Siglec1-expressing subcapsular sinus macrophages provide soil for melanoma lymph node metastasis

Rohit Singh; Beom K Choi

doi:10.7554/eLife.48916

. 2019 Dec 24;8:e48916. doi: 10.7554/eLife.48916

Siglec1-expressing subcapsular sinus macrophages provide soil for melanoma lymph node metastasis

Rohit Singh ^1,^✉, Beom K Choi ^2,^✉

Editors: Richard M White³, Päivi M Ojala⁴

PMCID: PMC6930078 PMID: 31872800

Abstract

Lymph nodes (LNs) are a common site of metastasis in solid cancers, and cutaneous melanomas show inherent properties of LN colonization. However, interactions between LN stroma and pioneer metastatic cells during metastatic colonization remain largely uncharacterized. Here we studied mice implanted with GFP-expressing melanoma cells to decipher early LN colonization events. We show that Siglec1-expressing subcapsular sinus (SCS) macrophages provide anchorage to pioneer metastatic cells. We performed in vitro co-culture to demonstrate that interactions between hypersialylated cancer cells and Siglec1 drive the proliferation of cancer cells. When comparing the transcriptome profile of Siglec1-interacting cancer cells against non-Siglec1-interacting cancer cells, we detected enrichment in positive regulators of cell cycle progression. Further, knockout of St3gal3 sialyltransferase compromised the metastatic efficiency of tumor cells by reducing α−2,3-linked sialylation. Thus, the interaction between Siglec1-expressing SCS macrophages and pioneer metastatic cells drives cell cycle progression and enables efficient metastatic colonization.

Research organism: Mouse

eLife digest

Cancer cells can leave the site where they arise and travel to other organs. Very few of the cancer cells that make this journey will survive long enough to form new tumors (also known as ‘metastases’). However, melanoma cells – the most aggressive type of skin cancer cells – are an exception. These cells will often colonize their nearest lymph nodes and melanoma patients with metastases in the lymph nodes are less likely to survive than those patients without them.

Previous studies have shown that melanoma cells arrive at a lymph node and first proliferate in the region at the edge of this organ, known as the subcapsular sinus, before moving to the center. However, it was not understood how melanoma cells manage to survive in the subcapsular sinus.

Now, Singh and Choi have tracked fluorescent melanoma cells to observe how they interact with the cells in the lymph nodes in mice. Melanoma cells have ‘sticky’ proteins coated with sugars on their surface. The results show that when the cells arrive in the subcapsular sinus these proteins bind to a receptor called Siglec1 located on the surface of immune cells called macrophages, which are also present. In this way, the melanoma cells anchor themselves in the lymph node. Moreover, binding Siglec1 helps melanoma cells survive and proliferate. In a last set of experiments, Singh and Choi deleted the enzyme responsible for making the sugar molecules in melanoma cells. Without the sugar coat, melanoma cells were less able to anchor themselves and grow within the mouse lymph nodes.

Lymph nodes are often the first stop for melanoma cells on the way to other organs. Therefore, understanding the interaction between melanoma cells and macrophages might be useful for developing therapies that could disrupt this process and treat this aggressive cancer.

Introduction

Lymphatic dissemination is a common metastasis route in solid cancers and LN metastasis is often associated with the severity of the disease (Nathanson, 2003). Although the clinical consequences of LN metastasis are debatable, recent reports have described clinically relevant events that take place during LN colonization by tumor cells (Werner-Klein et al., 2018; Pereira et al., 2018; Brown et al., 2018; Lee et al., 2019; Naxerova et al., 2017). Melanoma metastasizes to LNs very early in cancer progression and metastatic cells acquire driver genetic changes during colonization of LNs, suggesting the important role that LNs have in tumor evolution (Werner-Klein et al., 2018). These evolved post-LN-colonizing cancer cells with acquired colonization signatures show superior xenograft formation in mice compared with pre-colonizing cancer cells, suggesting a possible reason as to why metastasis-positive LNs are linked to disease severity in cancer (Werner-Klein et al., 2018). Moreover, LNs provide a foothold for metastatic cells to disseminate further. Besides lymphatic dissemination to downstream LNs, during LN colonization metastatic cells gain access to the blood vessels in LNs and take a hematogenous route to colonize peripheral organs (Pereira et al., 2018; Brown et al., 2018). Despite all clinically important roles that LNs have in the systemic spread of evolved cancer cells, our knowledge of the early events of LN colonization by pioneer metastatic cells is very limited (Naxerova et al., 2017).

The distal organ metastatic colonization process is organ-specific and requires interactions between disseminated tumor cells (DTCs; seed) and distal organs (soil) to reinitiate growth (Peinado et al., 2017; Massagué and Obenauf, 2016). Although primary tumors release many early DTCs into the circulation, which are the precursors of metastasis, very few eventually form distal metastasis. The majority of DTCs that land in unfamiliar distal sites fail to survive the hostile microenvironment of the new-found stroma. This inefficiency of metastasis suggests that distal organ colonization is a bottleneck of the metastasis colonization process. To gain a foothold in new landing sites, pioneer metastatic cells require active participation of the host stroma to obtain survival and viability signals (Mehlen and Puisieux, 2006; Buchheit et al., 2014). A better understanding of the events that define this interaction between metastatic cells and host organ stroma is needed to identify actionable vulnerabilities of the metastatic colonization process. The current paradigm posits that LN metastatic colonization begins with the arrest of metastatic cells in the LN subcapsular sinus (SCS) (Das et al., 2013; Jeong et al., 2015). However, in LN metastasis, focus is often given to post-metastatic colonization events, whereas the interactions between metastatic cells and host stroma that leads to LN colonization by tumor cells remains largely uncharacterized (Nathanson, 2003; Lee et al., 2019; Das et al., 2013; Jeong et al., 2015; Olmeda et al., 2017). Therefore, using enhanced green fluorescent protein (GFP)-expressing mouse melanoma cells, we investigated the early LN metastatic colonization events and how LN supports the newly arrived DTCs.

Results

LN metastatic colonization begins with interactions between pioneer metastatic cells and Siglec1⁺ SCS macrophages

To decipher the earliest metastatic events in LN, we first defined the stage at which melanoma LN metastasis formation takes place. Enhanced green fluorescent protein-expressing B16F10 (B16-GFP) melanoma cells were injected into mouse footpads to form primary tumor (Figure 1—figure supplement 1A). The advantage of this model is that it mimics the natural course of metastasis, that is, primary tumor growth, pre-metastatic conditioning of draining LNs, and dissemination of tumor cells followed by LN colonization (Jeong et al., 2015; Harrell et al., 2007), while GFP enables us to track cancer cells even as single cells. Pioneer metastatic cells could be observed in the SCS of sentinel popliteal LNs lined by Lyve-1⁺ lymphatic endothelial cells as early as 2 weeks after inoculation and before the appearance of any visible macroscopic metastatic foci (Figure 1—figure supplement 1B). Given the cell composition of the LN SCS and prominent presence of SCS macrophages in the sinus (Gray and Cyster, 2012), we reasoned that pioneer metastatic cells may use SCS macrophages to find an initial anchorage point. Therefore, we stained the LN sections positive for B16-GFP cells with anti-Siglec1 (CD169) antibody, the surface protein highly expressed on macrophages on the floor of the SCS and in the LN medullary region (Gray and Cyster, 2012; Nakamura et al., 2002). Of note, by depleting LN-resident macrophages through injecting clodronate liposomes into the mouse footpads, we confirmed that Siglec1 is primarily expressed on SCS and medullary sinus macrophages in LNs (Figure 1—figure supplement 2). We found the pioneer metastatic cells in close contact with SCS macrophages within the LN SCS, suggesting they interact with each other right after metastastic cells enter the SCS (Figure 1A and B; Video 1). Likewise, we confirmed this SCS macrophage–tumor cell interaction using another cell surface marker expressed on SCS macrophages, CD11b (Figure 1—figure supplement 1C). We analyzed the sections from day 17 to day 21, and found that after initial cancer cell attachment to SCS macrophages, small metastatic foci developed within the SCS (Figure 1C). With the increase in size, the foci exerted pressure on the SCS macrophage–lymphatic lining, which eventually lead to disruption of the sinus lining and metastatic cells entering the LN cortex (Figure 1D). Of note, to test the generalizability of our observations, we implanted an EGFP-expressing 4T1 mouse breast cancer cell line into mouse footpads and found that breast cancer cells also used SCS macrophages to find a foothold in LNs (Figure 1—figure supplement 3). Taken together with previous observations (Das et al., 2013; Jeong et al., 2015), where LN metastatic cells from different tumor types remain in the SCS and form a metastatic focus before invading into the LN cortex, our observations indicate that other tumors metastasizing to LNs may also use a LN colonization mechanism similar to melanoma.

Figure 1. — B6 mice were implanted with B16-GFP cancer cells in footpads. Representative laser scanning microscopy images of cryosectioned sentinel popliteal LNs (pLNs) on indicated days are shown. (A) Image taken at 14 days post-inoculation; pioneer metastatic cells (green) were evident in the subcapsular sinus (SCS) of pLN. Here, metastatic cell could be seen in close contact with Siglec1⁺ SCS macrophages (red) in the LN SCS lined by lymphatic endothelial cells (blue). (B) A laser scanning microscope image of early metastatic B16F10 cell (green) in close contact with LN SCS macrophages (Siglec1, red; nucleus, blue) and its 3D reconstructed image. (C) Metastatic cells resumed proliferation and formed microscopic metastatic foci within the LN SCS. (D) Metastatic foci grew and disrupted the SCS macrophage–lymphatic endothelial cell lining and entered the LN cortex. Data representative of four biologically independent experiments. (**E, F**) Adhesion assays of B16-GFP cells on monolayers of HEK293T or Siglec-1 expressing HEK293T cells. (E) Representative photomicrographs of adherent B16-GFP cells on the monolayer of indicated HEK293T cells. (F) Quantification of the number of adherent B16-GFP cells on monolayers. Data are ±s.d.; n = 4 biologically independent experiments. P-value was calculated by two-tailed, unpaired t-test.

Figure 1—source data 1. This spreadsheet contains the source data for Figure 1F.

elife-48916-fig1-data1.xlsx^{(30.7KB, xlsx)}

Figure 1—figure supplement 1. — B6 mice were implanted with B16-GFP cancer cells in footpads. Representative laser scanning microscopy images of cryosectioned sentinel popliteal LNs (pLNs) on indicated days are shown. (A) Image taken at 14 days post-inoculation; pioneer metastatic cells (green) were evident in the subcapsular sinus (SCS) of pLN. Here, metastatic cell could be seen in close contact with Siglec1⁺ SCS macrophages (red) in the LN SCS lined by lymphatic endothelial cells (blue). (B) A laser scanning microscope image of early metastatic B16F10 cell (green) in close contact with LN SCS macrophages (Siglec1, red; nucleus, blue) and its 3D reconstructed image. (C) Metastatic cells resumed proliferation and formed microscopic metastatic foci within the LN SCS. (D) Metastatic foci grew and disrupted the SCS macrophage–lymphatic endothelial cell lining and entered the LN cortex. Data representative of four biologically independent experiments. (**E, F**) Adhesion assays of B16-GFP cells on monolayers of HEK293T or Siglec-1 expressing HEK293T cells. (E) Representative photomicrographs of adherent B16-GFP cells on the monolayer of indicated HEK293T cells. (F) Quantification of the number of adherent B16-GFP cells on monolayers. Data are ±s.d.; n = 4 biologically independent experiments. P-value was calculated by two-tailed, unpaired t-test.

Figure 1—source data 1. This spreadsheet contains the source data for Figure 1F.

elife-48916-fig1-data1.xlsx^{(30.7KB, xlsx)}

Video 1. A close interaction of SCS macrophages (red) and metastatic cell (green) visualized in 3D space within lymph node SCS lined by lymphatic endothelial cells (blue).

Download video file^{(3.5MB, mp4)}

Open in a new tab

We can see the SCS macrophage protrusion which spreads over wide surface of cancer cells, this contact provides anchorage to newly arrived pioneer metastatic cell in SCS (nuclei, white).

Siglec1 binds to α2,3-sialylated proteins on cancer cells

Increased protein sialylation is characteristic of several cancer types including melanomas (Kim and Varki, 1997; Agrawal et al., 2017). Using Maackia amurensis II and Sambucus nigra lectins (α−2,3- and α−2,6-sialylation-specific, respectively) (Varki, 2007) we found more than 10-fold higher cell surface α2,3‐ and α2,6‐linked sialylation in B16F10 melanoma cells compared with non-tumorigenic mouse melanocytes, melan-A cell line (Figure 1—figure supplement 4A–D) (Bennett et al., 1987). Of note, melan-A cells showed only basal levels of α2,3-sialylation. As Siglec1 is a sialic-acid-recognizing protein that interacts with α2,3‐ and α2,6‐linked sialylated proteins (Crocker et al., 1999), we hypothesized that it is Siglec1 itself that is responsible for the SCS macrophage–tumor cell interaction (Nath et al., 1999). To confirm this, we used cell adhesion assay. HEK293T cells were grown as a monolayer in chamber slides and transfected with plasmid expressing mouse Siglec1 or empty plasmid as a mock control. We found significantly higher adherence of B16-GFP cells to Siglec1-expressing HEK293T cells compared with mock-transfected cells (Figure 1E,F). Additionally, we confirmed Siglec1 binding to cancer cells by flow cytometry and microscopy employing recombinant mSiglec1(ECD)-mFC protein (Figure 1—figure supplement 4E,F). Furthermore, treatment with sialidase abolished the Siglec1 binding to cancer cells while removing the α2,3‐ sialylation completely and α2,6- sialylation by one third, suggesting Siglec1 preferentially binds to α2,3‐sialylated protein on cancer cells (Figure 1—figure supplement 5A–F). Based on the above in vivo and in vitro results, we suggest that Siglec1-expressing SCS macrophages provide the ‘soil’ for incoming metastatic cells and prevent their washout with lymph flow.

