1, and DDX58) in HepG2 cells transfected with the miR-183 cluster at 50 nm final concentration and subsequently stimulated with poly(I:C)/LyoVec at a final concentration of 500 ng/ml for 24 h. Data represent the means ± S.E. of four biological replicates. *, p < 0.05; **, p < 0.01; ***, p < 0.001. IFNL1 data represent the means ± S.E. of three biological replicates.

Gene ontology enrichment analysis of genes up-regulated more than 1.5-fold in expression revealed that biological processes related to type I IFN signaling were activated by each miRNA of the cluster (Fig. 2B and Tables S1–S3). Data from qPCR experiments of type I and III IFN (IFNB1 and IFNL1) as well as ISG (STAT1, DDX58, and RSAD2) expression levels in poly(I:C)-stimulated HepG2 cells confirmed enhanced IFN signaling and production in miR-183 cluster–treated cells (Fig. 2, C and D). Additionally, a similar activation of IFN and ISG expression was observed in VSV-infected MCF7 breast cancer cells treated with the miR-183 mimics (Fig. S2, A and B). Conversely, inhibition of the miR-183 cluster produced an opposite effect, decreasing IFNB1 and RSAD2 expression (Fig. S3). Analogous levels of ISG expression were observed in HepG2 cells following VSV infection (Fig. S4). These data strongly validate the regulatory role of the miR-183 cluster in IFN signaling.

miR-183 promotes Jak/STAT signaling

Type I and III IFN stimulation activates the JAK/STAT pathway (20), which yields phosphorylation-dependent activation of STAT1, a transcription factor required for ISG induction. Interestingly, we observed increased STAT1 mRNA expression in miR-183–treated cells, suggesting that miR-183 activates constitutive Jak/STAT signaling in the absence of immune stimulation (Fig. S5). Activation of STAT1 depends on phosphorylation at a C-terminal tyrosine residue (Tyr-701), whereas an additional phosphorylation at Ser-727 is thought to be required for maximal activation of the transcription factor (21). We examined the miR-183 cluster's effect on these two STAT1 phosphorylation sites. As miR-183 exhibited the most potent antiviral effect (Fig. 1, B–D, and Fig. S1), we focused our efforts on characterizing this miRNA's effects on Jak/STAT signaling. miR-183–transfected HepG2 cells showed increased STAT1 phosphorylation at Tyr-701 and Ser-727 during poly(I:C)/LyoVec and IFN-α immunostimulation at various time points (Fig. 3, A–C), consistent with enhanced Jak/STAT signaling.

Figure 3.

Figure 3.

miR-183 activates Jak/STAT signaling. A, HepG2 cells were transfected with either Con-miR or miR-183 at 50 nm final concentration for 48 h and then treated with poly(I:C)/LyoVec (500 ng/ml) for 24 h. Western blot analyses of total STAT1 and phosphorylated STAT1 (pSTAT1 Tyr-701 and Ser-727) are shown. β-Tubulin levels served as a loading control. B, HepG2 cells were transfected with either Con-miR or miR-183 at 50 nm final concentration for 48 h and subsequently treated with IFN-α (1000 units) for 30 and 60 min. C, HepG2 cells were transfected with either Con-miR or miR-183 at 50 nm final concentration for 48 h and subsequently treated with IFN-α (1000 units) for 24-h Western blot analysis of total STAT1 and phosphorylated STAT1. β-Tubulin levels served as a loading control. D, qPCR analysis of relative ISG expression (RSAD2, STAT1, and DDX58) in HepG2 cells transfected with miR-183 cluster mimics at 50 nm final concentration and subsequently stimulated with 1000 units/ml IFN-α for 24 h. Data represent the means ± S.E. of three biological replicates. *, p < 0.05; **, p < 0.01. E, HepG2 cells were transfected with either Con-miR or miR-183 at final concentration of 50 nm. 48 h post-transfection, cells were infected with VSV-GFP or an attenuated VSV-GFP strain (MΔ51) at two different multiplicities of infection (1 and 3) for 24 h. Western blot analysis was then performed as in A.

We performed short pulses of IFN-α to distinguish changes in phosphorylation status from overall increases in STAT1 expression levels. The results showed that the increase in phosphorylation by miR-183 occurred prior to any change in expression of STAT1 (Fig. 3B). Consistent with this, miR-183 was shown to be able to enhance IFN-stimulated response element (ISRE)-driven reporter activity during TBK1 and IKKϵ overexpression in HEK293T cells (Fig. S6). Measurements by qPCR also confirmed that the miRNA cluster activated ISG expression during IFN-α stimulation, with DDX58, RSAD2, and STAT1 expression increasing over 4-fold in cells transfected with each mimic independently (Fig. 3D).

