Skip to main content
PLOS One logoLink to PLOS One
. 2019 Dec 23;14(12):e0226576. doi: 10.1371/journal.pone.0226576

Kinetics of the thermal inactivation and the refolding of bacterial luciferases in Bacillus subtilis and in Escherichia coli differ

Eugeny Gnuchikh 1,2, Ancha Baranova 1,3,4, Vera Schukina 1, Ilyas Khaliullin 1, Gennady Zavilgelsky 2, Ilya Manukhov 1,2,*
Editor: Eugene A Permyakov5
PMCID: PMC6927610  PMID: 31869349

Abstract

Here we present a study of the thermal inactivation and the refolding of the proteins in Gram positive Bacillus subtilis. To enable use of bacterial luciferases as the models for protein thermal inactivation and refolding in B. subtilis cells, we developed a variety of bright luminescent B. subtilis strains which express luxAB genes encoding luciferases of differing thermolability. The kinetics of the thermal inactivation and the refolding of luciferases from Photorhabdus luminescens and Photobacterium leiognathi were compared in Gram negative and Gram positive bacteria. In B. subtilis cells, these luciferases are substantially more thermostable than in Escherichia coli. Thermal inactivation of the thermostable luciferase P. luminescens in B. subtilis at 48.5°С behaves as a first-order reaction. In E.coli, the first order rate constant (Kt) of the thermal inactivation of luciferase in E. coli exceeds that observed in B. subtilis cells 2.9 times. Incubation time dependence curves for the thermal inactivation of the thermolabile luciferase of P. leiognathi luciferase in the cells of E. coli and B. subtilis may be described by first and third order kinetics, respectively. Here we shown that the levels and the rates of refolding of thermally inactivated luciferases in B. subtilis cells are substantially lower that that observed in E. coli. In dnaK-negative strains of B. subtilis, both the rates of thermal inactivation and the efficiency of refolding are similar to that observed in wild-type strains. These experiments point that the role that DnaKJE plays in thermostability of luciferases may be limited to bacterial species resembling E. coli.

Introduction

When exposed to mildly elevated temperatures, eukaryotic and prokaryotic thermolabile proteins transiently undergo partial or complete unfolding, resulting in a loss of their activity [1]. Persistence of the heat stress prevents the proteins from refolding to their native state, while favoring alternative, beta-sheet enriched conformations. To prevent misfolding, eukaryotic and prokaryotic cells employ a variety of molecular chaperones, the most abundant and best studied of which being Hsp60-Hsp10 (GroEL-GroES), Hsp70-Hsp40-nucleotide exchange factor (DnaK-DnaJ-GrpE), Hsp100 (ClpA–ClpB–ClpX) and so-called small chaperones sHsp (IbpA-IbpB) [210].

In studies of the folding, misfolding and refolding conditions in Escherichia coli, bacterial and firefly derived luciferases often serve as model substrates [1013]. Moreover, luminescent Gram positives bacteria have their use as biosensors suitable for clinical applications [1418]. Despite enormous biotechnological importance of Gram positive cells in general, and of B. subtilis, a workhorse of industrial recombinant protein production in particular, the mechanisms of the folding and the refolding of the proteins in these bacterial cells remain enigmatic.

In present work we use the model bacterial luciferases differing in their thermostability to investigate the thermal inactivation and the refolding of the proteins in Gram positive B. subtilis. A variety of bright luminescent B. subtilis strains which express luxAB genes encoding luciferases from bacteria P. luminescens [14] and P. leiognathi [15], are utilized in the comparative study of the kinetics of the thermal inactivation and the refolding of the luciferases in Gram negative and Gram positive bacteria. In particular, we evaluated effects of dnaKJ genes on luciferase thermostability in cellular environments of B. subtilis and E. coli.

Materials and methods

Bacterial strains, plasmids, and growth conditions

Bacterial strains are presented in Table 1. Plasmids are presented in Table 2.

Table 1. Bacterial strains.