Siglec1-interacting cancer cells show higher proliferation

With limited chances of survival, disseminated tumor cells (DTCs) land in distal metastasis sites (Massagué and Obenauf, 2016). To establish a new colony, pioneer metastatic cells must overcome anoikis and amorphosis, and resume proliferation by establishing adhesive and signaling interactions with host tissue (Mehlen and Puisieux, 2006; Buchheit et al., 2014). As our data confirmed cell-to-cell contact between SCS macrophages and pioneer metastatic cells, we investigated the functional consequences of this interaction for tumor cells. We used apoptosis marker cleaved-caspase-3 and cell proliferation marker Ki67 to determine the proliferation status of pioneer metastatic cells and found that they were in a non-proliferative non-apoptotic state when they landed in the LN SCS, and resumed proliferation after they came into contact with SCS macrophages (Figure 2A–D). To confirm this, we used an in vitro co-culture method. Mouse Siglec1 was transiently expressed in HEK293T cells and B16-GFP cells were co-cultured with these Siglec1-expressing cells (hereafter referred to as HEK^Siglec1 and HEK^Mock for cells transfected with plasmid expressing mouse Siglec1 and empty plasmid, respectively; Figure 2E, Figure 2—figure supplement 1A). Of note, Siglec1 expression did not affect the proliferation status of HEK293T cells (Figure 2—figure supplement 1B). To mimic the non-adherent nature of DTCs, we co-cultured cells in low binding culture plates. Of note, we observed that cancer cells cultured in non-adherent conditions showed significantly reduced Ki67 expression, similar to DTCs (Figure 2—figure supplement 1C,D) (Pantel and Brakenhoff, 2004). We found more Ki67⁺ proliferating B16-GFP cells in tumor cells-HEK^Siglec1 co-cultures compared with cells co-cultured with HEK^Mock (Figure 2F,G). To exclude the possibility that expression of Siglec1 may induce HEK293T cells to secrete some pro-proliferation factors and in turn induce B16-GFP cell proliferation, we prepared conditioned media from HEK^Mock and HEK^Siglec1 cells and treated the B16-GFP cells in a similar setting as the co-culture experiments. Conditioned media did not affect the proliferation of B16-GFP cells (Figure 2—figure supplement 1E,F). We next tested the role of Siglec1 in the survival of cancer cells. We assessed Annexin V staining in B16-GFP cells after co-culturing B16-GFP cells with HEK^Mock and HEK^Siglec1 cells. B16-GFP cells co-cultured with HEK^Siglec1 cells had significantly lower Annexin V-positive apoptotic cells (Figure 2H,I). We further validated these results using a mouse macrophage cell line, J774A.1, which expresses Siglec1 (Figure 2—figure supplement 2A). We used siRNA to knockdown Siglec1 expression in J774A.1 cells and performed co-culture experiments with B16-GFP cells (Figure 2—figure supplement 2B–D). We observed decreased proliferation of B16-GFP cells co-cultured with these Siglec1 knockdown J774A.1 macrophages compared with B16-GFP cells co-cultured with control siRNA-transfected macrophages (Figure 2—figure supplement 2E,F). Furthermore, we observed a significant increase in Annexin V-positive apoptotic cancer cells when they were co-cultured with Siglec1-knocked down macrophages (Figure 2—figure supplement 2G,H). Taken together, our data revealed a role for Siglec1 in cancer cell survival and proliferation during the initial metastatic colonization of LNs by pioneer metastatic cells.

(**A–D**) Apoptosis (cleaved caspase-3, white; **A, B**) and proliferation (Ki67, white; **C, D**) in newly deposited metastatic cells in the LN SCS. Pioneer metastatic cells were in a non-apoptotic non-proliferative state when they landed in the SCS and resumed growth after arrest by SCS macrophages. Data representative of four biologically independent experiments. (E) Schematic of co-culture experimental procedure. HEK293T cells were transfected with empty mammalian expression plasmid or mSiglec1-expressing plasmid. Cells were cultured for 3 days before use in co-culture experiments with B16-GFP cells. (**F, G**) Proliferation of B16-GFP cells measured by Ki67 expression after 18 hr co-culture with HEK^Mock or HEK^Siglec1 cells (n = 4 independent experiments, P-value by two-tailed, unpaired t-test). (**H, I**) Apoptosis in B16-GFP cells after 18 hr co-culture with HEK^Mock or HEK^Siglec1 cells measured by Annexin V staining (n = 4 independent experiments, P-value by two-tailed, unpaired t-test). (**J–M**) Intracellular Phosflow staining to access phosphorylated AKT (pAKT; **J, K**) and phosphorylated ERK1/2 (pERK; **L, M**) levels in B16-GFP cells after 18 hr co-culture with HEK^Mock or HEK^Siglec1 cells. Bar graphs represent fold change in phosphorylation over B16-GFP co-cultured with HEK^Mock (n = 3 independent experiments; P-value was calculated by two-tailed, unpaired t-test). CC3, cleaved caspase-3; meta, metastasis.

Figure 2—source data 1. This spreadsheet contains the source data for Figure 2.

elife-48916-fig2-data1.xlsx^{(32.9KB, xlsx)}

Figure 2—figure supplement 1. — (**A–D**) Apoptosis (cleaved caspase-3, white; **A, B**) and proliferation (Ki67, white; **C, D**) in newly deposited metastatic cells in the LN SCS. Pioneer metastatic cells were in a non-apoptotic non-proliferative state when they landed in the SCS and resumed growth after arrest by SCS macrophages. Data representative of four biologically independent experiments. (E) Schematic of co-culture experimental procedure. HEK293T cells were transfected with empty mammalian expression plasmid or mSiglec1-expressing plasmid. Cells were cultured for 3 days before use in co-culture experiments with B16-GFP cells. (**F, G**) Proliferation of B16-GFP cells measured by Ki67 expression after 18 hr co-culture with HEK^Mock or HEK^Siglec1 cells (n = 4 independent experiments, P-value by two-tailed, unpaired t-test). (**H, I**) Apoptosis in B16-GFP cells after 18 hr co-culture with HEK^Mock or HEK^Siglec1 cells measured by Annexin V staining (n = 4 independent experiments, P-value by two-tailed, unpaired t-test). (**J–M**) Intracellular Phosflow staining to access phosphorylated AKT (pAKT; **J, K**) and phosphorylated ERK1/2 (pERK; **L, M**) levels in B16-GFP cells after 18 hr co-culture with HEK^Mock or HEK^Siglec1 cells. Bar graphs represent fold change in phosphorylation over B16-GFP co-cultured with HEK^Mock (n = 3 independent experiments; P-value was calculated by two-tailed, unpaired t-test). CC3, cleaved caspase-3; meta, metastasis.

Figure 2—source data 1. This spreadsheet contains the source data for Figure 2.

elife-48916-fig2-data1.xlsx^{(32.9KB, xlsx)}

Siglec1-interacting cancer cells show higher phosphorylation of AKT and ERK1/2

Successful metastatic colonization requires activation of the pro-survival PI3K/AKT and ERK pathways (Buchheit et al., 2014). Because these two cascades are crucial for metastatic colonization, we tested whether they were sensitive to Siglec1-dependent cancer cell interactions. After co-culturing B16-GFP cells with HEK^Siglec1 or HEK^Mock for 18 hr, we performed intracellular Phosflow analysis. Siglec1 engagement with cancer cells induced AKT phosphorylation at S473, which is a PI3K-mediated AKT-activating event (Figure 2J,K). Furthermore, in a similar setting, we found higher levels of phosphorylated ERK1/2 (ERK1, T203/Y205; ERK2, T183/Y185; Figure 2L,M) in cancer cells co-cultured with HEK^Siglec1. We further analyzed AKT and ERK1/2 phosphorylation in B16-GFP cells co-cultured with Siglec1-knocked down J774A.1 cells. Consistent with the reduced proliferation and increased apoptosis in B16-GFP co-cultured with Siglec1-knocked down J774A.1 cells, we found reduced AKT and ERK1/2 phosphorylation in comparison with cells co-cultured with J774A.1 cells transfected with control siRNA (Figure 2—figure supplement 2I–L). Collectively, these results suggest that Siglec1 interactions provide growth cues to cancer cells. Therefore, these interactions may facilitate the LN colonization of melanoma cells.

Siglec1 drives transcriptional programs necessary for metastatic colonization

Next, to determine the molecular outcome of tumor cell and Siglec1 interactions, we performed a whole transcriptome analysis (Figure 3A). Compared with tumor cells that were not interacting with Siglec1, tumor cells cultured with HEK^Siglec1 showed differential expression (fold change >1.5; raw P<0.05) of 239 genes, of which 68 were upregulated and 171 were downregulated (Figure 3B, Figure 3—source data 1). A pathway analysis of the upregulated genes revealed that tumor cells from HEK^Siglec1–tumor cell co-culture displayed enrichment in positive regulators of cell cycle and DNA replication compared with cancer cells cultured with mock-transfected HEK293T cells (Figure 3C). Furthermore, gene ontology analysis revealed that upregulated genes were mainly involved in cell cycle-related biological processes (Figure 3D,E). Consistent with FACS analysis of Ki67 staining, RNA sequencing results confirmed higher levels of Ki67 expression in HEK^Siglec1 co-cultured cancer cells (Figure 3E, Figure 3—source data 1). Additionally, we observed downregulation of apoptosis-related (Bbc3, Rras, Ddit3, Ddit4) and tumor suppressor (Hes1, Ahnak, Timp3, Smad7, Ndrg1) genes in Siglec1-interacting cancer cells (Figure 3—source data 1). Thus, the interaction between Siglec1 and cancer cells drove cell cycle progression and proliferation in cancer cells. In light of the prior knowledge of the vulnerabilities of metastatic processes, Siglec1-mediated interactions between SCS macrophages and metastatic cells may provide the vital support required to overcome dormancy and initiate successful LN colonization (Pantel and Brakenhoff, 2004; Sosa et al., 2014).

Siglec1-interacting cancer cells show high PLK1 activation

As we observed a shift towards increased cell cycle activity and proliferation in Siglec1-interacting cancer cells, we sought to further explain the mechanism by which Siglec1 interaction induces cell cycle activation in tumor cells by examining the critical mitotic events. To this end, we revisited our RNA sequencing results to identify important molecular events that regulate mitotic entry. Gene expression data showed significant upregulation in cell cycle master regulator PLK1 expression in co-culture experiments (Figure 3E, Figure 3—source data 1) (Paschal et al., 2012). This prompted us to compare PLK1 activation in primary tumor and early LN metastatic cells. We used Phosflow to compare PLK1 phosphorylation in primary tumor and LN metastatic cells. PLK1 phosphorylation at T210 is a mitosis-specific G2/M transition-activating event (Paschal et al., 2012). We found 1.8-fold higher activation of PLK1 in LN metastatic cells in comparison with primary tumor cells (Figure 4A,B). Consistently, in in vitro experiments, we found marked increase in mitosis-committed cancer cells when B16-GFP cells were co-cultured with HEK^Siglec1 in comparison with HEK^Mock (Figure 4C,D). With a reverse approach, where we knocked down Siglec1 using siRNA in J774A.1 macrophages and performed co-culture experiments with B16-GFP cells, we found that knockdown of Siglec1 significantly decreased PLK1 phosphorylation (Figure 4E–G, Figure 2—figure supplement 2A–D). Taken together, Siglec1-interacting tumor cells showed higher PLK1 phosphorylation than those that did not interact with Siglec1. This strong mitotic induction observed in Siglec1-interacting tumor cells and confirmed by high PLK1 phosphorylation during early LN metastatic colonization supports our model whereby Siglec1 confers a growth advantage to pioneer metastatic cells. This presence of a highly growth permissive ‘soil’ reflects the high prevalence of LN metastasis in melanoma during the early stages of primary tumor growth, even before metastasis to peripheral organs.

(A) FACS plots showing phosphorylated PLK1 (pPLK1) in primary tumor (PT) and LN metastatic cells (LN meta). (B) Fold change in pPLK1 in LN meta vs. PT cells calculated from A (n = 12 from three independent experiments with four animals per experiment; bar represents ±s.d., P-value was calculated by two-tailed, unpaired t-test). (**C, D**) PLK1 phosphorylation in B16-GFP cells after 18 hr co-culture with indicated cancer cells/HEK293T co-culture. Representative FACS plot (C) and quantification (D) are shown (n = 4 independent experiments). (E) Schema of siRNA transfection in J774A.1 mouse macrophage cells and co-culture with B16-GFP cells. (**F, G**) PLK1 phosphorylation in B16-GFP cells after 18 hr co-culture with *Siglec1*-knocked down and control J774A.1 cells.( G) Quantification of (F) (n = 4 independent experiments, P-value was calculated by two-tailed, unpaired t-test).

Figure 4—source data 1. This spreadsheet contains the source data for Figure 4.

elife-48916-fig4-data1.xlsx^{(32.5KB, xlsx)}

Role of α2,3-sialylation in LN metastasis

Hypersialylation in cancers, including melanomas, is directly linked to the metastatic potential of cancer cells (Agrawal et al., 2017; Bos et al., 2009; Schultz et al., 2012). In previous experiments, we established that Siglec1 preferentially binds to α−2,3-linked sialylation (Figure 1—figure supplement 5A–F). One sialyltransferase, ST3 beta-galactoside alpha-2,3-sialyltransferase 3 (St3gal3) is known to produce Siglec-binding α−2,3 sialylation in mice and is linked to metastasis and poor prognosis in several cancer types (Guo et al., 2011; Pérez-Garay et al., 2010; Cui et al., 2011; Chang et al., 2006). Hence, we knocked out St3gal3 in B16-GFP cells using CRISPR-mediated single base pair deletion (Figure 5—figure supplement 1A,B), which decreased α−2,3 sialylation of cell surface proteins by 20% (Figure 5—figure supplement 1C,D). Additionally, St3gal3 knockout (KO) cells showed approximately 70% reduced cell surface binding of Siglec1 (Figure 5—figure supplement 1E,F). Of note, St3gal3 KO did not affect the proliferation of B16-GFP cells in culture, in vitro adhesion and migration, or growth as primary tumors (Figure 5—figure supplement 1G–K), but it abrogated the ability of B16-GFP to adhere to a Siglec1-expressing HEK293T cell monolayer (Figure 5A,B). Notably, St3gal3 KO severely reduced the LN metastasis burden (Figure 5C–E). To explore the possibility of Siglec1 expression on primary tumor lymphatic vessels, which might have affected the initial egress of cancer cells from the primary tumor, we searched for Siglec1 expression on primary tumor lymphatic vessels and found none (Figure 5—figure supplement 2). Next, we sought to explain the reduced metastasis by comparing the morphological features of early metastatic foci and quantifying the proliferation and survival of metastatic cells in the LN SCS. Immunohistological analysis at an early metastasis stage (day 17) revealed that although St3gal3 KO B16-GFP cells are present in the LN SCS, they did not form foci and were not in contact with SCS macrophages (Figure 5F). Whereas, WT B16-GFP cells formed tight-knit foci in contact with SCS macrophages (Figure 5F). We further investigated whether this deprivation of Siglec1-derived signals from SCS macrophages affected the proliferation and survival of St3gal3 KO metastatic cells during early colonization. Ki67 staining revealed that St3gal3 KO B16-GFP cells showed severely reduced proliferation in the SCS in comparison with WT B16-GFP cells (Figure 5G,H). Furthermore, early metastatic cells originating from St3gal3 KO cells showed significantly decreased survival in the SCS (Figure 5I,J). Three weeks after tumor cell implantation, a large metastatic focus had formed in the LN, which disrupted the SCS macrophages lining the LN sinus, but St3gal3 KO tumors only formed small cell clusters, which crossed the SCS without growing in size in the SCS, suggesting a lack of ability to adhere to the SCS macrophages and hence reduced metastatic growth (Figure 5—figure supplement 3). Thus, overall α−2,3-sialylation abundance on tumor cells affects the efficiency of LN metastasis formation. Combined, these results suggest that the survival and proliferation of pioneer metastatic cells in the LN SCS is crucial process of metastatic colonization, and abrogation of SCS macrophage–tumor cell binding slowed down the metastatic colonization considerably.