Increased STAT1 Tyr-701 phosphorylation was also observed in the context of VSV-GFP infection; however, no significant difference in phosphorylation at the Ser-727 site was seen (Fig. 3E). The use of an attenuated VSV strain, defective in its capacity to evade IFN signaling because of a deletion in the matrix (M) protein (22), rescued the miR-183–mediated effect on Ser-727 phosphorylation. This suggests that WT VSV M protein partially impairs miR-183's effect on STAT1; however, because it has been shown that it is possible to achieve STAT1 activation independent of the phosphorylation at Ser-727 (21), there is only partial impairment. Maximal activation of STAT1 is achieved when phosphorylation at Ser-727 is also maximized (21). Furthermore, similar results were observed in poly(I:C)/LyoVec-treated A549 lung cancer cells (Fig. S7). Collectively, our observations revealed that miR-183 enhances Jak/STAT signaling under both basal and virus-stimulated conditions.

Viral RNA can also be sensed by Toll-like receptors (TLRs) 3, 7, and 8 in the endosomal compartment, and ligand engagement of these TLRs results in downstream IFN production and signaling. We examined whether the cluster could influence TLR3 signaling in MCF7 cells by treating miR-183 cluster mimic–transfected cells with naked poly(I:C) and probing STAT1 phosphorylation levels. Our immunoblot analyses revealed that miR-96 and miR-183 promoted TLR3 agonist–induced STAT1 phosphorylation (Fig. S8). Taken together, these results demonstrate that the miR-183 cluster activates both TLR and RIG-I–induced Jak/STAT signaling.

miR-183 represses negative regulators of IFN production

To characterize the direct targets of miR-183 contributing to its stimulatory effects on IFN signaling/production and anti-viral effects, we utilized the gene expression profiling data to identify potential miR-183 targets. To do this, we examined the overlap between miR-183 predicted targets from TargetScan (23) and genes whose expression was down-regulated by miR-183 mimic transfection in poly(I:C)/LyoVec–stimulated HepG2 cells (>1.5-fold) (Fig. 4A). This produced a list of 413 genes, and we examined this list for genes described previously to be negative regulators of IFN production and signaling. miR-183 repressed the expression of serine/threonine protein phosphatase 2A catalytic subunit α isoform (PPP2CA) (24) and tripartite motif–containing 27 (TRIM27) (25), genes shown previously to inhibit IFN production with putative miR-183 binding sites in their 3′ UTRs (Fig. 4B).

Figure 4.

Figure 4.

miR-183 activates IRF3 phosphorylation. A, the Venn diagram shows overlap between miR-183 predicted targets and genes repressed in miR-183 mimic–transfected HepG2 cells at a concentration of 50 nm and immunostimulated with poly(I:C) at a concentration of 500 ng/ml for 24 h. B, the predicted miR-183 binding sites in the 3′ UTRs of three negative regulators of IRF3 signaling (PPP2CA and TRIM27). Sites were taken from TargetScan (23). C, qPCR analysis of miR-183 target expression levels in miR-183 mimic–transfected (50 nm) and poly(I:C)-treated (500 ng/ml) HepG2 cells. Poly(I:C) treatment was done for 24 h. PPP2CA data represent the means ± S.E. of five biological replicates. TRIM27 data represent the means ± S.E. of four biological replicates **, p < 0.01; ***, p < 0.001. D and E, Western blot analysis of PP2A catalytic subunit α (PP2Ac) and total IRF3 and phosphorylated IRF3 (pIRF3 Ser-386) levels in Con-miR– or miR-183 mimic–transfected HepG2 cells at 50 nm final concentration treated with poly(I:C) (500 ng/ml) 48h post-transfection (D) or infected with different multiplicities of infection (MOI) of VSV-GFP 48 h post-transfection (E). β-Tubulin levels served as a loading control.

We then validated repression of miR-183 regulated genes in poly(I:C)/LyoVec-immunostimulated HepG2 cells transfected with mimics of the miR-183 cluster. qPCR confirmed that miR-183 inhibited mRNA levels of these predicted targets by over 50% in poly(I:C)/LyoVec-treated HepG2 cells (Fig. 4C). In parallel, decreased protein phosphatase 2A (PP2A) catalytic subunit α protein abundance was confirmed by Western blot analysis (Fig. 4D) and PPP2CA was validated as a direct target of miR-183 (Fig. S9). These results suggest that the miR-183 cluster represses the expression of negative regulators of IRF3 phosphorylation to mediate their inhibitory effects on IFN production.

PP2A and TRIM27 inhibit interferon production by decreasing IRF3 phosphorylation (24, 25). Phosphorylation of IRF3 at the C terminus is required for the transcription factor to homo/heterodimerize and translocate to the nucleus to mediate transcriptional activation of IFN genes and ISGs. Therefore, we hypothesized that miR-183 activates IFN production and signaling through increased IRF3 activation and examined the phosphorylation status of IRF3 in miR-183–transfected cells. Western blot analyses confirmed increased IRF3 phosphorylation and down-regulated expression of PPP2CA in miR-183–transfected HepG2 cells during poly(I:C) treatment or VSV infection (Fig. 4, D and E). This miR-183–enhanced IRF3 phosphorylation was also observed in RIG-I agonist–treated A549 cells (Fig. S6) and TLR3 agonist–treated MCF7 cells (Fig. S7).