Strain Genotype Source
E. coli K12 BW25113 lacIq rrnBT14 ΔlacZWJ16 hsdR514 ΔaraBADAH33 ΔrhaBADLD78 obtained from Keio Collection
E. coli K12 JW0013 Derivative of BW25113 ΔdnaK::kan obtained from Keio Collection
B. subtilis 168 trpC2 obtained from VKPM
B. subtilis NBS 2001 Derivative of 168, ΔdnaK-dnaJ::Spcr obtained from H. Yoshikawa. [19].

Table 2. Plasmids used in the work.

Plasmid Description Source
pMWAL-1TPpur pMWAL-1 [20] based shuttle vector made by cloning of the promoter Ppur from Bacillus amyloliquefaciens. Includes pMW118 and pBS72 replicons along with chloramphenicol (Cmr) and ampicillin (Apr) resistance genes. Obtained from V.A. Lifshits (GosNIIgenetika)
pXen5 Integrative shuttle vector with two replicons: pE194 for B. subtilis and pMB9 oriC for E. coli, a lux-operon cassette ABCDE lux from P. luminescens with modified SD sequences, transposase and IR repeats as well erythromycin (Ermr) and kanamycin (Kmr) resistance genes. [14]
pLF22ABleo Includes α and β subunits of P. leiognathi luciferase expressed from promoter Prep in plasmid pLF22 (Cmr). [15]
pMWAL-1Ppur-dhfr-t1t2-MCS (изменить название) pMWAL-1TPpur–based shuttle vector made by the cloning of multiple cloning site sequence and dihydrofolate reductase encoding gene which confers resistance to trimethoprim (Tpr). Plasmid also contains Cmr and Apr. Present work
pPfbaA-MCS pMWAL-1Ppur_dhfr_t1t2_MCS based shuttle vector made by adding promoter of fructose-1,6-bisphosphate aldolase gene (PfbaA). (Tpr, Cmr and Apr). Present work
pPfbaA-XenAB Plasmid resulting from the cloning of α and β subunits of the luciferase from P. luminescens into pPfbaA_MCS (Tpr, Cmr and Apr). Present work
pPfbaA_LeoAB Plasmid resulting from the cloning of α and β subunits of the luciferase from P. leiognathi into pPfbaA_MCS (Tpr, Cmr and Apr). Present work
pTZ57R-xenAB Plasmid resulting from the cloning of α and β subunits of the luciferase from P. luminescens under promoter Plac into vector pTZ57R (Apr). Present work
pTZ57R-leoAB As pTZ57R-xenAB but lux gene of luciferase take from P. leiognathi. Present work

E. coli and B. subtilis was grown either in LB media, with constant aeration at 200 rpm at 37°С unless indicated otherwise. Solid media plates were prepared using 1.5% of agar.

For selection, media we made with spectinomycin 150 μg/ml, ampicillin 100 μg/ml and chloramphenicol 10 μg/ml.

Transformation

B. subtilis cells were transformed according to the protocol of Spizizen [21]. E. coli cells were transformed using calcium chloride protocol [22].

Enzymes and chemical substances

The substrate for luciferase n-decanal was from Sigma-Aldrich (USA). Enzymes for cloning were purchased in Promega (USA). Media were from Helicon (Moscow, Russia). Oligonucleotides were made by Syntol (Moscow, Russia).