(A) In vitro adhesion assay of wildtype (WT) and *St3gal3-*knockout (KO) B16-GFP cell lines to a Siglec1-expressing HEK293T monolayer. (B) The numbers of cells attached to the monolayer are plotted. Data are ±s.d.; n = 4 biologically independent experiments. P-value by two-tailed, unpaired t-test. (C) Representative images of metastasis bearing LNs from WT or KO B16-GFP tumor cells implanted in mice 3 weeks after injection. Red arrowheads indicate metastatic foci. (D) Representative plots of GFP⁺ metastasized cells in LNs of mice bearing 3 week primary WT or *St3gal3* KO B16-GFP melanoma tumors. (E) Graph showing total metastasis burden per LN in mice implanted with WT or *St3gal3* KO B16-GFP (quantification of C; n = 8 samples per group; P-value was calculated by two-tailed, unpaired t-test). (F) Morphological features of early metastatic foci (day 17) in the LN SCS of mice injected with WT or *St3gal3* KO B16-GFP (green, B16-GFP; red, SCS macrophages). (G) Representative confocal images of Ki67⁺ (white) nuclei in metastatic foci formed by WT or *St3gal3* KO B16-GFP cells in the LN SCS. (H) Quantification of Ki67⁺ nuclei in metastatic foci in (G). (I) Representative confocal image of apoptosis in WT and *St3gal3* KO B16-GFP cells during the early stages of LN metastatic colonization measured by cleaved caspase-3⁺ (white) staining. (J) Quantification of cleaved caspase-3⁺ cells in (I). Data are from a total of six mice in each group from two independent experiments; P-value by two-tailed, unpaired t-test.

Figure 5—source data 1. This spreadsheet contains the source data for Figure 5.

elife-48916-fig5-data1.xlsx^{(29.6KB, xlsx)}

Figure 5—figure supplement 1. — (A) In vitro adhesion assay of wildtype (WT) and *St3gal3-*knockout (KO) B16-GFP cell lines to a Siglec1-expressing HEK293T monolayer. (B) The numbers of cells attached to the monolayer are plotted. Data are ±s.d.; n = 4 biologically independent experiments. P-value by two-tailed, unpaired t-test. (C) Representative images of metastasis bearing LNs from WT or KO B16-GFP tumor cells implanted in mice 3 weeks after injection. Red arrowheads indicate metastatic foci. (D) Representative plots of GFP⁺ metastasized cells in LNs of mice bearing 3 week primary WT or *St3gal3* KO B16-GFP melanoma tumors. (E) Graph showing total metastasis burden per LN in mice implanted with WT or *St3gal3* KO B16-GFP (quantification of C; n = 8 samples per group; P-value was calculated by two-tailed, unpaired t-test). (F) Morphological features of early metastatic foci (day 17) in the LN SCS of mice injected with WT or *St3gal3* KO B16-GFP (green, B16-GFP; red, SCS macrophages). (G) Representative confocal images of Ki67⁺ (white) nuclei in metastatic foci formed by WT or *St3gal3* KO B16-GFP cells in the LN SCS. (H) Quantification of Ki67⁺ nuclei in metastatic foci in (G). (I) Representative confocal image of apoptosis in WT and *St3gal3* KO B16-GFP cells during the early stages of LN metastatic colonization measured by cleaved caspase-3⁺ (white) staining. (J) Quantification of cleaved caspase-3⁺ cells in (I). Data are from a total of six mice in each group from two independent experiments; P-value by two-tailed, unpaired t-test.

Figure 5—source data 1. This spreadsheet contains the source data for Figure 5.

elife-48916-fig5-data1.xlsx^{(29.6KB, xlsx)}

Discussion

Melanoma has a predilection for metastasizing to LNs in the early stages of the disease (Bedrosian et al., 2000). The high prevalence of LN metastasis early during tumor progression suggests the presence of a metastasis-permissive environment in LNs. Our data provide a possible explanation for this. We propose a model whereby lymphatic disseminated metastatic cells directly interact with SCS macrophages just after landing in the LN SCS. The overall abundance and continuous presence of Siglec1⁺ macrophages in the SCS facilitates efficient metastatic seeding by providing adherence and promoting cell cycle progression in otherwise vulnerable DTCs. Our model is in agreement with the sequence of events leading to metastatic colonization of LN observed by Das et al. and Jeong et al. using in vivo imaging, whereby they observed that pioneer metastatic cells remain in the LN SCS to form metastatic foci that grow in size and disrupts the SCS to invade the LN cortex (Das et al., 2013; Jeong et al., 2015).

LN SCS macrophages have been implicated in anti-tumor responses (Asano et al., 2011; Pucci et al., 2016). We show here another facet of Siglec1⁺ SCS macrophages where they physically interact with hypersialylated metastatic cells, conferring growth advantages upon them. Genes affected by Siglec1-cancer cell interactions were not only involved in cell cycle progression and DNA replication, but also in apoptosis and tumor suppression. Accordingly, reduced sialylation in tumor cells reduced the efficiency of metastasis. Our findings also suggest how the organ-specific LN metastasis trait of melanoma arises, and countering hypersialylation may therefore prove to be therapeutically beneficial in preventing LN metastasis and subsequent spread to distal organs.

Materials and methods

Key resources table.

Reagent type (species) or resource	Designation	Source or reference	Identifiers	Additional information
Cell line (mouse)	B16F10	ATCC	Cat# CRL-6475, RRID:CVCL_0159
Cell line (mouse)	4T1	ATCC	Cat# CRL-2539 RRID:CVCL_0125
Cell line (human)	HEK293T	ATCC	Cat# CRL-3216, RRID:CVCL_0063
Cell line (mouse)	J774A.1	ATCC	Cat# TIB-67, RRID:CVCL_0358
Antibody	anti-mouse CD169 (Siglec1) (clone #3D6.112)	Bio-Rad	Cat# MCA884, RRID:AB_322416	(1:200)
Antibody	Rabbit anti-mouse LYVE-1 antibody	Angiobio	Cat# 11–034, RRID:AB_2813732	(1:200)
Antibody	Rabbit anti-Ki67 antibody	Abcam	Cat# ab15580, RRID:AB_443209	(1:200)
Antibody	Rabbit anti-cleaved Caspase-3 (Asp175) antibody	Cell Signaling Technology	Cat# 9579, RRID:AB_10897512	(1:200)
Antibody	Rabbit Anti-GFP antibody	Abcam	Cat# ab6556, RRID:AB_305564	(1:200)
Antibody	Cy3 AffiniPure Goat Anti-Rat IgG (H+L)	Jackson ImmunoResearch	Cat# 112-165-167, RRID:AB_2338251	(1:500)
Antibody	Cy5 AffiniPure Goat Anti-Rabbit IgG (H+L)	Jackson ImmunoResearch	Cat# 111-175-144, RRID:AB_2338013	(1:500)
Antibody	PE mouse anti-Ki67 antibody (Clone # B65)	BD Biosciences	Cat# 556027, RRID:AB_2266296	As recommended by manufacturer
Antibody	Alexa Fluor647-anti-mouse CD169 (Siglec1) antibody (clone #3D6.112)	BioLegend	Cat# 142408, RRID:AB_2563621	As recommended by manufacturer
Antibody	PE mouse IgG1 Isotope control antibody (Clone# MOPC-21)	BD Biosciences	Cat# 556027, RRID:AB_2266296	As recommended by manufacturer
Antibody	BD Phosflow PE mouse anti-Akt (pS473) antibody	BD Biosciences	Cat# 560378, RRID:AB_1645328	As recommended by manufacturer
Antibody	BD Phosflow PerCP-Cy5.5 Mouse anti-ERK1/2 (pT202/pY204) antibody	BD Biosciences	Cat# 560115, RRID:AB_1645298	As recommended by manufacturer
Antibody	BD Phosflow PE Mouse anti-PLK1 (pT210) antibody	BD Biosciences	Cat# 558445, RRID:AB_647227	As recommended by manufacturer
Antibody	PE Goat Anti-Mouse Ig (Multiple Adsorption)	BD Biosciences	Cat# 550589, RRID:AB_393768	(1:500)
Other	Biotinylated Sambucus Nigra Lectin (SNA)	Vector Laboratories	Cat# B-1305, RRID:AB_2336718
Other	Biotinylated Maackia Amurensis Lectin II (MAL II)	Vector Laboratories	Cat# B-1265, RRID:AB_2336569
Other	Streptavidin-FITC	eBioscience	Cat# 11-4317-87	(1:500)
Other	PE Streptavidin	BD Biosciences	Cat# 554061, RRID:AB_10053328	(1:500)
Commercial assay or kit	PE Annexin V	BD Pharmingen	Cat# 556422	As recommended by manufacturer
Software	Imaris version 8.1	Bitplane	RRID:SCR_007370
Recombinant DNA reagent	Mouse Siglec1 full length cDNA	Transomic technologies	Cat# BC141335	Construction of expression plasmid
Transfected construct (mouse)	siRNA-1 to mouse Siglec1	Bioneer	Cat# 20612–1	RNA-GUC UUC CUU UCG AGA CUC A = tt(1-AS)
				RNA-UGA GUC UCG AAA GGA AGA C = tt(1-AA)
Transfected construct (mouse)	siRNA-2 to mouse Siglec1	Bioneer	Cat# 20612–2	RNA-CUC CAA CCA ACU UCA CGA U = tt(2-AS)
				RNA-AUC GUG AAG UUG GUU GGA G = tt(2-AA)
Transfected construct (mouse)	Negative control siRNA	Bioneer	Cat# SN-1003
Transfected construct (mouse)	pRGEN-CjCas9-CMV	Toolgen	TGEN_CjS1
Transfected construct (mouse)	pRGEN-U6-mSt3gal3-CjRG1	Toolgen	TGEN_CjS1	RGEN sequence: CAGTAAGTGTAGCTTCCAGGCAGAATAATA C
Sequence based reagent	mSt3gal3 For	This paper	PCR primers	TCACTATGCGGAGGAAGACTGCTTAATATC
Sequence based reagent	mSt3gal3 Rev	This paper	PCR primers	ATGCAGATTTCAAGGGTTGGGGGAAG

Open in a new tab

Cell culture

Mouse melanoma cell line B16F10 (ATCC) and its derivatives, B16F10-GFP and St3gal3 knockout B16F10-GFP cell lines, were cultured in DMEM supplemented with 10% FBS and 2 mM l-glutamine. J774A.1 (ATCC) mouse macrophage cells were cultured in DMEM supplemented with 10% FBS and 2 mM l-glutamine. 4T1 (ATCC) mouse breast cancer cells were cultured in RPMI-1640 medium supplemented with 10% FBS. HEK293T (ATCC) cells were cultured in DMEM medium supplemented with 10% FBS and 2 mM l-glutamine. Melan-A, a spontaneously immortalized melanocyte cell line, was kindly provided by Prof. Eun-Ju Chang, Asan Medical Center, Seoul, Korea. Melan-A cells were cultured in RPMI-1640 medium supplemented with 10% FBS, 200 nM phorbol 12-myristate 13-acetate (PMA), 50 μg/mL streptomycin, and 50 U/mL penicillin. All cells tested negative for mycoplasma.

Generation of mouse ST3 beta-galactoside alpha-2,3-sialyltransferase 3 (St3gal3) knockout cell line

pRGEN-CjCas9-CMV and pRGEN-U6-mSt3gal3-CjRG1 plasmids were purchased from Toolgen (Seoul, South Korea) with the following target sequence of RGEN: CAGTAAGTGTAGCTTCCAGGCAGAATAATAC (underlined are PAM sequence-NNNNRYAC- not included in gRNA but recognized by Cas9 protein). B16F10-GFP cells were transfected with the abovementioned plasmids (ratio 1:1) using Lipofectamine 3000. Forty-eight hours after transfection, cells were single-cell sorted on a FACSAria cell sorter (BD Biosciences, US) and cultured in 96-well plates to isolate genomic DNA and PCR-amplify target regions. The following primers were used for amplifying target sites by Sanger DNA sequencing to select the KO cell line: forward primer 5′-TCACTATGCGGAGGAAGACTGCTTAATATC-3′, reverse primer 5′-ATGCAGATTTCAAGGGTTGGGGGAAG-3′. Forward primer was used for the DNA sequencing.

Animal studies

C57/BL6 and BALB/c mice were purchased from OrientBio (Gapyeong, Korea) and were between 6 and 8 weeks of age at use. Mice were housed in specific pathogenfree conditions at the National Cancer Centre, Goyang. All experiments using animals were performed in accordance with protocols (NCC-17–303C) approved by the Institutional Animal Care and Use Committee of the National Cancer Centre and in accordance with the Guide for the Care and Use of Laboratory Animals. To study early LN metastatic cells, we implanted 2 × 10⁵ B16F10-eGFP or 4T1-eGFP subcutaneously into one hind limb footpad of each anesthetized mouse (Zoletil 40 mg/kg, Rompun 5 mg/kg). Animals were killed at different time points (starting from day 10) to collect popliteal LNs. For LN metastasis assays, anesthetized mice were subcutaneously implanted with 2 × 10⁵ B16F10-GFP or St3gal3 knockout B16F10-GFP cells in one hind limb footpad. Mice were killed at the end of the metastasis protocol, that is., 21 days for the LN assessment. For total metastatic burden in LNs, LNs were processed as described under tissue dissociation for FACS staining sections.

Primary tumor volumes were calculated using the following formula- volume (mm³) = (L × W²)/2, where L (length) is the larger of two perpendicular axes and W (width) is the smaller of two perpendicular tumor axes.

To confirm Siglec1 expression on the SCS macrophages, LN macrophages were depleted by footpad injection of 30 μL clodronate liposome. PBS liposomes were injected as control liposomes. Both liposomes were purchased from http://clodronateliposomes.org.