PP2A has also been proposed previously to impair IFN-induced STAT1 phosphorylation (26); miR-183 targeting of the phosphatase would contribute to its effects on Jak/STAT signaling (Fig. 3). Furthermore, knockdown of PPP2CA in HepG2 cells resulted in the dampening of the miR-183-mediated effect on STAT1 phosphorylation following poly(I:C) stimulation (Fig. S10). As predicted, both miR-183 and specific siRNA targeting PPP2CA led to lower levels of protein expression and a commensurate increase in phosphorylation of STAT1.

Treatment with PPP2CA siRNA dampens the effects of miR-183 by lowering the mRNA levels of the key miRNA target (Fig. S10). Additionally, it is evident that, with siRNA knockdown of PPP2CA, the magnitude of difference in STAT1 phosphorylation (Tyr-701 and Ser-727) between Con-miR– and miR-183–transfected HepG2 cells is not as significant relative to what is observed in naïve Con-siRNA–transfected HepG2 cells (Fig. S10, lanes 1 and 2 versus lanes 3 and 4). This further validates that miR-183's effect on Jak–STAT signaling depends on PPP2CA repression. Overall, this confirms that miR-183-driven enhancement of IFN signaling and the accompanying antiviral response are mediated through PPP2CA targeting. In addition, specific induction of the miR-183 cluster by the CRISPR activation system (27) in HepG2 cells produced consistent increases in IRF3 and STAT1 phosphorylation and ISG expression as well as concomitant down-regulation of PPP2CA expression during poly(I:C)/LyoVec stimulation (Fig. S11). Therefore, our data demonstrate that the miR-183 cluster mediates its antiviral effects through repression of negative regulators of IRF3 and STAT1 phosphorylation (Fig. 5).

Figure 5.

Figure 5.

A schematic of the proposed model of the mechanism by which miR-183 regulates the innate antiviral immune response. The miR-183 cluster positively regulates type I interferon and ISG production by repressing negative regulators of the antiviral response. Specifically, mir-183 targets PPP2CA, which is known to negatively regulate IRF3 and STAT1 phosphorylation (24, 26), and miR-183 also targets TRIM27 and, as a result, impairs the degradation of TBK1 and enhances IRF3 signaling in the initiation of type I IFN production (25). This establishes a model whereby miR-183's repression of PPP2CA and TRIM27 enhances the activation of IFN and ISG production.

Discussion

Overall, our work elucidates a novel role for the miR-183 cluster in regulation of the innate antiviral response through activation of IFN production and signaling. Although previous studies have highlighted functional roles of miRNAs encoded in the miR-183 cluster in helper T lymphocyte clonal expansion (28) and natural killer cell function (29), our work highlights a novel function of this highly conserved miRNA cluster in the cell-intrinsic defense against pathogens. Furthermore, miR-183's regulation of tonic IFN signaling could also play an important role in immune homeostasis, as increased constitutive IFN signaling has been linked to autoimmunity (30). This provides a potential explanation for the previously reported association between increased miR-183 cluster expression and lupus disease in mice (31). The identification of the miR-183 family as a primary regulator of IFN signaling opens novel avenues for immunomodulatory strategies to treat interferonopathies and other immune disorders. This is, to the best of our knowledge, the only known example of a miRNA cluster shaping the innate immune response through cooperative regulation of the IFN pathway.

Experimental procedures

Reagents

The HepG2 hepatoma cells (HB-8065), MCF7 breast cancer cells (HTB-22), A549 lung epithelial cancer cells (CCL-185), and HEK293 human embryonic kidney cells (CRL-1573) were procured from the ATCC. Mouse embryonic fibroblast cells (32) were kindly provided by Dr. Marc Servant (Université de Montreal, Montreal, QC, Canada). VSV-GFP WT and mutant viruses were kindly provided by Dr. John C. Bell (Ottawa Hospital Research Institute, Ottawa, ON, Canada)(22). All mirVana miRNA mimics and inhibitors, along with controls, were purchased from Ambion. PPP2CA-targeting siRNA (4390824) and the negative control (4390843, Silencer Select) were purchased from Ambion. The PPP2CA 3′ UTR luciferase construct was purchased from Genecopoeia. Low-molecular-weight (LMW) poly(I:C) complexed with LyoVec and LMW poly(I:C) alone were purchased from Invivogen. IFN-α was procured from PBL Assay Science. The pISRE-Luc plasmid was a kind gift from Dr. Katherine Fitzgerald (University of Massachusetts Medical School, Worcester, MA). pcDNA3.1-TBK1-FLAG, pcDNA3.1-FLAG-IKBKE, and empty pcDNA3.1 were a kind gift from Dr. Daniel Lamarre (Centre hospitalier de l'Université de Montréal, Montreal, QC, Canada) (33). The lentiviral vectors encoding MS2-p65-HSF1 (61426) and dCas9-VP64 (61425) fusion proteins and the lenti sgRNA(MS2)_puro-optimized backbone (73797) were gifts from Feng Zhang (Broad Institute, Cambridge, MA), obtained from Addgene (27).