Constructing the plasmids

Primers utilized for constructing the plasmids are described in Table 3. As a backbone for assembly of biosensors we selected shuttle plasmid pMWAL-1TPpur with two origins pMW118 (GenBank: AB005475) and pBS72 [23], which allows teta-type replication, as well as amplicillin and chloramphenicol resistance gens bla and cat for E. coli and B. subtilis, respectively. With an aid of P1/P2 primers, trimethoprim resistance gene dhfr from B. cereus ATCC14579 was introduced into the plasmid pMWAL-1TPpur under its Ppur promoter. With an aid of P3/P4 primers, rrnB terminator T1T2 was introduced to build a promoterless plasmid pMWAL-1Ppur_dhfr_t1t2_MCS. In turn, with an aid of primers P5/P6, this construct was modified by inserting constitutive promoter of fructose-1,6-bisphosphate aldolase gene (PfbaA) [24] into SacI recognition site, thus, resulting in plasmid pPfbaA_MCS. Later, plasmid pPfbaA_MCS was utilized for cloning of α and β subunits of luciferases from P. luminescens and P. leiognathi, which were amplified on the pXen5 [14] and pLF22ABleo [15] templates using P7/P8 and P9/P10 primers, respectively, to obtain pPfbaA_XenAB and pPfbaA_LeoAB plasmids, respectively. Both subunits of P. luminescens and P. leiognathi luciferases were cloned into pTZ57R vector to obtain constructs pTZ57R_xenAB (with pair of primers P7/P8) and pTZ57R_leoAB (with pair of primers P9/P10), respectively.

Table 3. Primers utilized for constructing the plasmids.

P1 5-GTTTCTACCCGGCTGCCGTAATAAAGGAGGTTTACCGATGATTGTTTCATTTATGGTCGCTATG-3
P2 5-TCGGTACCCGGGGATCCTCGATTCTCCTCCTCTTTCTATATTAGT-3
P3 5-GTACTAATATAGAAAGAGGAGGAGAATCGAGCTGATGCAAAAACGAGGCTAGTTTAC-3
P4 5-CGGCCGCTCGAGGGGCCCGGCGCGCCGGATCCCCATGCCGAACTCAGAAGTGAA-3
P5 5-GCCGCGGTACCGAGCTTTTTCTCCATAACTAGGATACCAAC-3
P6 5-AAAGAAGAGCTTTCAGGtATTCGAATCATGTCATTATGTTGCCGATTTG-3
P7 5-ACCGCGGCCGCTCGAGGAAGCAAGAGGAGGACTCTCTATG-3
P8 5-GCCGGGCCCCTCGAGATTTCAACCTGGCCGTTAATAATGAATGA-3
P9 5- ATCGCGGCCGCTCTCAGATCGGAAGGTGGAAGAA -3
P10 5- TCGGGGCCCGTACCTCGCGAATGCATCTA-3

Measurement of the intensity of bioluminescence

Cell were prepared by overnight cultivation at 30°С with aeration at 200 rpm in LB media with chloramphenicol or ampicillin, then diluted 1:100 in LB media with chloramphenicol, grown till reaching OD = 0.4–0.5, then incubated at a certain temperature. To eliminate de novo protein synthesis, incubation media was supplemented with following antibiotics: chloramphenicol (167 μg/ml) for E. coli and tetracycline (60 μg/ml) for B. subtilis.

To measure the intensity of bioluminescence the cells were sampled into the 200-μl test tubes like in [25]. Two μl of 0.1% n-decanal dissolved in ethanol were added to final concentration of 0.001%. Cells are placed in the luminometer without shaking at room temperature (~20°С), with direct measurements of total bioluminescence (in RLU, relative light units) using “Biotox-7” (LLC EKON, Russia). In five seconds timeframe, luciferase substrate n-decanal enters the cells and participates in light producing reaction.

Results

Hybrid plasmid with PfbaA or Plac controlled luxAB-genes were introduced to B. subtilis and E. coli cells, respectively. The levels of resultant strain bioluminescence in cultures sampled at varying OD are shown in Table 4. As could be seen form Table 4, bioluminescence intensities observed for B. subtilis and for E. coli cultures are approximately the same.

Table 4. A comparison of the levels of bioluminescence observed in B. subtilis 168 and E. coli cells transformed by plasmids with luxAB-genes.