Cell adhesion assay

Full-length mouse Siglec1 cDNA (Transomic Technologies) was cloned into mammalian expression plasmid pd18. HEK293T cells were cultured in chamber slides to 70–80% confluency in DMEM supplemented with 10% FBS. At this point cells were transfected with empty vector (pd18) or vector expressing mouse Siglec1 (pd18-mSiglec1) using Lipofectamine 3000 (Invitrogen). After 6 hr transfection, medium was changed, and cells were cultured for three days before use in cell adhesion assays. On day 3, single cell suspensions of GFP-expressing cancer cells were prepared using enzyme-free PBS-based cell dissociation buffer (Gibco) and passing cells through 40 μm nylon filters (Falcon). Cells were counted and 1 × 10⁵ cells in 0.5 ml DMEM supplemented with 10% FBS were added per chamber. Cells were incubated for 5 min at 37°C, and then the medium was removed with non-attached cells and wells were further washed with complete medium three times with gentle force with a P1000 pipette. Cells were fixed by adding 2% paraformaldehyde directly into wells and incubating for 10 min at 37°C. Cells were stained as described in the immunostaining section. After image acquisition, adherent cells were counted using the Spots tool in Imaris (version 8.1; Bitplane).

For extracellular matrix cell adhesion assays, wells in 96-well plates were coated with 5 μg/ml fibronectin overnight at 4°C. The next day, wells were washed with PBS and then with DMEM. Single cell suspensions were prepared using enzyme-free cell dissociation buffer and cells were passed through 40 μm nylon filters. A total of 5 × 10³ cells per well were added in a volume of 100 μl DMEM and incubated for 30 min at 37°C. After incubation, wells were washed with DMEM to remove unbound cells and 100 μl DMEM supplemented with 10% FBS was added to each well and incubated for 2 hr to allow cells to recover. Next, 20 μl CellTiter 96 AQueous One Solution (Promega) was added to each well and incubated for 1 hr at 37°C. After incubation, absorbance was measured at 490 nm using a 96-well plate reader. Fibronectin-coated wells with 100 μl DMEM supplemented with 10% FBS and without added cells were used to deduct the background.

Immunohistochemical staining

LNs were fixed with 4% paraformaldehyde and processed for cryosectioning. OCT-embedded tissues were sectioned by cryostat (Leica) in thin (20 μm) or thick (100 μm) sections. Thin sections were used to locate and visualize pioneer metastasis cells. All sections were inspected under the Zeiss Axio Imager Z1 microscope to locate sections with GFP-positive cells. For antibody staining, LN sections were permeabilized and blocked in 5% goat serum in PBST (0.3% Triton X-100 in PBS). Antibodies used for immunohistochemical staining are listed in the Supplementary Information. For staining in in vitro cell adhesion assays, cells in chamber slides were fixed with 2% paraformaldehyde and stained using a similar protocol as the LN staining. Sections were mounted in fluorescent mounting medium (Dako) and images were acquired on a LSM 780 and LSM 880 Laser Scanning Confocal Microscope (Carl Zeiss SAS, Jena, Germany). All images were processed on Imaris (version 8.1; Bitplane) and shown as maximum intensity projections. Figure 3D reconstruction was performed on Imaris using the surface tool.

Co-culture experiments

HEK293T cells were grown in DMEM with 10% FBS, and 70–80% confluent cells were used for transfection with mammalian expression plasmids pd18 (empty plasmid; mock) or pd18-mSiglec1 using Lipofectamine 3000 (Invitrogen). Medium was changed to CDM293 (Invitrogen) supplemented with L-glutamine and cells were further cultured for 3 days to ensure maximum mSiglec1 expression on the cell surface. On day 3, single-cell preparations of B16-GFP cells were prepared by dissociating cells with enzyme-free PBS-based cell dissociation buffer (Gibco) and passing cells through 40 μm nylon filters (Falcon). Both HEK293T cells and cancer cells were counted and mixed at a 4:1 ratio in DMEM supplemented with 5% FBS. Cells were cultured in low binding plates (Corning) for 18 hr at 37°C in 5% CO₂. At the end of the experiments, cells either underwent cell sorting to assess gene expression or were fixed in Cytofix buffer for Ki67 or Phosflow staining. For apoptosis quantification PE Annexin V (BD biosciences) was used according to manufacturer’s instructions.

siRNA transfection into J774A.1 cells and co-culture experiment

Pre-designed negative control and mouse Siglec1 siRNAs were obtained from Bioneer (Bioneer, Daejeon, Korea). J774A.1 cells were reverse-transfected with siRNA using Lipofectamine RNAiMAX transfection reagent (Invitrogen) in Opti-MEM medium. Medium was changed after 6 hr post-transfection to DMEM supplemented with 10% FBS. Siglec1 expression was assessed on day 3 and day four post-transfection using Alexa647-conjugated anti-mouse Siglec1 antibody. Co-culture experiments were performed as described in the previous section.

Ki67 and phosflow analysis

For Ki67 and Phosflow (pAKT, pERK, and pPLK1) analysis in co-culture experiments, cells were counted and fixed by adding Cytofix buffer directly into the cell culture, and cells were incubated for 10 min at 37°C. After washing with PBS, cells were permeabilized in 0.1% Triton X-100 in PBS for 5 min at room temperature. After washing the cells in staining buffer, the cells were incubated with mouse FcR blocking reagent (Miltenyi Biotec). Then samples were incubated with Ki67 or Phosflow antibody in staining buffer. Following incubation, cells were washed and analyzed by FACSverse (BD); data were assessed using gates for GFP⁺ cells. Fold changes were calculated by dividing the mean fluorescence intensity of experimental samples by the mean fluorescence intensity of control samples.

Tissue dissociation for FACS staining

LNs and primary tumors were mechanically dissociated with forceps and scalpels and placed in DMEM containing 2 mg/ml collagenase (Sigma) for 20 min at 37°C (for LN metastatic burden evaluation, collagenase incubation time was increased to 40 min). The suspensions were incubated in 0.1 mg/ml DNase I (Roche) for 10 mins. Tissue suspensions were resuspended with P1000, filtered through 40 μm nylon filters (Falcon), and aliquoted for total cell counting to adjust equal cell numbers for antibody staining. For antibody staining and FACS analysis, cells were fixed in 1 × Cytofix fixation buffer (BD) for 10 min at 37°C. After washing with PBS, cells were permeabilized in 0.1% Triton X-100 in PBS for 5 min at room temperature. Cells were washed and resuspended in staining buffer (BD) and then blocked with mouse FcR blocking reagent. Then samples were incubated with FACS antibodies and processed as described in the previous section.

Biotinylated lectin staining for FACS

For lectin staining, 1 × 10⁵ cells were resuspended in lectin staining buffer (10 mM HEPES, pH 7.5, 0.15M NaCl, 0.09% sodium azide) stained with 1 µg/ml lectin in a 100 µl volume at 4°C for 30 min followed by incubation with detection reagent streptavidin-PE for 20 min at 4°C.

Sialidase treatment

A total of 5 × 10⁵ B16F10 cells were treated with 0.5 U/ml sialidase (from Clostridium perfringens; Roche Applied Science) in serum-free RPMI medium for 1 hr at 37°C in 5% CO₂ and 95% relative humidity. Control cells were incubated in similar conditions but without the enzyme. After 1 hr, cells were washed in lectin staining buffer and stained with lectin or mouse Siglec1(ECD)-mFc.

Transwell migration assay

Wild type and St3gal3 knockout B16F10-GFP cells were serum-starved overnight in DMEM medium. The next day, a single cell suspension was prepared using enzyme-free cell dissociation buffer and 5 × 10⁴ cells were added in 100 μl to the upper chambers of 24-well transwell permeable supports with 8 μm pores (Corning). The lower chambers were filled with 650 μl DMEM medium supplemented with 10% FBS as a chemoattractant. Control chambers were filled with DMEM without FBS. After 8 hr of incubation, the upper chambers were washed with PBS and non-migrated cells from the upper side of transwell chambers were removed gently using cotton swabs. Then cells on the lower side of the membranes were fixed with methanol for 10 min. Cells were stained with crystal violet solution for 10 min and thoroughly rinsed with water. After drying the membranes, images were captured on a Zeiss Axio Imager M1 (Carl Zeiss) microscope using a 10 × objective. The number of total migrated cells was counted using the following formula: (average number on cells per image/image area) × 0.33 cm². Next, the percentage of migrated cells was counted using the following formula: (number of migrated cells/50,000) × 100.

Metastatic burden of LNs

To calculate the total number of GFP⁺ metastatic cells in LNs, the total number of LN cells was counted after tissue digestion. The number of metastatic cells was determined by gating around GFP⁺ cells and the following formula was used to calculate the final number of metastatic cells in LNs: (number of cells in GFP⁺ gate/total number of FACS analyzed cells) × total number of LN cells.

Transcriptome analysis

After 18 hr of co-culture of GFP-expressing cancer cells with Siglec1-expressing or mock HEK293T cells in low binding plates, B16-GFP cells were sorted using a BD FACS Aria II or a BD FACS Aria SORP based on GFP expression. Total RNA from samples was isolated using a RNeasy Plus Mini kit (Qiagen). Library preparation for RNA sequencing and data analysis was performed by Macrogen (Macrogen Inc, Korea). Briefly, a TruSeq RNA library (Illumine) was constructed according to the manufacturer’s instructions and RNA-seq was performed on a HiSeq4000 (Illumina). Processed trimmed reads were mapped to known reference genomes through the TopHat program (version 2.0.13) and then aligned to UCSC mm10 using Bowtie aligner (bowtie2 v2.2.3), which allows splice junction processing. After read mapping, transcript assembly work was performed through the cufflinks program (version 2.2.1). As a result, the expression profile values for each sample were obtained for each transcript, and the FPKM (Fragment per Kilobase of Transcript per Million mapped reads) values were compiled based on the gene transcripts. Siglec1 and Dhfr were not included in the differential expressed gene counting and pathway analysis due to their plasmid origin. KEGG pathway analysis of unregulated genes was performed using the database for annotation, visualization and integrated discovery (DAVID) v6.8 (Huang et al., 2009a; Huang et al., 2009b). GO enrichment analysis of unregulated genes was performed using the Gene Ontology (GO) knowledgebase (Mi et al., 2017).

Statistical analysis

All data are expressed as mean ±s.d. and data points are shown as scatter plots. Significance between two groups was analyzed with two-tailed, unpaired t-tests using Graphpad Prism software. Exact P-values are shown in the graphs.

Acknowledgements

We thank Prof. Eun-Ju Chang (Asan Medical Center, Seoul, Korea) for providing mouse Melan-A cell line, Tae-Sik Kim, Flow Cytometry Unit and Mi Ae Kim, Microcopy Imaging Unit, National Cancer Center for technical support. We also thank Hye Young Seo for critical reading of manuscript and comments.

Funding Statement

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.

Contributor Information

Rohit Singh, Email: rohit@ncc.re.kr.

Beom K Choi, Email: 11380@ncc.re.kr.

Richard M White, Memorial Sloan Kettering Cancer Center, United States.

Päivi M Ojala, University of Helsinki, Finland.

Funding Information

This paper was supported by the following grants:

National Cancer Center 1810102 to Beom K. Choi.
National Cancer Center 1910050 to Beom K. Choi.

Additional information

Competing interests

No competing interests declared.

Author contributions

Conceptualization, Formal analysis, Validation, Investigation, Visualization, Methodology, Writing—original draft, Writing—review and editing.

Resources, Formal analysis, Supervision, Funding acquisition, Validation, Investigation, Methodology, Writing—original draft, Writing—review and editing.

Ethics

Animal experimentation: All experiments using animals were performed in accordance with protocols (protocol number NCC-17-303C) approved by the Institutional Animal Care and Use Committee of National Cancer Centre and were performed in accordance with the Guide for the Care and Use of Laboratory Animals.

Additional files

Transparent reporting form

elife-48916-transrepform.docx^{(249.1KB, docx)}

Data availability

All data are available in the main paper or the supplementary materials. RNA-seq data have been deposited in NCBI Gene Expression Omnibus (GEO) under accession number GSE109077.

The following dataset was generated:

Singh R, Choi BK. 2019. Analysis of transcriptome of mouse melanoma cells co-cultured with HEK293T cells expressing mouse Siglec1. NCBI Gene Expression Omnibus. GSE109077