Cell culture and transfection

Adherent HepG2 cells were cultured in DMEM (Invitrogen) supplemented with 10% FBS (PAA Laboratories), 1× nonessential amino acids (NEAAs; Gibco), 50 units/ml penicillin, and 50 mg/ml streptomycin. Adherent HEK293 cells were cultured in minimum essential medium (Invitrogen) supplemented with 10% FBS, 1 mm sodium pyruvate (Gibco), 1× NEAAs, 50 units/ml penicillin, and 50 mg/ml streptomycin. Adherent mouse embryonic fibroblasts, A549 cells, and Vero cells were cultured in DMEM supplemented with 10% FBS. Adherent MCF7 cells were cultured in minimum essential medium containing 10% FBS, 1% NEAAs, 1% sodium pyruvate, and 0.01 mg/ml recombinant insulin (Sigma-Aldrich). All cell culture maintenance and experiments were performed at 37 °C and 5% CO2. IFN-α was used at a working concentration of 1000 units/ml. LMW poly(I:C) complexed with LyoVec was used at 500 ng/ml, whereas LMW poly(I:C) for TLR3 agonism was used at 50 μg/ml. Transfections for miRNA mimics and inhibitors were performed using Lipofectamine RNAiMax (Life Technologies). Transfections were performed according to the manufacturer's protocol, using 2.5 μl of RNAiMAx/1 μl of 100 μm of miRNA mimic. Transfection of plasmid DNA was performed using Lipofectamine 2000 (Life Technologies) according to the manufacturer's protocol.

mRNA microarray analysis

RNA isolation from HepG2 cells was performed with the RNeasy kit (Qiagen). Gene expression profiling was performed using Affymetrix Human Gene ST.2.0 arrays. Data were normalized and analyzed using the Affymetrix Expression Console and Transcriptome Analysis Console (v3.0) according to the manufacturer's protocols. Gene ontology analysis was performed using the ToppGene suite (34). For ToppGene analysis, p values were adjusted with Bonferroni correction. Heatmap visualization of expression data was done on datasets filtered for genes activated over 8-fold under all conditions (HepG2 cells transfected with mimics of miR-96, miR-182, or miR-183 individually at 50 nm). Because multiple transcript cluster IDs correspond to TRANK1, we show the -fold change corresponding to ID 17123262, the probe showing the highest magnitude of -fold change in expression.

Quantitative RT-PCR

RNA isolation from hepatocytes was performed using TRIzol (Life Technologies), RNeasy kits (Qiagen), or NucleoSpin miRNA (Macherey-Nagel) according to the manufacturer's protocol. RNA integrity was confirmed by 0.8% agarose gel electrophoresis in 1× Tris borate-EDTA (Ambion). For mRNA profiling, 250 ng of total RNA was reverse-transcribed using the Superscript II RT Kit (Life Technologies), following the manufacturer's instructions. qPCR was subsequently performed on an iCycler (Bio-Rad), using iQ SYBR Green SSO Advanced Supermix (Bio-Rad) according to the manufacturer's protocol. Primer sequences are listed in Table S4. Relative miRNA levels were quantified using the TaqMan miRNA assay (Applied Biosystems), with 10 ng of total RNA used for reverse transcription using the TaqMan MicroRNA Reverse Transcription Kit (Applied Biosystems). For both mRNA and miRNA quantification, the 2 ΔΔCt method was used to calculate -fold changes in expression relative to mock- or control-treated samples (35), with 18S rRNA or RNU6B levels being used for normalization.

Viral infection

HepG2 cells and MCF7 cells were seeded at 5 × 105 cells/well in 6-well plates and simultaneously reverse-transfected with 50 nm control; miR-96, miR-182, or miR-183 mimics; or inhibitors. Forty-eight hours post-transfection, the medium was removed, and cells were incubated at 37 °C in serum-free DMEM containing VSV-GFP particles at the appropriate multiplicity of infection. One hour post-infection, cells were washed with 1× PBS, and the medium was replaced with DMEM supplemented with 10% FBS. Twenty-four hours post-infection (VSV), cell supernatants (for plaque assays) were collected and clarified via centrifugation at 1700 × g for 10 min to remove cells and cellular debris. Adherent cells were washed once with PBS and then lysed for subsequent cellular RNA and protein analyses.

Viral plaque assays

Vero cells were seeded at 7.5 × 105 cells/well in 6-well plates. Twenty-four hours after seeding, 10-fold serial dilutions (1:10 to 1:109) of the supernatants collected from VSV-infected HepG2 cells were prepared in DMEM. The medium was removed from Vero cells and replaced with 100 μl of virus-containing supernatant (one dilution per well). Cells were incubated in virus-containing supernatant at 37 °C for 1 h. One hour post-infection, 2 ml of warm (37 °C to 40 °C) agarose medium (1× DMEM, 10% FBS, 1% (w/v) agarose) was added to each well and allowed to solidify. After 24 h (VSV), plaques were counted by visual examination. Viral titers in supernatants were back-calculated based on serial dilutions and expressed as plaque-forming units per milliliters of supernatant.