Strains* OD = 0.1 OD = 0.2 OD = 0.5 OD = 1,0
B.s. pFba-leoAB 4500±600** 12000±1000 100000±15000 300000±50000
B.s. pFba-xenAB 3000±500 10000±1000 45000±6000 110000±15000
E.c. pTZ57R-leoAB 12000±2000 28000±3300 75000±7000 160000±45000
E.c. pTZ57R-xenAB 10000±1250 19000±2050 41000±5200 90000±17000

* B.s.—B. subtilis 168; E.c.—E. coli K12 BW25113

** Levels of luminescence are shown in RLU, relative light units, with background luminescence levels at 50 RLUs.

To quantify relative thermostability of luciferases in vivo, the luxAB gene expressing cells of B. subtilis 168 and E. coli BW25113 were grown at 28°С and 37°С for cells with luciferase from P. leiognathi and P. luminescens, respectively, until OD = 0.4–0.6 was reached. Then the tetracycline or chloramphenicol was added, and incubation was continued at elevated temperatures. In this experiment, addition of antibiotics prevented protein synthesis de novo.

Fig 1 shows the luminescence of B. subtilis 168 (with pFba-xenAB or pFba-leoAB) and E. coli BW25113 cells (with pTZ57R-xenAB or pTZ57R-leoAB) at various temperatures.

Fig 1. A plot reflecting relative drops in the levels of bioluminescence during 15 minutes of incubation at various temperatures.

Fig 1

BsLeo—B. subtilis 168 (pFba-leoAB). EcLeo- E. coli BW25113 (pTZ57R_leoAB). BsXen—B. subtilis 168 (pFba-xenAB). EcXen—E. coli BW25113 (pTZ57R_xenAB).

As could be seen at Fig 1, in B. subtilis the luciferases display higher thermostability than in E. coli. When expressed in B. subtilis, each luciferase reached inactivated state at the temperature of 3–5°С higher than in E. coli. In course of subsequent experimentation with thermal inactivation of luciferase in B. subtilis and E.coli cells in vivo, the differences in luciferase thermostabilities were taken into account.

According to data obtained in vitro [26] and in vivo in E. coli cells [11], P. leiognathi luciferase is significantly more thermolabile than luciferase from P. luminescense. The data in Fig 1 show that the same difference persists in the cells of B. subtilis.

Kinetics of luciferase thermal inactivation in vivo in B. subtilis cells were compared to that observed in cells of E. coli. Fig 2 presents inactivation kinetics at 41°С or 48,5°С for luciferases from P. leiognathi (Fig 2A), and P. luminescens (Fig 2B), respectively.

Fig 2. Plots of relative luminescence of B. subtilis and E. coli cells expressing luciferases P. luminescens (A) and P. leiognathi (B), and exposed to 48,5°С and 41°С, respectively.

Fig 2

Приведены средние значения шести экспериментов.Bc—B. subtilis 168; BcΔ—B. subtilis NBS2001 ΔdnaKJ::spc; Ec–E. coli BW25113; EcΔ—E. coli JW0013 ΔdnaK::kan;.

As could be seen from the data presented at Fig 2A, in all strains the bioluminescence intensity drops observed for P. luminescens luciferase are well described by a semi-logarithmic graph (lg A–time), and, therefore, thermal inactivation of this luciferasae is a first-order reaction. Table 5 shows respecitive first order rate constants (Kt).

Table 5. First order rate constants (Kt) for P. luminescens luciferase inactivation at 48.5°С.

Strain Rate constant, Kt, min-1 Correlation coefficient, R2
B. subtilis 0.0254 0.957
B. subtilis ΔdnaKJ 0.031 0.976
E. coli 0.074 0.992
E. coli ΔdnaK 0.132 0.993

As could be seen from Table 5, for luciferase of P. luminescens the ratio of the rate constants for wild type strains of E. coli and B. subtilis was 2.9, while for ΔdnaK mutant strains of same bacteria this ratio was 4.3.