References

Agrawal P, Fontanals-Cirera B, Sokolova E, Jacob S, Vaiana CA, Argibay D, Davalos V, McDermott M, Nayak S, Darvishian F, Castillo M, Ueberheide B, Osman I, Fenyö D, Mahal LK, Hernando E. A systems biology approach identifies FUT8 as a driver of melanoma metastasis. Cancer Cell. 2017;31:804–819. doi: 10.1016/j.ccell.2017.05.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
Asano K, Nabeyama A, Miyake Y, Qiu CH, Kurita A, Tomura M, Kanagawa O, Fujii S, Tanaka M. CD169-positive macrophages dominate antitumor immunity by crosspresenting dead cell-associated antigens. Immunity. 2011;34:85–95. doi: 10.1016/j.immuni.2010.12.011. [DOI] [PubMed] [Google Scholar]
Bedrosian I, Faries MB, Guerry D, Elenitsas R, Schuchter L, Mick R, Spitz FR, Bucky LP, Alavi A, Elder DE, Fraker DL, Czerniecki BJ. Incidence of sentinel node metastasis in patients with thin primary melanoma (< or = 1 mm) with vertical growth phase. Annals of Surgical Oncology. 2000;7:262–267. doi: 10.1007/s10434-000-0262-z. [DOI] [PubMed] [Google Scholar]
Bennett DC, Cooper PJ, Hart IR. A line of non-tumorigenic mouse melanocytes, syngeneic with the B16 melanoma and requiring a tumour promoter for growth. International Journal of Cancer. 1987;39:414–418. doi: 10.1002/ijc.2910390324. [DOI] [PubMed] [Google Scholar]
Bos PD, Zhang XH, Nadal C, Shu W, Gomis RR, Nguyen DX, Minn AJ, van de Vijver MJ, Gerald WL, Foekens JA, Massagué J. Genes that mediate breast Cancer metastasis to the brain. Nature. 2009;459:1005–1009. doi: 10.1038/nature08021. [DOI] [PMC free article] [PubMed] [Google Scholar]
Brown M, Assen FP, Leithner A, Abe J, Schachner H, Asfour G, Bago-Horvath Z, Stein JV, Uhrin P, Sixt M, Kerjaschki D. Lymph node blood vessels provide exit routes for metastatic tumor cell dissemination in mice. Science. 2018;359:1408–1411. doi: 10.1126/science.aal3662. [DOI] [PubMed] [Google Scholar]
Buchheit CL, Weigel KJ, Schafer ZT. Cancer cell survival during detachment from the ECM: multiple barriers to tumour progression. Nature Reviews Cancer. 2014;14:632–641. doi: 10.1038/nrc3789. [DOI] [PubMed] [Google Scholar]
Chang WW, Yu CY, Lin TW, Wang PH, Tsai YC. Soyasaponin I decreases the expression of alpha2,3-linked sialic acid on the cell surface and suppresses the metastatic potential of B16F10 melanoma cells. Biochemical and Biophysical Research Communications. 2006;341:614–619. doi: 10.1016/j.bbrc.2005.12.216. [DOI] [PubMed] [Google Scholar]
Crocker PR, Vinson M, Kelm S, Drickamer K. Molecular analysis of sialoside binding to sialoadhesin by NMR and site-directed mutagenesis. Biochemical Journal. 1999;341:355–361. doi: 10.1042/bj3410355. [DOI] [PMC free article] [PubMed] [Google Scholar]
Cui H, Lin Y, Yue L, Zhao X, Liu J. Differential expression of the alpha2,3-sialic acid residues in breast Cancer is associated with metastatic potential. Oncology Reports. 2011;25:1365–1371. doi: 10.3892/or.2011.1192. [DOI] [PubMed] [Google Scholar]
Das S, Sarrou E, Podgrabinska S, Cassella M, Mungamuri SK, Feirt N, Gordon R, Nagi CS, Wang Y, Entenberg D, Condeelis J, Skobe M. Tumor cell entry into the lymph node is controlled by CCL1 chemokine expressed by lymph node lymphatic sinuses. The Journal of Experimental Medicine. 2013;210:1509–1528. doi: 10.1084/jem.20111627. [DOI] [PMC free article] [PubMed] [Google Scholar]
Gray EE, Cyster JG. Lymph node macrophages. Journal of Innate Immunity. 2012;4:424–436. doi: 10.1159/000337007. [DOI] [PMC free article] [PubMed] [Google Scholar]
Guo JP, Brummet ME, Myers AC, Na HJ, Rowland E, Schnaar RL, Zheng T, Zhu Z, Bochner BS. Characterization of expression of glycan ligands for Siglec-F in normal mouse lungs. American Journal of Respiratory Cell and Molecular Biology. 2011;44:238–243. doi: 10.1165/rcmb.2010-0007OC. [DOI] [PMC free article] [PubMed] [Google Scholar]
Harrell MI, Iritani BM, Ruddell A. Tumor-induced sentinel lymph node lymphangiogenesis and increased lymph flow precede melanoma metastasis. The American Journal of Pathology. 2007;170:774–786. doi: 10.2353/ajpath.2007.060761. [DOI] [PMC free article] [PubMed] [Google Scholar]
Huang daW, Sherman BT, Lempicki RA. Bioinformatics enrichment tools: paths toward the comprehensive functional analysis of large gene lists. Nucleic Acids Research. 2009a;37:1–13. doi: 10.1093/nar/gkn923. [DOI] [PMC free article] [PubMed] [Google Scholar]
Huang daW, Sherman BT, Lempicki RA. Systematic and integrative analysis of large gene lists using DAVID bioinformatics resources. Nature Protocols. 2009b;4:44–57. doi: 10.1038/nprot.2008.211. [DOI] [PubMed] [Google Scholar]
Jeong H-S, Jones D, Liao S, Wattson DA, Cui CH, Duda DG, Willett CG, Jain RK, Padera TP. Investigation of the lack of angiogenesis in the formation of lymph node metastases. JNCI: Journal of the National Cancer Institute. 2015;107:djv155. doi: 10.1093/jnci/djv155. [DOI] [PMC free article] [PubMed] [Google Scholar]
Kim YJ, Varki A. Perspectives on the significance of altered glycosylation of glycoproteins in Cancer. Glycoconjugate Journal. 1997;14:569–576. doi: 10.1023/a:1018580324971. [DOI] [PubMed] [Google Scholar]
Lee CK, Jeong SH, Jang C, Bae H, Kim YH, Park I, Kim SK, Koh GY. Tumor metastasis to lymph nodes requires YAP-dependent metabolic adaptation. Science. 2019;363:644–649. doi: 10.1126/science.aav0173. [DOI] [PubMed] [Google Scholar]
Massagué J, Obenauf AC. Metastatic colonization by circulating tumour cells. Nature. 2016;529:298–306. doi: 10.1038/nature17038. [DOI] [PMC free article] [PubMed] [Google Scholar]
Mehlen P, Puisieux A. Metastasis: a question of life or death. Nature Reviews Cancer. 2006;6:449–458. doi: 10.1038/nrc1886. [DOI] [PubMed] [Google Scholar]
Mi H, Huang X, Muruganujan A, Tang H, Mills C, Kang D, Thomas PD. PANTHER version 11: expanded annotation data from gene ontology and reactome pathways, and data analysis tool enhancements. Nucleic Acids Research. 2017;45:D183–D189. doi: 10.1093/nar/gkw1138. [DOI] [PMC free article] [PubMed] [Google Scholar]
Nakamura K, Yamaji T, Crocker PR, Suzuki A, Hashimoto Y. Lymph node macrophages, but not spleen macrophages, express high levels of unmasked sialoadhesin: implication for the adhesive properties of macrophages in vivo. Glycobiology. 2002;12:209–216. doi: 10.1093/glycob/12.3.209. [DOI] [PubMed] [Google Scholar]
Nath D, Hartnell A, Happerfield L, Miles DW, Burchell J, Taylor-Papadimitriou J, Crocker PR. Macrophage-tumour cell interactions: identification of MUC1 on breast Cancer cells as a potential counter-receptor for the macrophage-restricted receptor, sialoadhesin. Immunology. 1999;98:213–219. doi: 10.1046/j.1365-2567.1999.00827.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
Nathanson SD. Insights into the mechanisms of lymph node metastasis. Cancer. 2003;98:413–423. doi: 10.1002/cncr.11464. [DOI] [PubMed] [Google Scholar]
Naxerova K, Reiter JG, Brachtel E, Lennerz JK, van de Wetering M, Rowan A, Cai T, Clevers H, Swanton C, Nowak MA, Elledge SJ, Jain RK. Origins of lymphatic and distant metastases in human colorectal Cancer. Science. 2017;357:55–60. doi: 10.1126/science.aai8515. [DOI] [PMC free article] [PubMed] [Google Scholar]
Olmeda D, Cerezo-Wallis D, Riveiro-Falkenbach E, Pennacchi PC, Contreras-Alcalde M, Ibarz N, Cifdaloz M, Catena X, Calvo TG, Cañón E, Alonso-Curbelo D, Suarez J, Osterloh L, Graña O, Mulero F, Megías D, Cañamero M, Martínez-Torrecuadrada JL, Mondal C, Di Martino J, Lora D, Martinez-Corral I, Bravo-Cordero JJ, Muñoz J, Puig S, Ortiz-Romero P, Rodriguez-Peralto JL, Ortega S, Soengas MS. Whole-body imaging of lymphovascular niches identifies pre-metastatic roles of midkine. Nature. 2017;546:676–680. doi: 10.1038/nature22977. [DOI] [PMC free article] [PubMed] [Google Scholar]
Pantel K, Brakenhoff RH. Dissecting the metastatic cascade. Nature Reviews Cancer. 2004;4:448–456. doi: 10.1038/nrc1370. [DOI] [PubMed] [Google Scholar]
Paschal CR, Maciejowski J, Jallepalli PV. A stringent requirement for Plk1 T210 phosphorylation during K-fiber assembly and chromosome congression. Chromosoma. 2012;121:565–572. doi: 10.1007/s00412-012-0375-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
Peinado H, Zhang H, Matei IR, Costa-Silva B, Hoshino A, Rodrigues G, Psaila B, Kaplan RN, Bromberg JF, Kang Y, Bissell MJ, Cox TR, Giaccia AJ, Erler JT, Hiratsuka S, Ghajar CM, Lyden D. Pre-metastatic niches: organ-specific homes for metastases. Nature Reviews Cancer. 2017;17:302–317. doi: 10.1038/nrc.2017.6. [DOI] [PubMed] [Google Scholar]
Pereira ER, Kedrin D, Seano G, Gautier O, Meijer EFJ, Jones D, Chin SM, Kitahara S, Bouta EM, Chang J, Beech E, Jeong HS, Carroll MC, Taghian AG, Padera TP. Lymph node metastases can invade local blood vessels, exit the node, and colonize distant organs in mice. Science. 2018;359:1403–1407. doi: 10.1126/science.aal3622. [DOI] [PMC free article] [PubMed] [Google Scholar]
Pérez-Garay M, Arteta B, Pagès L, de Llorens R, de Bolòs C, Vidal-Vanaclocha F, Peracaula R. alpha2,3-sialyltransferase ST3Gal III modulates pancreatic Cancer cell motility and adhesion in vitro and enhances its metastatic potential in vivo. PLOS ONE. 2010;5:e12524. doi: 10.1371/journal.pone.0012524. [DOI] [PMC free article] [PubMed] [Google Scholar]
Pucci F, Garris C, Lai CP, Newton A, Pfirschke C, Engblom C, Alvarez D, Sprachman M, Evavold C, Magnuson A, von Andrian UH, Glatz K, Breakefield XO, Mempel TR, Weissleder R, Pittet MJ. SCS macrophages suppress melanoma by restricting tumor-derived vesicle-B cell interactions. Science. 2016;352:242–246. doi: 10.1126/science.aaf1328. [DOI] [PMC free article] [PubMed] [Google Scholar]
Schultz MJ, Swindall AF, Bellis SL. Regulation of the metastatic cell phenotype by sialylated glycans. Cancer and Metastasis Reviews. 2012;31:501–518. doi: 10.1007/s10555-012-9359-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
Sosa MS, Bragado P, Aguirre-Ghiso JA. Mechanisms of disseminated Cancer cell dormancy: an awakening field. Nature Reviews Cancer. 2014;14:611–622. doi: 10.1038/nrc3793. [DOI] [PMC free article] [PubMed] [Google Scholar]
Varki A. Glycan-based interactions involving vertebrate sialic-acid-recognizing proteins. Nature. 2007;446:1023–1029. doi: 10.1038/nature05816. [DOI] [PubMed] [Google Scholar]
Werner-Klein M, Scheitler S, Hoffmann M, Hodak I, Dietz K, Lehnert P, Naimer V, Polzer B, Treitschke S, Werno C, Markiewicz A, Weidele K, Czyz Z, Hohenleutner U, Hafner C, Haferkamp S, Berneburg M, Rümmele P, Ulmer A, Klein CA. Genetic alterations driving metastatic colony formation are acquired outside of the primary tumour in melanoma. Nature Communications. 2018;9:595. doi: 10.1038/s41467-017-02674-y. [DOI] [PMC free article] [PubMed] [Google Scholar]

eLife. doi: 10.7554/eLife.48916.sa1

Decision letter

Editor: Richard M White¹

In the interests of transparency, eLife publishes the most substantive revision requests and the accompanying author responses.

Acceptance summary:

In this study, the authors attempt to understand the mechanisms underlying lymph node metastasis, a common site for metastasis for disease such as melanoma. They demonstrate that GFP tagged pioneer metastatic cells interact with Siglec1+ subcapsular sinus macrophages, and that this interaction promotes their proliferation. Importantly, knockout of the St3gal3 sialyltransferase compromised the metastatic efficiency of tumor cells by reducing α-2,3-linked sialylation. These results suggest a mechanism by which tumor cells can coopt a hypersialylated mechanism to promote distant colonization, which may be a paradigm for how other tumors do this as well.

Decision letter after peer review:

Thank you for submitting your article "Siglec1-expressing subcapsular sinus macrophages provide soil for melanoma lymph node metastasis" for consideration by eLife. Your article has been reviewed by two peer reviewers, and the evaluation has been overseen by a Reviewing Editor and Päivi Ojala as the Senior Editor. The reviewers have opted to remain anonymous.

The reviewers have discussed the reviews with one another and the Reviewing Editor has drafted this decision to help you prepare a revised submission.

In this manuscript, Singh and Choi present data that macrophages in the lymph nodes express Siglec1/CD169, which interacts with sialylated proteins on the surface of B16F10 cells. These data may provide further information as to the mechanism by which melanoma cells colonize lymph nodes, an important initial site of metastasis in this disease. Overall, the data are of interest and will open the way for further investigations. There are several areas the reviewers felt would heighten the impact/generalizability of the data and solidify its importance for the field. Specifically:

Major requests:

1) Signaling downstream of Siglec1

Confocal microscopy shows close association between Siglec1+ macrophages and tumour cells. However, this does not itself prove that signalling mediated by Siglec1/sialylated protein interaction is occurring directly between these cell types. The in vitro experiments showing the responses of B16F10 cells to Siglec1 signalling are weakened by the fact that they are conducted using HEK-293 cells to express Siglec1. Mouse macrophages and human HEK-293 cells would express very different ranges of secreted and cell-surface molecules that could modulate the outcome of Siglec1 signalling. It would be better to use SCS macrophages if possible, or otherwise a closely matched mouse macrophage cell line, for these in vitro experiments. Siglec1 could then be either overexpressed or knocked down. It may only be necessary to do a few key in vitro experiments with SCS macrophages to validate the general findings established using HEK-293 cells.

Is treatment with recombinant siglec-1 sufficient to cause downstream PI3K/Akt or Erk signaling and proliferation? Or do these signaling pathways require cell surface siglec-1?

2) The effects of volasertib

Is it surprising that blocking the cell cycle with volasertib inhibited growth of metastatic cancer cells in LNs? It is unclear how this relates to the proposed siglec-1 mechanism. Further, the examination of primary growth is not indicative of LN specificity of volasertib as the drug was only delivered locally. If volasertib is given systemically, what are the effects on primary tumor growth? Staining of the primary tumour for cleaved Caspase-3/Ki67 would help rule in or out any effects on metastasis secondary to effects on the primary tumour for these experiments.

3) Cell-intrinsic properties of Siglec1

Several other possible explanations for impaired metastatic colony formation of St3gal3 KO tumour cells need to be investigated. Does knockout of St3gal3 affect inherent adhesive, migratory or invasive properties of B16F10 cells? Is there Siglec1 expressed in the primary tumour (e.g. in lymphatics) that might affect the initial rate of metastatic tumour cells escaping from the primary tumour? Comparison of% Ki67+ between St3gal3 WT and KO tumour cells in the SCS would also be informative.

4) Generalizability of the findings

Are the results of the CD169/SCS macrophage mechanism specific to B16F10 cells or is the mechanism of LN colonization found in other cell lines?

5) Specificity of Siglec1 on macrophages

While the abundant expression of Siglec1 on SCS macrophages is well-established, Iftakhar et al. (2016, PNAS) and other studies have indicated some (albeit lower) expression of Siglec1 in SCS floor lymphatic endothelial cells (LECs). An appropriate macrophage-specific marker (e.g. CD11b) should be used in combination with LYVE1 to confirm a) the identity of the Siglec1-expressing cells interacting with tumour cells, and b) what proportion of the Siglec1 staining in the LN belongs to macrophages.

6) How the Siglec1 interaction promotes metastasis

"As we observed a shift towards increased cell cycle activity and proliferation in Siglec1-interacting cancer cells, and abolition of this interaction in vivo revealed the vulnerability of early metastasis colonization process." What in vivo abolition of siglec-1 interaction is this statement referring to? The only interventions at this point in the manuscript seem to be performed in vitro, not in vivo making this statement confusing. To what are the authors referring?