VSV-GFP fluorescence imaging

HepG2 cells were seeded at 2 × 105 cells/well in 12-well plates and simultaneously reverse-transfected with Con-miR, miR-96, miR-182, or miR-183 mimics as described previously. Forty-eight hours post-transfection, cells were infected with VSV-GFP. 24 h post-infection, cells were washed twice with PBS and fixed with a solution of 4% (v/v) formaldehyde and 4% (w/v) sucrose in water for 15 min at room temperature. Fixed cells were washed twice with PBS for 3 min and stored in PBS at 4 °C until imaging. Fixed cells were mounted with ProLong Diamond Antifade Mountant with DAPI (Life Technologies). Imaging was performed using an Axiophot fluorescence microscope (Zeiss) attached to a DP-70 color charged coupled device (CCD) camera (Olympus) with a 50-watt mercury fluorescence excitation light source using either a blue or green filter cube for DAPI or GFP, respectively. Images were acquired using the ImagePro 6 software suite (MediaCybernetics) and analyzed using ImageJ (National Institutes of Health).

3′ UTR luciferase reporter assay

The miR-183 binding site in a Dual-Luciferase reporter containing the 3′ UTR of the protein phosphatase 2A catalytic subunit α was mutated using the QuikChange Lightning Kit (Stratagene) according to the manufacturer's protocol, with a primer designed to introduce a point mutation in the first nucleotide of the miR-183 seed sequence (forward, 5′-GGACCAAAAGATGTGCCTAATAAAAATACAAAGCC-3′; reverse, 5′-GGCTTTGTATTTTTATTAGGCACATCTTTTGGTCC-3′). HEK293 cells were seeded at 4 × 104 cells/well in 24-well plates and transfected 24 h later with 500 ng/ml of either the WT or mutant 3′ UTR construct as described previously. Twenty-four hours post-transfection, cells were transfected with Con-miR, miR-96, miR-182, or miR-183 mimics as described previously. Forty-eight hours post-mimic transfection, cells were lysed in 1× passive lysis buffer (Promega), and the Dual-Luciferase assay was carried out as described previously (36), using a SpectraMax L luminometer (Molecular Devices).

PPP2CA knockdown

HepG2 cells were reverse-transfected in a 10-cm dish with 50 nm control or miR-183 mimics. 24 h post-transfection, cells were reseeded in a 12-well plate and then reverse-transfected with 50 nm siRNA targeting PPP2CA or control siRNA. 24 h after siRNA transfection, cells were stimulated with poly(I:C)/LyoVec at 500 ng/ml final concentration. 24 h post-stimulation, cells were lysed in 1× SDS lysis buffer and prepared for immunoblotting.

Immunoblotting

After transfections, cells were washed twice with PBS and lysed with SDS lysis buffer consisting of 50 mm Tris-HCl (pH 6.8), 2% SDS, and 10% glycerol. A protease inhibitor mixture (Roche Diagnostics) was added to each extract. The protein concentration of each sample was quantified using the DC Protein Assay (Bio-Rad) according to the manufacturer's protocol. Prior to loading, 10% (v/v) of DTT and bromphenol blue (1:1) were added to each sample, and 40–60 μg/well was loaded onto an SDS-PAGE gel (10% resolving, 4% stacking gel). The resolved proteins were transferred to a Hybond-P PVDF membrane (Amersham Biosciences). The membrane was probed using the following primary antibodies and corresponding volume dilutions (in 3% (w/v) BSA): rabbit anti-STAT1 (1:1000; Cell Signaling Technology, Beverly, MA; 9172), rabbit anti-phospho-STAT1 (Tyr-701, 1:1000, Cell Signaling Technology, 7649), rabbit anti-phospho-STAT1 (Ser-727, 1:1000, Cell Signaling Technology, 9177), rabbit anti-IRF3 (1:1000; Santa Cruz Biotechnology, Dallas, TX; sc-9082), anti-IRF3 (1:1000, Cell Signaling Technology, 10949S), rabbit anti-phospho-IRF3 (Ser-386, 1:1000; EMD Millipore, Etobicoke, ON, Canada; ABE501), rabbit anti-phospho-IRF3 (Ser-386, 1:1000, Abcam, ab76493), rabbit anti-PP2A (α/β catalytic subunit, 1:5000, Abcam, ab32141), rabbit anti-β-tubulin (1:1000, Santa Cruz Biotechnology, sc-9104), and anti-β-tubulin (1:5000, Abcam, ab6046). β-Tubulin expression levels were used as loading controls. Membranes were then incubated with HRP-conjugated goat anti-mouse or donkey anti-rabbit secondary antibodies (Jackson ImmunoResearch Laboratories, Westgrove, PA). Protein bands were visualized using either Amersham Biosciences ECL Prime Western Blotting Detection Reagent (GE Healthcare) or Clarity ECL Western Blotting Substrate (Bio-Rad) according to the respective manufacturer's protocols, depending on antibody strength and background signal.

ISRE-luciferase assay

HEK293T cells were reverse-transfected with 50 nm control or miR-183 mimics in 10-cm dishes. 24 h post-transfection with miRNA mimics, cells were reseeded in a 24-well plate and reverse-transfected with 100 ng of ISRE promoter–driven firefly luciferase reporter plasmid (ISRE-Luc), 50 ng of Renilla luciferase–expressing plasmid (pGL4, Promega), and 100 ng of the overexpression plasmids pcDNA3.1-TBK1-FLAG or pcDNA3.1-FLAG-IKBKE or empty pcDNA3.1 as a negative control. 24 h post-transfection, the cells were lysed with 1× passive lysis buffer (Promega), and Dual-Luciferase reporter assays were performed as described previously (36).