As could be seen from the data presented at Fig 2B, for luciferase of P. leiognathi expressed in E. coli cells the bioluminescence intensity drops are also well described by a semi-logarithmic graph (lg A–time), while in B. subtilis cells respective kinetics are substantially more complex. To find out the order of this reaction, Rakovsky techniques was employed [27, §301 p. 466] by linearizing it in coordinates ln t1/2 Vs. ln A0, where A0 –initial activity, t1/2 –time to semi-inactivation (Fig 3A).

Fig 3. Dependence of initial bioluminescence and the time to semi-inactivation at 41°С (A) and linearization of data describing inactivation in coordinates ½*A-2 Vs. t (B) for B. subtilis cells expressing luciferase P. leiognathi.

Fig 3

Bc—B. subtilis 168; BcΔ—B. subtilis NBS2001 ΔdnaKJ::spc; A–units of activity.

As could be seen from Fig 3A, for both lines the slope is close to 2, indicating that the kinetics of this reaction is of a third-order. These data were linearized in coordinates ½*A-2 Vs. t and approximated by lines shown on Fig 3B. Table 6 shows rate constants for P. leiognathi thermal inactivation at 41°С in E. coli and B. subtilis cells.

Table 6. Rate constants (Kt) of P. leiognathi luciferase thermal inactivation.

Strain Order of the reaction Rate constant (Kt) Correlation coefficient, R2
E. coli 1 0,427 min-1 0,986
E. coli ΔdnaK 1 0,735 min-1 0,972
B. subtilis 3 1,06•10−4•min-1•A-2* 0,983
B. subtilis ΔdnaKJ 3 1,07•10−4•min-1•A-2 0,927

* A -–units of activity

Notably, the difference in the rates of P. leiognathi luciferase thermal inactivation at 41°С in the cells of E. coli and B. subtilis, which are described by first order and third order kinetics, respectively, leads to a prominent, orders-of magnitude difference in the levels of cell bioluminescence at 20 minutes post thermal inactivation onset.

When the luciferase of P. leiognathi undergoes thermal inactivation in E. coli, similar kinetics are observed at lower temperatures, which is explained by the presence of active bichaperone system DnaKJE-ClpB, which actively aids refolding [11]. However, as could be seen at Fig 2, in B. subtilis dnaK+ and dnaK-, kinetics of luciferase inactivation remain the same, while in E. coli the ratio of rate constants was at 1.8. This observation indicates that DnaKJE chaperone does not properly function in B. subtilis, as it is unable to support the refolding of luciferase.

Fig 4 depicts the data describing the refolding of luciferases from P. leiognathi and P. luminescens after thermal inactivation in vivo in E. coli or B. subtilis cells. Bacterial cells were incubated at 47°С or 51°С for E. coli or B. subtilis, respectively. In both cases, the luminescence levels gradually decreased across approximately 2–3 orders of magnitude till reaching the background levels, at which point the translation inhibitors, chloramphenicol for E. coli and tetracycline for B. subtilis, were added to media followed by incubating bacterial cultures at room temperature under continuous monitoring of their luminescence. Thermal inactivation time was about 15–25 minutes.

Fig 4. The kinetics of luminescence of E. coli and B. subtilis cells with thermal inactivated luciferases from P. leiognathi (A) and P. luminescens (B), which regained their activity after cell cultures were moved to room temperature.

Fig 4

Luciferases were thermal inactivated in vivo by exposure of carrier cells at either 47°С (E. coli) or 51°С (B. subtilis). Relative luminescence shown on vertical axis is proportional to percent of refolded luciferase molecules. The cells of B. subtilis were pPfbaA-LeoAB (luciferase P. leiognathi) and pPfbaA-XenAB (P. luminescens), while the cells of E. coli were transformed with plasmids pTZ57R-LeoAB (P. leiognathi) and pTZ57R-XenAB (P. luminescens). Bs—B. subtilis 168. BsΔ—B. subtilis NBS2001 ΔdnaKJ. Ec—E. coli BW25113. EcΔ—E. coli JW0013 ΔdnaK::kan.