Quantification of several key results:

1) Figure 2: There is no quantification of cleaved caspase 3 positive cancer cells to support the authors' conclusion. These data should be quantified. Further, why was cleaved caspase-3 not measured in the co-culture experiments as was done for Ki67? It seems the lack of binding of cancer cells would lead to apoptosis, making cleaved caspase-3 a relevant measure.

2) How reliable is visual inspection for metastasis in melanoma? The authors should analyze tissue sections to identify microscopic metastasis and verify that metastatic nodes visually identified did indeed contain tumor cells and those judged to be negative were cancer-free. It is known that determining the incidence of metastasis based only on the presence of melanin is unreliable. A microscopic examination is needed.

3) Quantitation of% Ki67+ GFP cells as single cells vs those in colonies would be helpful to support the rest of Figure 2 and the claims that tumour cells begin proliferating after contact with Siglec1+ macrophages (see also point 3).

[Editors' note: further revisions were requested prior to acceptance, as described below.]

Thank you for submitting your article "Siglec1-expressing subcapsular sinus macrophages provide soil for melanoma lymph node metastasis" for consideration by eLife. The reviewers have discussed the reviews with one another and the Reviewing Editor has drafted this decision to help you prepare a revised submission.

In general, the reviewers felt that you addressed most of their previous concerns, but that a few issues remain. One significant question was how generalizeable the findings were, and there is concern that the 4T1 cell experiments did not fully address this. We do not feel you have to necessarily do additional validation experiments, but if you have additional data I would suggest you add it to the manuscript or add text to the document addressing this point. Other specific points, most of which can be addressed by clarifying the Figures or text, are listed below:

Reviewer #1:

Origins of 4T1 breast cancer cell line not in Key Resources Table or in Materials and methods. Also, it appears that the 4T1 breast cancer cells were grown subcutaneously and not in the mammary fat pad. Why was this done? Is the Siglec mediated binding only a result of tumors that are grown in the skin? Were 4T1 only used in one experiment, with no further verification of the proposed mechanism? It seems none of the co-culture experiments with Siglec overexpressing human macrophages or Siglec downregulated murine macrophages were performed with another cell line like 4T1 to determine whether the signaling is specific only to B16 cells. The presented experiments with 4T1 do not address the reviewer's questions about how generalizable the hypersialation and Siglec mechanism would be to other cell lines.

In Figure 1, examples of cancer cells sitting on SCS macrophages are shown. Are there examples where cancer cells are directly on LECs? The staining seems to show that the SCS macrophages form an almost complete barrier, suggesting that interaction of cancer cells on the SCS layer is not an active process but just result of the density of SCS macrophages.

Figure 1—figure supplement 3 is missing a LEC stain identify the SCS floor?

Figure 1—figure supplement 4 A and B. It appears that the graph key is incorrect. As it is currently shown, Melan-A has significantly more sialyation than B16F10, which contradicts the graphs in C and D as well as what is written in the text.

Subsection “Siglec1-interacting cancer cells show higher proliferation”: "As our data confirmed adhesive cell-to-cell contact between SCS macrophages and pioneer metastatic cells…" The data do not confirm adhesive cell-cell contact in vivo. The data show contact and proximity, but not adhesion. The in vitro assay did not use only pioneering metastatic cells, but a cell line from culture. This statement needs to be revised. Further, the author use the term pioneering metastatic cells frequently, but the term should only be used for the earliest arriving cells to the lymph node in vivo, and not to cells in a cell culture dish.

Figure 2: Why are the SSC-A values so different for panels F and H? They should be from similar experimental conditions. Panels J-M need strong positive controls for pERK and pAKT. There is not much of a shift in pERK and pAKT and the biological relevance of these data are questionable at best.

Figure 2—figure supplement 2. Why are the SSC-A values so different for panels E and G? They should be from similar experimental conditions. In Panels I and K, it is very challenging to see how the pERK and pAKT are actually different in any meaningful way. Are these findings robust? Can a strong positive control be used for pERK and pAKT to show what a true positive should look like? Otherwise these data are not very strong.

Reviewer #2:

Overall the authors have addressed most of the issues that were raised.

We had questioned (in point #5) the evidence in the data for the point that the disruption of the macrophage-lymphatic SCS lining by the growing metastasis is part of the colonisation process. This point was not directly addressed in the Response letter, but some additional text has been added to tone down their claims. But directly addressing this concern in the response would be more informative.

Major requests:

1) Signaling downstream of Siglec1

The authors have addressed this concern by performing co-culture experiments of B16F10 cells with the mouse macrophage line J774A.1 to model SCS macrophages. J774A.1 endogenously expresses Siglec1, and siRNA-mediated knockdown of the endogenous protein resulted in increased apoptosis and decreased proliferation of co-cultured B16F10 cells. This complements the prior results obtained using overexpression of Siglec1 in HEK293 cells. The authors should ensure that for figures concerning the siRNA data, the x-axis is labelled as siRNA (Figure 4G, Figure 2—figure supplement 2 F, H, L) to avoid confusion with the HEK293 overexpression data.

2) The effects of volasertib

The removal of this experiment does help streamline the manuscript and retain focus on Siglec1-mediated downstream signaling.

3) Cell-intrinsic properties of Siglec1

The experiments performed confirm that altering st3gal3 expression does not have any intrinsic effects on B16F10 cell behaviour, and validated that abrogating siglec1-mediated signaling impairs proliferation and survival of metastasising cells in the SCS.

The lack of staining for Siglec in tumour lymphatics shown in the response letter only is somewhat superficial and does not appear to be mentioned in the new document text.

4) Specificity of Siglec1 on macrophages

It would have been useful to see direct co-staining for Siglec1 and a macrophage marker. There does appear to be faint Siglec staining on LYVE1+ LECs in the medullary sinuses of macrophage-depleted LNs in Figure 1—figure supplement 2B; however the new experiments performed do indicate that the vast majority of Siglec1 in LNs is expressed on sinusoidal macrophages. The results text should describe the macrophage depletion experiment – currently this appears not to be specifically mentioned.

eLife. 2019 Dec 24;8:e48916. doi: 10.7554/eLife.48916.sa2

Author response

Major requests:

1) Signaling downstream of Siglec1

Confocal microscopy shows close association between Siglec1+ macrophages and tumour cells. However, this does not itself prove that signalling mediated by Siglec1/sialylated protein interaction is occurring directly between these cell types. The in vitro experiments showing the responses of B16F10 cells to Siglec1 signalling are weakened by the fact that they are conducted using HEK-293 cells to express Siglec1. Mouse macrophages and human HEK-293 cells would express very different ranges of secreted and cell-surface molecules that could modulate the outcome of Siglec1 signalling. It would be better to use SCS macrophages if possible, or otherwise a closely matched mouse macrophage cell line, for these in vitro experiments. Siglec1 could then be either overexpressed or knocked down. It may only be necessary to do a few key in vitro experiments with SCS macrophages to validate the general findings established using HEK-293 cells.

We thank the reviewers for pointing this out. Given the difficulty in isolating sufficient numbers of SCS macrophages, as well as there being no standard protocol for their culture, we performed experiments with the mouse macrophage cell line J774A.1. J774A.1 cells express Siglec1 and thus we performed siRNA-mediated knockdown of Siglec1 in this line for co-culture experiments. The results are provided in Figure 2—figure supplement 2 and in Figure 4E–G. Consistent with our in vitro findings in HEK293 cells, we observed similar results using a comparable line when we used Siglec1-knocked down J774A.1 cells for co-culture experiments.

Is treatment with recombinant siglec-1 sufficient to cause downstream PI3K/Akt or Erk signaling and proliferation? Or do these signaling pathways require cell surface siglec-1?

During the initial experiments, we used recombinant mouse Siglec1. However, the magnitude of change was very low and was mostly non-significant (data not shown). Nonetheless, co-culture experiments better reflect the setting of metastasis in which cell-to-cell interactions take place. Therefore, we persisted with this set-up rather than further exploring the use purified protein in our experiments.

2) The effects of volasertib

Is it surprising that blocking the cell cycle with volasertib inhibited growth of metastatic cancer cells in LNs? It is unclear how this relates to the proposed siglec-1 mechanism. Further, the examination of primary growth is not indicative of LN specificity of volasertib as the drug was only delivered locally. If volasertib is given systemically, what are the effects on primary tumor growth? Staining of the primary tumour for cleaved Caspase-3/Ki67 would help rule in or out any effects on metastasis secondary to effects on the primary tumour for these experiments.

As the reviewers point out, metastasis inhibition by volasertib was not a surprising observation, and, this particular set of experiments was not directly linked to the Siglec1 mechanism. Therefore, to ensure clarity and maintain the focus of the revised manuscript on Siglec1, we have removed the volasertib experiment from Figure 4. Rather, we have focused this section on the high mitotic activity measured by PLK1 phosphorylation in early metastatic cells, and demonstrated that Siglec1-interacting cancer cells showed higher mitotic commitment compared with cells that did not interact with Siglec1. These data are shown in Figure 4.

3) Cell-intrinsic properties of Siglec1

Several other possible explanations for impaired metastatic colony formation of St3gal3 KO tumour cells need to be investigated. Does knockout of St3gal3 affect inherent adhesive, migratory or invasive properties of B16F10 cells? Is there Siglec1 expressed in the primary tumour (e.g. in lymphatics) that might affect the initial rate of metastatic tumour cells escaping from the primary tumour? Comparison of% Ki67+ between St3gal3 WT and KO tumour cells in the SCS would also be informative.

Thank you for your comments. We performed additional experiments to assess the adhesion and transwell migration of WT and St3gal3 KO tumor cells. These data have been provided in Figure 5—figure supplement 1H–J. We did not find any significant difference in the in vitro adhesion and migration ability of St3gal3 WT and KO tumor cells.

We performed immunohistochemistry and confocal imaging to explore Siglec1 expression in tumor lymphatic endothelial cells but none was evident. This discounted the possibility of Siglec1 expression on tumor lymphatic cells and its affect on the initial rate of metastatic cells escaping from the primary tumor. See Figure 5—figure supplement 2.

We thank the reviewers for suggesting a comparison of positive Ki67 expression in St3gal3 WT and KO tumor cells in the SCS. We have provided a new set of data showing percentage of Ki67 positivity in the early stages of metastatic colonization in Figure 5G, H. This reduced proliferation and increased apoptosis shown in Figure 5G–J in St3gal3 KO early metastatic cells/foci supports our observation that Siglec1-expressing SCS macrophages-pioneer metastatic cell interaction is required for efficient LN metastatic colonization.

4) Generalizability of the findings

Are the results of the CD169/SCS macrophage mechanism specific to B16F10 cells or is the mechanism of LN colonization found in other cell lines?

To establish if LN metastasizing cancer cells other than melanoma also use SCS macrophages, we used GFP-expressing mouse breast cancer cells. Due to low GFP intensity, we detected the 4T1 cells using an anti-GFP antibody. We confirmed that breast cancer cells were also anchored by Siglec1-expressing SCS macrophages. These new data are provided in Figure 1—figure supplement 3. In light of our findings in melanoma as well as LN metastasis with early metastatic events observed by Das et al. and Jeong et al. (ref. 11, 12 in manuscript) using squamous cell carcinoma, breast cancer, and melanoma, it is possible that other LN-metastasizing tumors also use a similar strategy and LN SCS macrophages provide “soil” to other tumor types.

5) Specificity of Siglec1 on macrophages

While the abundant expression of Siglec1 on SCS macrophages is well-established, Iftakhar et al. (2016, PNAS) and other studies have indicated some (albeit lower) expression of Siglec1 in SCS floor lymphatic endothelial cells (LECs). An appropriate macrophage-specific marker (e.g. CD11b) should be used in combination with LYVE1 to confirm a) the identity of the Siglec1-expressing cells interacting with tumour cells, and b) what proportion of the Siglec1 staining in the LN belongs to macrophages.

As suggested by the reviewers, we have provided additional data using CD11b and Lyve1 to confirm that the interaction in the LN SCS is indeed between pioneer metastatic cells and CD11b⁺ SCS macrophages. Data have been provided in Figure 1—figure supplement 1C.

To address query (b) with regards to what proportion of Siglec1 staining belongs to macrophages, we depleted LN macrophages using clodronate liposomes with PBS liposomes as a control. Siglec1 and Lyve1 staining of control and macrophage-depleted LNs showed that Siglec1 is primarily expressed on SCS and medullary sinus macrophages. Of note, in macrophage-depleted LNs we could not detect Siglec1, which could account for the interaction that we observed between metastatic cells and SCS macrophages by Siglec1 staining. Data have been provided as Figure 1—figure supplement 2.

6) How the Siglec1 interaction promotes metastasis

"As we observed a shift towards increased cell cycle activity and proliferation in Siglec1-interacting cancer cells, and abolition of this interaction in vivo revealed the vulnerability of early metastasis colonization process." What in vivo abolition of siglec-1 interaction is this statement referring to? The only interventions at this point in the manuscript seem to be performed in vitro, not in vivo making this statement confusing. To what are the authors referring?

We thank reviewers to bringing this error to our attention. Originally, Figure 3 was placed after the St3gal3 KO B16-GFP cell line experiments and this statement was made in that context. During the final drafting of the manuscript this error went unnoticed by us. We have now fixed the error in the revised manuscript.

Quantification of several key results:

1) Figure 2: There is no quantification of cleaved caspase 3 positive cancer cells to support the authors' conclusion. These data should be quantified. Further, why was cleaved caspase-3 not measured in the co-culture experiments as was done for Ki67? It seems the lack of binding of cancer cells would lead to apoptosis, making cleaved caspase-3 a relevant measure.

We have provided the quantification of cleaved caspase-3-positive cells in the LN SCS in Figure 2B. Additionally, we have provided quantification of Ki67-positive cells in the LN SCS in Figure 2D.

Additionally, we thank the reviewers for raising this logical point regarding apoptosis measurement in co-culture experiments. We performed the additional experiments to measure apoptosis using Annexin-V-PE. These data have been added to Figure 2H, I (with HEK cells) and Figure 2—figure supplement 2G, H (with J774A.1 cells).

2) How reliable is visual inspection for metastasis in melanoma? The authors should analyze tissue sections to identify microscopic metastasis and verify that metastatic nodes visually identified did indeed contain tumor cells and those judged to be negative were cancer-free. It is known that determining the incidence of metastasis based only on the presence of melanin is unreliable. A microscopic examination is needed.

As mentioned in the response to major request #2, we have removed this dataset to ensure clarity and maintain the focus of the manuscript on Siglec1-mediated events.

3) Quantitation of% Ki67+ GFP cells as single cells vs those in colonies would be helpful to support the rest of Figure 2 and the claims that tumour cells begin proliferating after contact with Siglec1+ macrophages (see also point 3).

We have provided the quantification in Figure 2D.