CRISPR activation and lentivirus generation

HEK293T cells in 10-cm dishes were transfected with the packaging vectors pMD2.G (2 μg) and psPAX2 (4 μg) and 6 μg of transfer vector. Viral supernatant was collected 72 h post-transfection, filtered (0.45 μm), and used for transduction of HepG2 cells. HepG2 cells were lentivirally infected with dCas9-VP64 and MS2-p65-HSF1 and selected using blasticidin and hygromycin for more than 2 weeks; subsequently, cells were lentivirally infected with a nontargeting control (NTC) or guides targeting the promoter of miR-183. Guides were annealed and cloned into the lenti sgRNA(MS2)_puro-optimized backbone via the BsmBI sites. Five guides were tested for the capacity to mediate CRISPR activation–induced miR-183 cluster expression, and the top tested guide was identified using TaqMan miRNA qPCR assays (cloned with oligos CACCGAGGGCCTCCGTCCAGCCGCG (forward) and AAACCGCGGCTGGACGGAGGCCCTC (reverse)) and used for functional analysis of miR-183 cluster GOF. Nontargeting guide sequences (forward, CACCGGCGAGGTATTCGGCTCCGCG; reverse, AAACCGCGGAGCCGAATACCTCGCC) were used as a control.

Statistical analysis

Data are presented as the mean of replicates, with error bars representing the standard error of the mean. Unless otherwise stated, statistical significance was evaluated using two-tailed Student's t test, and p values of less than 0.05 were deemed significant.

Author contributions

R. S., N. A., and J. P. P. conceptualization; R. S., C. Q., and P. S. data curation; R. S., N. A., C. Q., P. S., and J. P. P. formal analysis; R. S. and J. P. P. supervision; R. S. and J. P. P. funding acquisition; R. S., N. A., C. Q., P. S., C. J. A., D. G. R., and J. P. P. investigation; R. S., N. A., and J. P. P. methodology; R. S., N. A., C. Q., and J. P. P. writing-original draft; R. S. and J. P. P. project administration; N. A., C. Q., and P. S. validation; N. A., C. Q., and P. S. visualization; J. P. P. resources.

Supplementary Material

Supporting Information

Acknowledgments

We thank Dr. M. H. Powdrill (uOttawa) for useful discussions and help through the course of this work. mRNA microarray profiling was performed by The Centre for Applied Genomics (TCAG), The Hospital for Sick Children, Toronto, Ontario, Canada.

This work was supported by Natural Sciences and Engineering Research Council Grant 298496 and Canadian Institutes of Health Research Grant 136807. University of Ottawa has filed a patent on the miR-183 cluster's immunomodulatory properties in the name of John Paul Pezacki and Ragunath Singaravelu.

This article contains Figs. S1–S11 and Tables S1–S4.

The gene expression profiling data of the miR-183 cluster and control mimic–transfected HepG2 cells immunostimulated with poly(I:C) have been deposited into NCBI GEO under the accession number: GSE139027.

6
The abbreviations used are:
miRNA
microRNA
VSV
vesicular stomatitis virus
ISG
IFN-stimulated gene
qPCR
quantitative RT-PCR
TLR
Toll-like receptor
LMW
low-molecular-weight
NEAA
nonessential amino acid
Con-miR
control microRNA.