As could be seen from the data presented on Fig 4A after thermal inactivation, the luminescence of E. coli cells expressing the P. leiognathi luciferase could be restored almost to its pre-inactivation levels. Evidently, this restoration is dependent on DnaK, as E. coli ΔdnaK cells are not able to restore their levels of luminescence after exposure to high temperatures.

In curves describing of the reactivation of thermally inactivated luciferases, both lag-period and inflection are unremarkable, thus, being indicative of possible multiples stages of reactivation reaction limited by some rate-limiting. Analysis of relatively fast refolding steps provides some difficulty due to rapid cooling down of the sample within the first few minutes after its return to the room temperature.

Analysis of slower steps of P. leiognathi luciferase refolding in E. coli cells, most parts of the kinetic curve are well approximated by exponential dependence of an accumulation of the product resulting from the first-order reaction with lag-period A = Amax×(1-ek×(t-tlag)), where Amax is the level of maximal degree of reactivation, k–first-order reaction rate constant and tlag–the time required for completion of fast steps of the refolding (Fig 5).

Fig 5. Non-linear approximation of a time-dependent increase of the activity of P. leiognathi luciferase in E. coli cells is described by first-order reaction kinetics with a lag-period.

Fig 5

Kinetics curve parameters Amax, k and tlag were derived by non-linear approximation using SciDAVis software (Amax = 57,11±0,85%, k = 0,035±0,002 min-1 and tlag = 3,42±0,44 min).

Refolding kinetics analysis of other strains showed that thermal inactivated cells of B. subtilis wild-type strain 168 are substantially less capable of luciferase refolding than E. coli, and successfully refold just approximately one percent of available denatured enzymes. In B. subtilis, the success of the refolding does not require the presence of DnaK chaperone. As opposed to E. coli, the cells of B. subtilis refold luciferases of P. leiognathi and P. luminescens to about the same levels, and with similar kinetics.

Discussion

A comparison of thermal inactivation kinetics of luciferases in E.coli and B. subtilis strains transformed with lux-biosensor plasmids demonstrated that the thermostability of these model proteins in Gram positive bacteria B. subtilis is higher than that in Gram negative E. coli, with the difference in tolerated temperatures reaching 4–5°C (Figs 1 and 2).

Earlier works demonstrated that luciferase activity in E. coli cells depend on ability of particular luciferase to refold [10]. According to date presented above, in Gram positive bacteria B. subtilis, enhanced thermostability of bacterial luciferases is not because of better refolding. In fact, native B. subtilis cells do not support luciferase refolding well. After incubation of B. subtilis cells with luciferase-bearing constructs on elevated temperatures, bioluminescience drops 3–4 orders of magnitude; the transfer of these cells back to the room temperature results in restoring luciferase activity up to approximately 1% of its initial levels either in presence or in absence of DnaKJ chaperone. In conclusion, our experiments point that the role that DnaKJE plays in termostability of luciferases in E. coli is limited to this models system. In fact, in B. subtilis cells this chaperone is not involved in improving the thermostability of luciferase.

Possibly, activity of thermal inactivated luciferases in B. subtilis may be rescued by other ATP-dependent chaperones, which are yet to be investigated. A set of biosensors plasmids incorporating luciferases of varying intrinsic thermostability, which we presented above, may facilitate further molecular and genetic dissection of the factors which govern the denaturing and the refolding of recombinant proteins in Gram positive cells.

Acknowledgments

Authors are grateful to Dr. H. Yoshikawa (Department of Bioscience, Tokyo University of Agriculture, Sakuragaoka, Japan) for graciously letting us to use B. subtilis strains with chaperone mutations.

Abbreviations

DnaKJE

DnaK DnaJ GrpE

RLU

relative light units

Data Availability

All relevant data are within the paper.

Funding Statement

This study was supported by State Contract 6.9899.2017/8.9 (for Manukhov IV), by State Project 595-00003-19 PR (for Zavilgelsky GB), and by RFBR 20-34-70132 (for Gnuchikh EY).