[Editors' note: further revisions were requested prior to acceptance, as described below.]

Reviewer #1:

Origins of 4T1 breast cancer cell line not in Key Resources Table or in Materials and methods. Also, it appears that the 4T1 breast cancer cells were grown subcutaneously and not in the mammary fat pad. Why was this done? Is the Siglec mediated binding only a result of tumors that are grown in the skin? Were 4T1 only used in one experiment, with no further verification of the proposed mechanism? It seems none of the co-culture experiments with Siglec overexpressing human macrophages or Siglec downregulated murine macrophages were performed with another cell line like 4T1 to determine whether the signaling is specific only to B16 cells. The presented experiments with 4T1 do not address the reviewer's questions about how generalizable the hypersialation and Siglec mechanism would be to other cell lines.

We have added the origin of the 4T1 breast cancer cell line to the Key Resources Table and thank the reviewer for pointing out this issue.

As the focus of our study was melanoma lymph node (LN) metastasis, we were able to determine the timeline of early metastatic cell arrival to popliteal LNs after several experiments. We had no such established protocol/timeline for the mammary fat pad injection experiments from which to determine the appropriate time point that pioneer metastatic cells may land in LNs. As subcutaneous injection of 4T1 cells is reported in the study of LN metastasis, we opted for this route and used our melanoma metastasis timeline as a guide [Hu et al., Theranostics 8(3), 3597-3610 (2018)]. We believe 4T1 metastatic cells originating from subcutaneous or mammary fat pad primary tumors colonize the LNs through lymphatic dissemination in a similar fashion, although the timeline might differ due to the different primary tumor growth rates. Of note, Brown et al. [Science 359, 1408-1411 (2018); reference 4 in the main manuscript] demonstrated that 4T1 mammary carcinoma cells even directly injected into popliteal LN afferent lymphatics by intralymphatic microinfusion show a normal lymph node colonization sequence.

Since we have examined the whole LN colonization process in the context of melanoma (which is reflected in the title of the manuscript), we performed detailed experiments with melanoma cell lines. In response to the reviewer’s query regarding the generalizability of the observations, we examined the initial event at which the metastatic cells landed in the LNs using GFP-expressing 4T1 mouse mammary carcinoma cells to determine whether breast cancer cells, which also frequently metastasize to LNs, also use SCS macrophages for anchorage. In the revised manuscript, we have strictly confined our statement to the similarity of the initial LN metastatic colonization step. We draw from the observations made by Das et al. and Jeong et al. (references 11 and 12 in manuscript, respectively) whereby used intravital microscopy and different tumor cells in mice to observe that LN metastatic cells stay and proliferate in LN SCS before invading the LN sinus, we speculated that breast cancer may also use a similar mechanism to melanoma. We have edited the manuscript text to reflect this inference. Further study is warranted to ascertain that other tumor types also use a similar mechanism.

In Figure 1, examples of cancer cells sitting on SCS macrophages are shown. Are there examples where cancer cells are directly on LECs? The staining seems to show that the SCS macrophages form an almost complete barrier, suggesting that interaction of cancer cells on the SCS layer is not an active process but just result of the density of SCS macrophages.

Thank you for your comment. Video 1 submitted with the manuscript shows pioneer metastatic cell in close proximity/sitting on the SCS lymphatic endothelial lining of SCS. In our multiple experiments, we observed metastatic cells at various distances from lymphatic endothelial cells that still had close interactions with SCS macrophages, even in low SCS macrophage-dense regions. Additionally, when we observe a SCS macrophage–lymphatic layer, e.g. in Figure 1—figure supplement 2, whereby the SCS macrophages did not form a complete barrier over the lymphatic lining of the SCS sinus in such a way as to leave no gaps for metastatic cancer cells to access the lymphatics lining. The in vivo observations of the SCS macrophage–pioneer metastatic cell interactions, combined with in vitro adhesion assays of Siglec1-overexpressing HEK293T and cancer cells, supports the active contact between Siglec1-expressing SCS macrophages and cancer cells. Furthermore, adhesion of cancer cells to Siglec1-overexpressing HEK293T cells was abolished after KO of St3gal3 (which produces Siglec-bindig sialylation), further supporting the Siglec1-specific interaction with tumor cells.

Figure 1—figure supplement is missing a LEC stain identify the SCS floor?

The 4T1-GFP cell line used in our experiments showed very weak GFP signals after paraformaldehyde tissue fixation. Thus, to visualize the 4T1 cells, we had to amplify the GFP signals using rabbit anti-GFP antibody. Since the Lyve-1 antibody was also of rabbit origin, we were left with no option. We mention the use of the anti-GFP antibody in the figure legend of Figure 1—figure supplement 3.

Figure 1—figure supplement 4 A and B. It appears that the graph key is incorrect. As it is currently shown, Melan-A has significantly more sialyation than B16F10, which contradicts the graphs in C and D as well as what is written in the text.

We thank reviewer to pointing out our error and have corrected this oversight in the revised manuscript.

Thank you for your comments. We have modified the relevant sentence by deleting the word “adhesive”. We have also used the term “cell-to-cell contact” rather than “adhesive cell-to-cell contact” to describe the interaction between SCS macrophages and pioneer metastatic cells.

Furthermore, we thank the reviewers highlighting the use of the term “pioneer metastatic cell”. We have replaced it with “cancer cells” in two places and have kept it in places where we have inferred the effect in in vivo metastatic cells based on in vivo and/or in vitro data.

Figure 2: Why are the SSC-A values so different for panels F and H? They should be from similar experimental conditions. Panels J-M need strong positive controls for pERK and pAKT. There is not much of a shift in pERK and pAKT and the biological relevance of these data are questionable at best.

Figure 2—figure supplement 2. Why are the SSC-A values so different for panels E and G? They should be from similar experimental conditions. In Panels I and K, it is very challenging to see how the pERK and pAKT are actually different in any meaningful way. Are these findings robust? Can a strong positive control be used for pERK and pAKT to show what a true positive should look like? Otherwise these data are not very strong.

Thank you for your comments. Although the data were from a similar co-culture experimental setting, the sample staining procedure and FACS analysis strategy was different. For the Ki67 analysis, we fixed and permeabilized the cells before staining, and for the FACS analysis, cells were gated on forward scatter (FSC) and side scatter (SSC) to eliminate debris. Whereas, for Annexin V staining, live cells were stained (without fixation and permeabilization) and no gating was applied. This was performed to include all live, apoptotic, and dead cells (application note: https://www.bdbiosciences.com/documents/BD_FACSVerse_Apoptosis_Detection_AppNote.pdf). As apoptotic cells show increased granularity, it was important to include high SSC-A cells in the analysis. Therefore, the SSC-A axis in the plots in Figure 2H and Figure 2—figure supplement 2G (Annexin V staining) shows more cells than that in the plots in Figure 2F and Figure 2—figure supplement 2E (Ki67 staining).

We would like to draw the reviewer’s attention to the fact that the Phosflow product data available on BD Biosciences’ website details a specific procedure, whereby cells are first serum-starved and then stimulated with strong AKT or ERK phosphorylation inducers to generate maximum changes in their phosphorylation status. In contrast in our experiments, at no point were the cells serum-starved, and there was a constant presence of FBS-derived growth factors in the culture media. This would not produce extreme changes in the phosphorylation status of AKT and ERK. Additionally, we needed to view our phosphorylation data in the context of the whole experimental setting in which we evaluated Ki67 (proliferation) and Annexin-V (apoptosis) in addition to Phosflow to understand the signaling mechanism.

Reviewer #2:

Overall the authors have addressed most of the issues that were raised.

We had questioned (in point #5) the evidence in the data for the point that the disruption of the macrophage-lymphatic SCS lining by the growing metastasis is part of the colonisation process. This point was not directly addressed in the Response letter, but some additional text has been added to tone down their claims. But directly addressing this concern in the response would be more informative.

We regularly observed that with an increase in the size of metastatic foci in SCS (before invading the LN cortex), a depression was formed by the foci in the SCS macrophage–lymphatic endothelial cell lining. (Figure 1C). We also frequently observed a bump in the LN surface where foci were formed. This suggests that the SCS macrophage–lymphatic endothelial cell lining is flexible and keeps the foci in the SCS sinus until it increases in size. Similarly, Das et al., 2013, observed that there was no disruption of the lymphatic lining of SCS when metastatic foci were present within the sinus. When the foci were big enough to invade, we observed that the normal arrangement of the “SCS macrophage–lymphatic endothelial cell lining” was lost at the foci front where cells enter the LN cortex (Figure 1D). We could see gaps in the lymphatic lining at this stage and some of the frontline metastatic cells invading the LN cortex were still attached to the Siglec1⁺ macrophages that had lost their place in the SCS lining. Therefore, we termed this event as a disruption in the SCS macrophage–lymphatic endothelial cell lining.

Major requests:

1) Signaling downstream of Siglec1

The authors have addressed this concern by performing co-culture experiments of B16F10 cells with the mouse macrophage line J774A.1 to model SCS macrophages. J774A.1 endogenously expresses Siglec1, and siRNA-mediated knockdown of the endogenous protein resulted in increased apoptosis and decreased proliferation of co-cultured B16F10 cells. This complements the prior results obtained using overexpression of Siglec1 in HEK293 cells. The authors should ensure that for figures concerning the siRNA data, the x-axis is labelled as siRNA (Figure 4G, Figure 2—figure supplement 2 F, H, L) to avoid confusion with the HEK293 overexpression data.

We thank the reviewer for these comments. We have labeled the abovementioned figures to reflect the use of siRNA.

2) The effects of volasertib

The removal of this experiment does help streamline the manuscript and retain focus on Siglec1-mediated downstream signaling.

We thank the reviewer for this comment.

3) Cell-intrinsic properties of Siglec1

The experiments performed confirm that altering st3gal3 expression does not have any intrinsic effects on B16F10 cell behaviour, and validated that abrogating siglec1-mediated signaling impairs proliferation and survival of metastasising cells in the SCS.

The lack of staining for Siglec in tumour lymphatics shown in the response letter only is somewhat superficial and does not appear to be mentioned in the new document text.

We have added the figure as Figure 5—figure supplement 2 and the following text description to the revised manuscript:

“To explore the possibility of Siglec1 expression on primary tumor lymphatic vessels, which might have affected the initial egress of cancer cells from the primary tumor, we searched for Siglec1 expression on primary tumor lymphatic vessels and found none (Figure 5—figure supplement 2).”

4) Specificity of Siglec1 on macrophages

It would have been useful to see direct co-staining for Siglec1 and a macrophage marker. There does appear to be faint Siglec staining on LYVE1+ LECs in the medullary sinuses of macrophage-depleted LNs in Figure 1—figure supplement 2B; however the new experiments performed do indicate that the vast majority of Siglec1 in LNs is expressed on sinusoidal macrophages. The results text should describe the macrophage depletion experiment – currently this appears not to be specifically mentioned.

We have added the following text to the revised manuscript:

“Of note, by depleting LN resident macrophages through injecting clodronate liposomes into the mouse footpads, we confirmed that Siglec1 is primarily expressed on SCS and medullary sinus macrophages in LNs (Figure 1—figure supplement 2).”

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Citations

Singh R, Choi BK. 2019. Analysis of transcriptome of mouse melanoma cells co-cultured with HEK293T cells expressing mouse Siglec1. NCBI Gene Expression Omnibus. GSE109077

Supplementary Materials

Figure 1—source data 1. This spreadsheet contains the source data for Figure 1F.

elife-48916-fig1-data1.xlsx^{(30.7KB, xlsx)}

Figure 1—figure supplement 4—source data 1. This spreadsheet contains the source data for figure supplement 4.

elife-48916-fig1-figsupp4-data1.xlsx^{(31.1KB, xlsx)}

Figure 1—figure supplement 5—source data 1. This spreadsheet contains the source data for figure supplement 5.

elife-48916-fig1-figsupp5-data1.xlsx^{(31.3KB, xlsx)}

Figure 2—source data 1. This spreadsheet contains the source data for Figure 2.

elife-48916-fig2-data1.xlsx^{(32.9KB, xlsx)}

Figure 2—figure supplement 1—source data 1. This spreadsheet contains the source data for figure supplement 1.

elife-48916-fig2-figsupp1-data1.xlsx^{(30.9KB, xlsx)}

Figure 2—figure supplement 2—source data 1. This spreadsheet contains the source data for figure supplement 2.

elife-48916-fig2-figsupp2-data1.xlsx^{(37.5KB, xlsx)}

Figure 3—source data 1. This spreadsheet contains the list of differentially expressed genes.

elife-48916-fig3-data1.xlsx^{(78.8KB, xlsx)}

Figure 4—source data 1. This spreadsheet contains the source data for Figure 4.

elife-48916-fig4-data1.xlsx^{(32.5KB, xlsx)}

Figure 5—source data 1. This spreadsheet contains the source data for Figure 5.

elife-48916-fig5-data1.xlsx^{(29.6KB, xlsx)}

Figure 5—figure supplement 1—source data 1. This spreadsheet contains the source data for figure supplement 1.

elife-48916-fig5-figsupp1-data1.xlsx^{(34KB, xlsx)}

Transparent reporting form

elife-48916-transrepform.docx^{(249.1KB, docx)}

Data Availability Statement

All data are available in the main paper or the supplementary materials. RNA-seq data have been deposited in NCBI Gene Expression Omnibus (GEO) under accession number GSE109077.