References

  • 1. Kimbrell D. A., and Beutler B. (2001) The evolution and genetics of innate immunity. Nat. Rev. Genet. 2, 256–267 10.1038/35066006 [DOI] [PubMed] [Google Scholar]
  • 2. Fitzgerald K. A., McWhirter S. M., Faia K. L., Rowe D. C., Latz E., Golenbock D. T., Coyle A. J., Liao S. M., and Maniatis T. (2003) IKKϵ and TBK1 are essential components of the IRF3 signalling pathway. Nat. Immunol. 4, 491–496 10.1038/ni921 [DOI] [PubMed] [Google Scholar]
  • 3. Sharma S., tenOever B. R., Grandvaux N., Zhou G. P., Lin R., and Hiscott J. (2003) Triggering the interferon antiviral response through an IKK-related pathway. Science 300, 1148–1151 10.1126/science.1081315 [DOI] [PubMed] [Google Scholar]
  • 4. Onoguchi K., Yoneyama M., Takemura A., Akira S., Taniguchi T., Namiki H., and Fujita T. (2007) Viral infections activate types I and III interferon genes through a common mechanism. J. Biol. Chem. 282, 7576–7581 10.1074/jbc.M608618200 [DOI] [PubMed] [Google Scholar]
  • 5. Forster S. C., Tate M. D., and Hertzog P. J. (2015) MicroRNA as type I interferon-regulated transcripts and modulators of the innate immune response. Front. Immunol. 6, 334 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6. Jonas S., and Izaurralde E. (2015) Towards a molecular understanding of microRNA-mediated gene silencing. Nat. Rev. Genet. 16, 421–433 10.1038/nrg3965 [DOI] [PubMed] [Google Scholar]
  • 7. Powdrill M. H., Desrochers G. F., Singaravelu R., and Pezacki J. P. (2016) The role of microRNAs in metabolic interactions between viruses and their hosts. Curr. Opin. Virol. 19, 71–76 10.1016/j.coviro.2016.07.005 [DOI] [PubMed] [Google Scholar]
  • 8. O'Connell R. M., Taganov K. D., Boldin M. P., Cheng G., and Baltimore D. (2007) MicroRNA-155 is induced during the macrophage inflammatory response. Proc. Natl. Acad. Sci. U.S.A. 104, 1604–1609 10.1073/pnas.0610731104 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9. Sheedy F. J., Palsson-McDermott E., Hennessy E. J., Martin C., O'Leary J. J., Ruan Q., Johnson D. S., Chen Y., and O'Neill L. A. (2010) Negative regulation of TLR4 via targeting of the proinflammatory tumor suppressor PDCD4 by the microRNA miR-21. Nat. Immunol. 11, 141–147 10.1038/ni.1828 [DOI] [PubMed] [Google Scholar]
  • 10. Taganov K. D., Boldin M. P., Chang K. J., and Baltimore D. (2006) NF-κB-dependent induction of microRNA miR-146, an inhibitor targeted to signaling proteins of innate immune responses. Proc. Natl. Acad. Sci. U.S.A. 103, 12481–12486 10.1073/pnas.0605298103 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11. Oussaief L., Fendri A., Chane-Woon-Ming B., Poirey R., Delecluse H. J., Joab I., and Pfeffer S. (2015) Modulation of microRNA cluster miR-183-96-182 expression by Epstein-Barr virus latent membrane protein 1. J. Virol. 89, 12178–12188 10.1128/JVI.01757-15 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12. Singaravelu R., O'Hara S., Jones D. M., Chen R., Taylor N. G., Srinivasan P., Quan C., Roy D. G., Steenbergen R. H., Kumar A., Lyn R. K., Özcelik D., Rouleau Y., Nguyen M. A., Rayner K. J., et al. (2015) MicroRNAs regulate the immunometabolic response to viral infection in the liver. Nat. Chem. Biol. 11, 988–993 10.1038/nchembio.1940 [DOI] [PubMed] [Google Scholar]
  • 13. El Sobky S. A., El-Ekiaby N. M., Mekky R. Y., Elemam N. M., Mohey Eldin M. A., El-Sayed M., Esmat G., and Abdelaziz A. I. (2016) Contradicting roles of miR-182 in both NK cells and their host target hepatocytes in HCV. Immunol. Lett. 169, 52–60 10.1016/j.imlet.2015.10.013 [DOI] [PubMed] [Google Scholar]
  • 14. Chen Y., Dong X., Yu D., and Wang X. (2015) Serum miR-96 is a promising biomarker for hepatocellular carcinoma in patients with chronic hepatitis B virus infection. Int. J. Clin. Exp. Med. 8, 18462–18468 [PMC free article] [PubMed] [Google Scholar]
  • 15. Stark T. J., Arnold J. D., Spector D. H., and Yeo G. W. (2012) High-resolution profiling and analysis of viral and host small RNAs during human cytomegalovirus infection. J. Virol. 86, 226–235 10.1128/JVI.05903-11 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16. Yu H., Liu Y., Bai L., Kijlstra A., and Yang P. (2014) Predisposition to Behçet's disease and VKH syndrome by genetic variants of miR-182. J. Mol. Med. 92, 961–967 10.1007/s00109-014-1159-9 [DOI] [PubMed] [Google Scholar]
  • 17. Singaravelu R., Quan C., Powdrill M. H., Shaw T. A., Srinivasan P., Lyn R. K., Alonzi R. C., Jones D. M., Filip R., Russell R. S., and Pezacki J. P. (2018) MicroRNA-7 mediates cross-talk between metabolic signaling pathways in the liver. Sci. Rep. 8, 361 10.1038/s41598-017-18529-x [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18. Mitchell A. M., Stone A. E., Cheng L., Ballinger K., Edwards M. G., Stoddard M., Li H., Golden-Mason L., Shaw G. M., Khetani S., and Rosen H. R. (2015) Transmitted/founder hepatitis C viruses induce cell-type- and genotype-specific differences in innate signaling within the liver. MBio. 6, e02510 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19. Li P., Sheng C., Huang L., Zhang H., Huang L., Cheng Z., and Zhu Q. (2014) miR-183/-96/-182 cluster is up-regulated in most breast cancers and increases cell proliferation and migration. Breast Cancer Res. 16, 473 10.1186/s13058-014-0473-z [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20. Au-Yeung N., Mandhana R., and Horvath C. M. (2013) Transcriptional regulation by STAT1 and STAT2 in the interferon JAK-STAT pathway. Jak-Stat. 2, e23931 10.4161/jkst.23931 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21. Wen Z., Zhong Z., and Darnell J. E. (1995) Maximal activation of transcription by STATL and STAT3 requires both tyrosine and serine phosphorylation. Cell 82, 241–250 10.1016/0092-8674(95)90311-9 [DOI] [PubMed] [Google Scholar]