References

  • 1.Anfinsen CB. Principles that govern folding of protein chains. Science 1973; 181: 223–230. 10.1126/science.181.4096.223 [DOI] [PubMed] [Google Scholar]
  • 2.Hartl FU. Molecular chaperones in cellular protein folding. Nature, 1996; 381: 571–580. 10.1038/381571a0 [DOI] [PubMed] [Google Scholar]
  • 3.Bukau B, and Horwich AL. The Hsp70 and Hsp60 Chaperone Machines. Cell, 1998; 92: 351–366. 10.1016/s0092-8674(00)80928-9 [DOI] [PubMed] [Google Scholar]
  • 4.Lund PA. Microbial molecular chaperones. Adv. Microb. Physiol. 2001, 44:93–140. 10.1016/s0065-2911(01)44012-4 [DOI] [PubMed] [Google Scholar]
  • 5.Teter SA, Houry WA, Ang D, Tradler T, Rockabrandt D, Fischer G, et al. Polypeptide flux through bacterial Hsp70: DnaK cooperates with trigger factor in chaperoning nascent chains. Cell, 1999. 97(6):755–765. 10.1016/s0092-8674(00)80787-4 [DOI] [PubMed] [Google Scholar]
  • 6.Hoskins JR, Sharma S, Sathyanarayana BK, and Wickner S. Clp ATPases and their role in protein unfolding and degradation. Adv. Protein Chem. 2001, 59:413–429. 10.1016/s0065-3233(01)59013-0 [DOI] [PubMed] [Google Scholar]
  • 7.Mogk A, Deuerling E, Vorderwwulbecke S, Vierling E, Bukau B. Small heat shock proteins, ClpB and the DnaK system form a functional trade in reversing protein aggregation. Molecular Microbiol. 2003. 50:585–595.; [DOI] [PubMed] [Google Scholar]
  • 8.Mogk A, Schlieker C, Friedrich KL, Schonfeld H-J, Vierling E, Bukau B. Refolding of substrates bound to small HSPs relies on a disaggregation reaction mediated most efficiently by ClpB/DnaK. J. Biol. Chem. 2003. 278: 31033–31042. 10.1074/jbc.M303587200 [DOI] [PubMed] [Google Scholar]
  • 9.Frydman J, Nimmesgern E, Ohtsuka K and Hartl FU. Folding of nascent polypeptide chains in a high molecular mass assembly with molecular chaperones. Nature. 1994; 370(6485):111–117. 10.1038/370111a0 [DOI] [PubMed] [Google Scholar]
  • 10.Schroder H, Langer T, Hartl FU, and Bukau B. DnaK, DnaJ and GrpE form a cellular chaperone machinery capable of repairing heat-induced protein damage. EMBO J. 1993, 12(11):4137–4144. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Manukhov IV, Eroshnikov GE, Vyssokikh MYu, Zavilgelsky GB. Folding and refolding of thermolabile and thermostable bacterial luciferases: the role of DnaKJ heat-shock proteins. FEBS Lett. 1999. (448). P. 265–268. [DOI] [PubMed] [Google Scholar]
  • 12.Zavilgelsky GB, Kotova VY, Mazhul' MM, Manukhov IV. Role of Hsp70 (DnaK-DnaJ-GrpE) and Hsp100 (ClpA and ClpB) chaperones in refolding and increased thermal stability of bacterial luciferases in Escherichia coli cells. Biochemistry (Mosc). 2002; 67(9):986–92. [DOI] [PubMed] [Google Scholar]
  • 13.Hsieh TY, Nillegoda NB, Tyedmers J, Bukau B, Mogk A, Kramer G. Monitoring protein misfolding by site-specific labeling of proteins in vivo. PLoS One. 2014, 9(6):e99395 10.1371/journal.pone.0099395 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Francis KP, Yu J, Bellinger-Kawahara C, Joh D, Hawkinson MJ, Xiao G, et al. , Visualizing pneumococcal infections in the lungs of live mice using bioluminescent Streptococcus pneumoniae transformed with a novel gram positive lux transposon, Infect. Immun. 2001, 69 (5): 3350–3358 10.1128/IAI.69.5.3350-3358.2001 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Deryabin DG, Efremova LV, Karimov IF, Manukhov IV, Gnuchikh EY, Miroshnikov SA. Microbiology Comparative sensitivity of the luminescent Photobacterium phosphoreum, Escherichia coli, and Bacillus subtilis strains to toxic effects of carbon-based nanomaterials and metal nanoparticles. Microbiology (Mikrobiologiya). 2016, 85(2): 177–186. [PubMed] [Google Scholar]