The following dataset was generated:

Singh R, Choi BK. 2019. Analysis of transcriptome of mouse melanoma cells co-cultured with HEK293T cells expressing mouse Siglec1. NCBI Gene Expression Omnibus. GSE109077

[bib1] Agrawal P, Fontanals-Cirera B, Sokolova E, Jacob S, Vaiana CA, Argibay D, Davalos V, McDermott M, Nayak S, Darvishian F, Castillo M, Ueberheide B, Osman I, Fenyö D, Mahal LK, Hernando E. A systems biology approach identifies FUT8 as a driver of melanoma metastasis. Cancer Cell. 2017;31:804–819. doi: 10.1016/j.ccell.2017.05.007. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib2] Asano K, Nabeyama A, Miyake Y, Qiu CH, Kurita A, Tomura M, Kanagawa O, Fujii S, Tanaka M. CD169-positive macrophages dominate antitumor immunity by crosspresenting dead cell-associated antigens. Immunity. 2011;34:85–95. doi: 10.1016/j.immuni.2010.12.011. [DOI] [PubMed] [Google Scholar]

[bib3] Bedrosian I, Faries MB, Guerry D, Elenitsas R, Schuchter L, Mick R, Spitz FR, Bucky LP, Alavi A, Elder DE, Fraker DL, Czerniecki BJ. Incidence of sentinel node metastasis in patients with thin primary melanoma (< or = 1 mm) with vertical growth phase. Annals of Surgical Oncology. 2000;7:262–267. doi: 10.1007/s10434-000-0262-z. [DOI] [PubMed] [Google Scholar]

[bib4] Bennett DC, Cooper PJ, Hart IR. A line of non-tumorigenic mouse melanocytes, syngeneic with the B16 melanoma and requiring a tumour promoter for growth. International Journal of Cancer. 1987;39:414–418. doi: 10.1002/ijc.2910390324. [DOI] [PubMed] [Google Scholar]

[bib5] Bos PD, Zhang XH, Nadal C, Shu W, Gomis RR, Nguyen DX, Minn AJ, van de Vijver MJ, Gerald WL, Foekens JA, Massagué J. Genes that mediate breast Cancer metastasis to the brain. Nature. 2009;459:1005–1009. doi: 10.1038/nature08021. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib6] Brown M, Assen FP, Leithner A, Abe J, Schachner H, Asfour G, Bago-Horvath Z, Stein JV, Uhrin P, Sixt M, Kerjaschki D. Lymph node blood vessels provide exit routes for metastatic tumor cell dissemination in mice. Science. 2018;359:1408–1411. doi: 10.1126/science.aal3662. [DOI] [PubMed] [Google Scholar]

[bib7] Buchheit CL, Weigel KJ, Schafer ZT. Cancer cell survival during detachment from the ECM: multiple barriers to tumour progression. Nature Reviews Cancer. 2014;14:632–641. doi: 10.1038/nrc3789. [DOI] [PubMed] [Google Scholar]

[bib8] Chang WW, Yu CY, Lin TW, Wang PH, Tsai YC. Soyasaponin I decreases the expression of alpha2,3-linked sialic acid on the cell surface and suppresses the metastatic potential of B16F10 melanoma cells. Biochemical and Biophysical Research Communications. 2006;341:614–619. doi: 10.1016/j.bbrc.2005.12.216. [DOI] [PubMed] [Google Scholar]

[bib9] Crocker PR, Vinson M, Kelm S, Drickamer K. Molecular analysis of sialoside binding to sialoadhesin by NMR and site-directed mutagenesis. Biochemical Journal. 1999;341:355–361. doi: 10.1042/bj3410355. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib10] Cui H, Lin Y, Yue L, Zhao X, Liu J. Differential expression of the alpha2,3-sialic acid residues in breast Cancer is associated with metastatic potential. Oncology Reports. 2011;25:1365–1371. doi: 10.3892/or.2011.1192. [DOI] [PubMed] [Google Scholar]

[bib11] Das S, Sarrou E, Podgrabinska S, Cassella M, Mungamuri SK, Feirt N, Gordon R, Nagi CS, Wang Y, Entenberg D, Condeelis J, Skobe M. Tumor cell entry into the lymph node is controlled by CCL1 chemokine expressed by lymph node lymphatic sinuses. The Journal of Experimental Medicine. 2013;210:1509–1528. doi: 10.1084/jem.20111627. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib12] Gray EE, Cyster JG. Lymph node macrophages. Journal of Innate Immunity. 2012;4:424–436. doi: 10.1159/000337007. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib13] Guo JP, Brummet ME, Myers AC, Na HJ, Rowland E, Schnaar RL, Zheng T, Zhu Z, Bochner BS. Characterization of expression of glycan ligands for Siglec-F in normal mouse lungs. American Journal of Respiratory Cell and Molecular Biology. 2011;44:238–243. doi: 10.1165/rcmb.2010-0007OC. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib14] Harrell MI, Iritani BM, Ruddell A. Tumor-induced sentinel lymph node lymphangiogenesis and increased lymph flow precede melanoma metastasis. The American Journal of Pathology. 2007;170:774–786. doi: 10.2353/ajpath.2007.060761. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib15] Huang daW, Sherman BT, Lempicki RA. Bioinformatics enrichment tools: paths toward the comprehensive functional analysis of large gene lists. Nucleic Acids Research. 2009a;37:1–13. doi: 10.1093/nar/gkn923. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib16] Huang daW, Sherman BT, Lempicki RA. Systematic and integrative analysis of large gene lists using DAVID bioinformatics resources. Nature Protocols. 2009b;4:44–57. doi: 10.1038/nprot.2008.211. [DOI] [PubMed] [Google Scholar]

[bib17] Jeong H-S, Jones D, Liao S, Wattson DA, Cui CH, Duda DG, Willett CG, Jain RK, Padera TP. Investigation of the lack of angiogenesis in the formation of lymph node metastases. JNCI: Journal of the National Cancer Institute. 2015;107:djv155. doi: 10.1093/jnci/djv155. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib18] Kim YJ, Varki A. Perspectives on the significance of altered glycosylation of glycoproteins in Cancer. Glycoconjugate Journal. 1997;14:569–576. doi: 10.1023/a:1018580324971. [DOI] [PubMed] [Google Scholar]

[bib19] Lee CK, Jeong SH, Jang C, Bae H, Kim YH, Park I, Kim SK, Koh GY. Tumor metastasis to lymph nodes requires YAP-dependent metabolic adaptation. Science. 2019;363:644–649. doi: 10.1126/science.aav0173. [DOI] [PubMed] [Google Scholar]

[bib20] Massagué J, Obenauf AC. Metastatic colonization by circulating tumour cells. Nature. 2016;529:298–306. doi: 10.1038/nature17038. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib21] Mehlen P, Puisieux A. Metastasis: a question of life or death. Nature Reviews Cancer. 2006;6:449–458. doi: 10.1038/nrc1886. [DOI] [PubMed] [Google Scholar]

[bib22] Mi H, Huang X, Muruganujan A, Tang H, Mills C, Kang D, Thomas PD. PANTHER version 11: expanded annotation data from gene ontology and reactome pathways, and data analysis tool enhancements. Nucleic Acids Research. 2017;45:D183–D189. doi: 10.1093/nar/gkw1138. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib23] Nakamura K, Yamaji T, Crocker PR, Suzuki A, Hashimoto Y. Lymph node macrophages, but not spleen macrophages, express high levels of unmasked sialoadhesin: implication for the adhesive properties of macrophages in vivo. Glycobiology. 2002;12:209–216. doi: 10.1093/glycob/12.3.209. [DOI] [PubMed] [Google Scholar]

[bib24] Nath D, Hartnell A, Happerfield L, Miles DW, Burchell J, Taylor-Papadimitriou J, Crocker PR. Macrophage-tumour cell interactions: identification of MUC1 on breast Cancer cells as a potential counter-receptor for the macrophage-restricted receptor, sialoadhesin. Immunology. 1999;98:213–219. doi: 10.1046/j.1365-2567.1999.00827.x. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib25] Nathanson SD. Insights into the mechanisms of lymph node metastasis. Cancer. 2003;98:413–423. doi: 10.1002/cncr.11464. [DOI] [PubMed] [Google Scholar]

[bib26] Naxerova K, Reiter JG, Brachtel E, Lennerz JK, van de Wetering M, Rowan A, Cai T, Clevers H, Swanton C, Nowak MA, Elledge SJ, Jain RK. Origins of lymphatic and distant metastases in human colorectal Cancer. Science. 2017;357:55–60. doi: 10.1126/science.aai8515. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib27] Olmeda D, Cerezo-Wallis D, Riveiro-Falkenbach E, Pennacchi PC, Contreras-Alcalde M, Ibarz N, Cifdaloz M, Catena X, Calvo TG, Cañón E, Alonso-Curbelo D, Suarez J, Osterloh L, Graña O, Mulero F, Megías D, Cañamero M, Martínez-Torrecuadrada JL, Mondal C, Di Martino J, Lora D, Martinez-Corral I, Bravo-Cordero JJ, Muñoz J, Puig S, Ortiz-Romero P, Rodriguez-Peralto JL, Ortega S, Soengas MS. Whole-body imaging of lymphovascular niches identifies pre-metastatic roles of midkine. Nature. 2017;546:676–680. doi: 10.1038/nature22977. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib28] Pantel K, Brakenhoff RH. Dissecting the metastatic cascade. Nature Reviews Cancer. 2004;4:448–456. doi: 10.1038/nrc1370. [DOI] [PubMed] [Google Scholar]

[bib29] Paschal CR, Maciejowski J, Jallepalli PV. A stringent requirement for Plk1 T210 phosphorylation during K-fiber assembly and chromosome congression. Chromosoma. 2012;121:565–572. doi: 10.1007/s00412-012-0375-8. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib30] Peinado H, Zhang H, Matei IR, Costa-Silva B, Hoshino A, Rodrigues G, Psaila B, Kaplan RN, Bromberg JF, Kang Y, Bissell MJ, Cox TR, Giaccia AJ, Erler JT, Hiratsuka S, Ghajar CM, Lyden D. Pre-metastatic niches: organ-specific homes for metastases. Nature Reviews Cancer. 2017;17:302–317. doi: 10.1038/nrc.2017.6. [DOI] [PubMed] [Google Scholar]

[bib31] Pereira ER, Kedrin D, Seano G, Gautier O, Meijer EFJ, Jones D, Chin SM, Kitahara S, Bouta EM, Chang J, Beech E, Jeong HS, Carroll MC, Taghian AG, Padera TP. Lymph node metastases can invade local blood vessels, exit the node, and colonize distant organs in mice. Science. 2018;359:1403–1407. doi: 10.1126/science.aal3622. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib32] Pérez-Garay M, Arteta B, Pagès L, de Llorens R, de Bolòs C, Vidal-Vanaclocha F, Peracaula R. alpha2,3-sialyltransferase ST3Gal III modulates pancreatic Cancer cell motility and adhesion in vitro and enhances its metastatic potential in vivo. PLOS ONE. 2010;5:e12524. doi: 10.1371/journal.pone.0012524. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib33] Pucci F, Garris C, Lai CP, Newton A, Pfirschke C, Engblom C, Alvarez D, Sprachman M, Evavold C, Magnuson A, von Andrian UH, Glatz K, Breakefield XO, Mempel TR, Weissleder R, Pittet MJ. SCS macrophages suppress melanoma by restricting tumor-derived vesicle-B cell interactions. Science. 2016;352:242–246. doi: 10.1126/science.aaf1328. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib34] Schultz MJ, Swindall AF, Bellis SL. Regulation of the metastatic cell phenotype by sialylated glycans. Cancer and Metastasis Reviews. 2012;31:501–518. doi: 10.1007/s10555-012-9359-7. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib35] Sosa MS, Bragado P, Aguirre-Ghiso JA. Mechanisms of disseminated Cancer cell dormancy: an awakening field. Nature Reviews Cancer. 2014;14:611–622. doi: 10.1038/nrc3793. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib36] Varki A. Glycan-based interactions involving vertebrate sialic-acid-recognizing proteins. Nature. 2007;446:1023–1029. doi: 10.1038/nature05816. [DOI] [PubMed] [Google Scholar]

[bib37] Werner-Klein M, Scheitler S, Hoffmann M, Hodak I, Dietz K, Lehnert P, Naimer V, Polzer B, Treitschke S, Werno C, Markiewicz A, Weidele K, Czyz Z, Hohenleutner U, Hafner C, Haferkamp S, Berneburg M, Rümmele P, Ulmer A, Klein CA. Genetic alterations driving metastatic colony formation are acquired outside of the primary tumour in melanoma. Nature Communications. 2018;9:595. doi: 10.1038/s41467-017-02674-y. [DOI] [PMC free article] [PubMed] [Google Scholar]

PERMALINK

Siglec1-expressing subcapsular sinus macrophages provide soil for melanoma lymph node metastasis

Rohit Singh

Beom K Choi

Roles

Abstract

eLife digest

Introduction

Results

LN metastatic colonization begins with interactions between pioneer metastatic cells and Siglec1+ SCS macrophages

Figure 1. Steps of lymph node (LN) metastatic colonization.

Figure 1—figure supplement 1. Approach for visualization of pioneer metastatic cells and early metastatic events in LNs.

Figure 1—figure supplement 2. Siglec1 is expressed on the macrophages on the floor of the LN SCS and medullary region.

Figure 1—figure supplement 3. 4T1 mouse breast cancer cells use LN SCS macrophages to find footholds during LN metastasis.

Figure 1—figure supplement 4. Siglec1 binds to hypersialylated cell surface proteins of mouse melanoma cells.

Figure 1—figure supplement 5. Siglec1 binds to mouse melanoma cells in an α−2,3 sialylation-specific manner.

Video 1. A close interaction of SCS macrophages (red) and metastatic cell (green) visualized in 3D space within lymph node SCS lined by lymphatic endothelial cells (blue).

Siglec1 binds to α2,3-sialylated proteins on cancer cells

Siglec1-interacting cancer cells show higher proliferation

Figure 2. Siglec1 on SCS macrophages provides growth support to metastatic cells.

Figure 2—figure supplement 1. HEKMock and HEKSiglec1 cells.

Figure 2—figure supplement 2. Knockdown of Siglec1 in J774A.1 mouse macrophages and subculture with B16-GFP cells.

Siglec1-interacting cancer cells show higher phosphorylation of AKT and ERK1/2

Siglec1 drives transcriptional programs necessary for metastatic colonization

Figure 3. Siglec1 cancer cell interaction drives cell cycle progression.

Siglec1-interacting cancer cells show high PLK1 activation

Figure 4. Siglec1-interacting cancer cells show high mitotic commitment.

Role of α2,3-sialylation in LN metastasis

Figure 5. α−2,3-linked sialylation and melanoma LN metastasis.

Figure 5—figure supplement 1. ST3 beta-galactoside alpha-2,3-sialyltransferase 3 (St3gal3) knockout cell line.

Figure 5—figure supplement 2. Primary tumor lymphatic vessels do not express Siglec1.

Figure 5—figure supplement 3. Representative image of metastasis in popliteal LNs of wild type (WT) and St3gal3 knockout (KO) B16-GFP primary tumor-bearing mice.

Discussion

Materials and methods

Key resources table.

Cell culture

Generation of mouse ST3 beta-galactoside alpha-2,3-sialyltransferase 3 (St3gal3) knockout cell line

Animal studies

Cell adhesion assay

Immunohistochemical staining

Co-culture experiments

siRNA transfection into J774A.1 cells and co-culture experiment

Ki67 and phosflow analysis

Tissue dissociation for FACS staining

Biotinylated lectin staining for FACS

Sialidase treatment

Transwell migration assay

Metastatic burden of LNs

Transcriptome analysis

Statistical analysis

Acknowledgements

Funding Statement

Contributor Information

Funding Information

Additional information

Competing interests

Author contributions

Ethics

Additional files

Data availability

References

Decision letter

Roles

Author response

Associated Data

Data Citations

Supplementary Materials

Data Availability Statement

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases

LN metastatic colonization begins with interactions between pioneer metastatic cells and Siglec1⁺ SCS macrophages

Figure 2—figure supplement 1. HEK^Mock and HEK^Siglec1 cells.