  • 22. Stojdl D. F., Lichty B. D., tenOever B. R., Paterson J. M., Power A. T., Knowles S., Marius R., Reynard J., Poliquin L., Atkins H., Brown E. G., Durbin R. K., Durbin J. E., Hiscott J., and Bell J. C. (2003) VSV strains with defects in their ability to shutdown innate immunity are potent systemic anti-cancer agents. Cancer Cell 4, 263–275 10.1016/S1535-6108(03)00241-1 [DOI] [PubMed] [Google Scholar]
  • 23. Agarwal V., Bell G. W., Nam J.-W., and Bartel D. P. (2015) Predicting effective microRNA target sites in mammalian mRNAs. Elife. 4 10.7554/eLife.05005 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24. Long L., Deng Y., Yao F., Guan D., Feng Y., Jiang H., Li X., Hu P., Lu X., Wang H., Li J., Gao X., and Xie D. (2014) Recruitment of phosphatase PP2A by RACK1 adaptor protein deactivates transcription factor IRF3 and limits type I interferon signaling. Immunity 40, 515–529 10.1016/j.immuni.2014.01.015 [DOI] [PubMed] [Google Scholar]
  • 25. Zheng Q., Hou J., Zhou Y., Yang Y., Xie B., and Cao X. (2015) Siglec1 suppresses antiviral innate immune response by inducing TBK1 degradation via the ubiquitin ligase TRIM27. Cell Res. 25, 1121–1136 10.1038/cr.2015.108 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26. Shanker V., Trincucci G., Heim H. M., and Duong H. T. (2013) Protein phosphatase 2A impairs IFNα-induced antiviral activity against the hepatitis C virus through the inhibition of STAT1 tyrosine phosphorylation. J. Viral Hepat. 20, 612–621 10.1111/jvh.12083 [DOI] [PubMed] [Google Scholar]
  • 27. Joung J., Konermann S., Gootenberg J. S., Abudayyeh O. O., Platt R. J., Brigham M. D., Sanjana N. E., and Zhang F. (2017) Genome-scale CRISPR-Cas9 knockout and transcriptional activation screening. Nat. Protoc. 12, 828–863 10.1038/nprot.2017.016 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28. Stittrich A. B., Haftmann C., Sgouroudis E., Kühl A. A., Hegazy A. N., Panse I., Riedel R., Flossdorf M., Dong J., Fuhrmann F., Heinz G. A., Fang Z., Li N., Bissels U., Hatam F., et al. (2010) The microRNA miR-182 is induced by IL-2 and promotes clonal expansion of activated helper T lymphocytes. Nat. Immunol. 11, 1057–1062 10.1038/ni.1945 [DOI] [PubMed] [Google Scholar]
  • 29. Donatelli S. S., Zhou J. M., Gilvary D. L., Eksioglu E. A., Chen X., Cress W. D., Haura E. B., Schabath M. B., Coppola D., Wei S., and Djeu J. Y. (2014) TGF-β-inducible microRNA-183 silences tumor-associated natural killer cells. Proc. Natl. Acad. Sci. U.S.A. 111, 4203–4208 10.1073/pnas.1319269111 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30. Gough D. J., Messina N. L., Clarke C. J., Johnstone R. W., and Levy D. E. (2012) Constitutive type I interferon modulates homeostatic balance through tonic signaling. Immunity 36, 166–174 10.1016/j.immuni.2012.01.011 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31. Dai R., Zhang Y., Khan D., Heid B., Caudell D., Crasta O., and Ahmed S. A. (2010) Identification of a common lupus disease-associated microRNA expression pattern in three different murine models of lupus. PLoS ONE 5, e14302 10.1371/journal.pone.0014302 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32. Clément J.-F., Bibeau-Poirier A., Gravel S.-P., Grandvaux N., Bonneil E., Thibault P., Meloche S., and Servant M. J. (2008) Phosphorylation of IRF-3 on Ser 339 Generates a Hyperactive Form of IRF-3 through Regulation of Dimerization and CBP Association. J. Virol. 82, 3984–3996 10.1128/JVI.02526-07 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33. Tremblay N., Baril M., Chatel-Chaix L., Es-Saad S., Park A. Y., Koenekoop R. K., and Lamarre D. (2016) Spliceosome SNRNP200 promotes viral RNA sensing and IRF3 activation of antiviral response. PLoS Pathog. 12, e1005772 10.1371/journal.ppat.1005772 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34. Chen J., Bardes E. E., Aronow B. J., and Jegga A. G. (2009) ToppGene Suite for gene list enrichment analysis and candidate gene prioritization. Nucleic Acids Res. 37, W305–W311 10.1093/nar/gkp427 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35. Livak K. J., and Schmittgen T. D. (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2-ΔΔCT method. Methods 25, 402–408 10.1006/meth.2001.1262 [DOI] [PubMed] [Google Scholar]
  • 36. Dyer B. W., Ferrer F. A., Klinedinst D. K., and Rodriguez R. (2000) A noncommercial dual luciferase enzyme assay system for reporter gene analysis. Anal. Biochem. 282, 158–161 10.1006/abio.2000.4605 [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supporting Information

Articles from The Journal of Biological Chemistry are provided here courtesy of American Society for Biochemistry and Molecular Biology

RESOURCES