  • 16.Deryabin DG, Karimov IF, Manukhov IV, Tolmacheva NA, Balabanov VP. Differential analysis of bactericidal systems of blood serum with recombinant luminescent Escherichia coli and Bacillus subtilis strains. Bull Exp Biol Med. 2012; 154(1):59–63. 10.1007/s10517-012-1875-5 [DOI] [PubMed] [Google Scholar]
  • 17.Vesterlund S, Paltta J, Lauková A, Karp M, Ouwehand AC. Rapid screening method for the detection of antimicrobial substances. J Microbiol Methods. 2004; 57(1):23–31. 10.1016/j.mimet.2003.11.014 [DOI] [PubMed] [Google Scholar]
  • 18.Immonen N, Karp M. Bioluminescence-based bioassays for rapid detection of nisin in food. Biosens Bioelectron. 2007; 22(9–10):1982–7. 10.1016/j.bios.2006.08.029 [DOI] [PubMed] [Google Scholar]
  • 19.Reyes DY, and Yoshikawa H. 2002. DnaK chaperone machine and trigger factor are only partially required for normal growth of Bacillus subtilis. Biosci. Biotechnol. Biochem. 66:1583–1586. 10.1271/bbb.66.1583 [DOI] [PubMed] [Google Scholar]
  • 20.Smirnov SV, Kotliarova VA. Method for producing isoprene using bacterium. Patent 2015.
  • 21.Spizizen J. Transformation of biochemically deficient strains of Bacillus subtilis by deoxyribonucleate. Proc Natl Acad Sci USA. 1958; 44:1072–1078. 10.1073/pnas.44.10.1072 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Mandel M, Higa A. Calcium-dependent bacteriophage DNA infection. J Mol Biol. 1970; 53(1):159–62. 10.1016/0022-2836(70)90051-3 [DOI] [PubMed] [Google Scholar]
  • 23.Titok MA, Chapuis J, Selezneva YV, Lagodich AV, Prokulevich VA, Ehrlich SD, et al. Bacillus subtilis soil isolates: Plasmid replicon analysis and construction of a new theta-replicating vector. Plasmid. 2003; 49:53–62. 10.1016/s0147-619x(02)00109-9 [DOI] [PubMed] [Google Scholar]
  • 24.Guiziou S, Sauveplane V, Chang HJ, Clerté C, Declerck N, Jules M, et al. A part toolbox to tune genetic expression in Bacillus subtilis. Nucleic Acids Res. 2016; 44:7495–7508. 10.1093/nar/gkw624 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Bazhenov SV, Khrulnova SA, Konopleva MN, Manukhov IV. Seasonal changes in luminescent intestinal microflora of the fish inhabiting the Bering and Okhotsk seas. FEMS Microbiol Lett. 2019. February 1;366(4). 10.1093/femsle/fnz040 [DOI] [PubMed] [Google Scholar]
  • 26.Tyulkova N.A., Sandalova T.P Comparative study of temperature effects on bacterial luciferases. Biochemistry. 1996; 2(61):205. [Google Scholar]
  • 27.Rakovskii Adam Vladislavovich. A course in physical chemistry. Goskhimizdat, 1939 (Leningrad)—544s. http://books.e-heritage.ru/book/10076516.

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

All relevant data are within the paper.


Articles from PLoS ONE are provided here courtesy of PLOS

RESOURCES