Skip to main content
British Journal of Pharmacology logoLink to British Journal of Pharmacology
. 2019 Dec 11;176(23):4558–4573. doi: 10.1111/bph.14822

Catalpol alleviates adriamycin‐induced nephropathy by activating the SIRT1 signalling pathway in vivo and in vitro

Jiangnan Zhang 1, Ran Bi 1, Qiang Meng 1,2, Changyuan Wang 1,2, Xiaokui Huo 1,2, Zhihao Liu 1,2, Chong Wang 1,2, Pengyuan Sun 1,2, Huijun Sun 1,2, Xiaodong Ma 1,2, Jingjing Wu 1,2,✉, Kexin Liu 1,2,✉
PMCID: PMC6932948  PMID: 31378931

Abstract

Background and Purpose

Catalpol, a water‐soluble active ingredient isolated from Rehmannia glutinosa, exhibits multiple pharmacological activities. However, the mechanism(s) underlying protection against renal injury by catalpol remains unknown.

Experimental Approach

Adriamycin‐induced kidney injury models associated with podocyte damage were employed to investigate the nephroprotective effects of catalpol. In vivo, TUNEL and haematoxylin‐eosin staining was used to evaluate the effect of catalpol on kidney injury in mice. In vitro, effects of catalpol on podocyte damage induced by adriamycin was determined by elisa kit, flow cytometry, Hoechst 33342, and TUNEL staining. The mechanism was investigated by siRNA, EX527, and docking simulations.

Key Results

In vivo, catalpol treatment significantly improved adriamycin‐induced kidney pathological changes and decreased the number of apoptotic cells. In vitro, catalpol markedly decreased the intracellular accumulation of adriamycin and reduced the calcium ion level in podocytes and then attenuated apoptosis. Importantly, the regulatory effects of catalpol on sirtuin 1 (SIRT1), multidrug resistance‐associated protein 2 (MRP2), and the TRPC6 channel were mostly abolished after incubation with SIRT1 siRNA or the SIRT1‐specific inhibitor EX527. Furthermore, docking simulations showed that catalpol efficiently oriented itself in the active site of SIRT1, indicating a higher total binding affinity score than that of other SIRT1 activators, such as resveratrol, SRT2104, and quercetin.

Conclusion and Implications

Taken together, our results suggest that catalpol exhibits strong protective effects against adriamycin‐induced nephropathy by inducing SIRT1‐mediated inhibition of TRPC6 expression and enhancing MRP2 expression.


What is already known

  • Catalpol has been found to have a variety of biological activities.

  • Sirtuin 1 is involved in diabetic nephropathy.

What this study adds

  • Activation of sirtuin 1 normalized adriamycin‐induced kidney dysfunction in mice.

  • Catalpol might be a promising activator of sirtuin 1 .

What is the clinical significance

  • Activation of sirtuin 1 is a novel potential therapeutic strategy to treat kidney disease.

1. INTRODUCTION

The anthracycline antibiotic http://www.guidetopharmacology.org/GRAC/LigandDisplayForward?ligandId=7069 a broad‐spectrum anti‐tumour drug, has been widely used to treat various cancers (Rivankar, 2014). The toxic side effect of adriamycin, mainly associated with cardiotoxicity (Octavia et al., 2012), limits its clinical applications. It has been noted that nephrotoxicity can be induced by adriamycin in rodents but rarely occurs in humans. Anthracycline‐induced chronic kidney damage was reported early in 1970 (Sternberg, 1970) and since then animal models of adriamycin‐induced kidney injury have been widely established (Bucciarelli, Binazzi, Santori, & Vespasiani, 1976; Chen et al., 2015). It has been reported that the adriamycin‐induced classic nephrotoxicity model is very similar to human progressive chronic renal disease (Ajith, Aswathy, & Hema, 2008). Subsequently, studies on adriamycin‐induced nephropathy have been extensively carried out. As previously reported, adriamycin primarily acts on podocytes to induce nephropathy (Mori, Mukoyama, & Nakao, 2011). Podocyte damage can cause the expression of nephrin to be down‐regulated, leading to proteinuria due to the formation of superoxide radicals in podocytes (Li et al., 2015), which can destroy the cell membrane structure and function and finally induce apoptosis (Cabeza et al., 2017).

http://www.guidetopharmacology.org/GRAC/ObjectDisplayForward?objectId=2707 (SIRT1), a NAD+‐dependent class III histone deacetylase, catalyses several protein substrates to perform its biological functions (Nogueiras et al., 2012). SIRT1 is widely expressed in the cells of a wide range of tissues and plays important roles in modulating cell senescence, apoptosis, autophagy, and oxidative stress (Kume, Kitada, Kanasaki, Maegawa, & Koya, 2013). Thus far, either SIRT1 protein or mRNA expression has been found to be suppressed in ischaemia/reperfusion‐induced acute kidney injury (Fan et al., 2013). In addition, activation of SIRT1 by http://www.guidetopharmacology.org/GRAC/LigandDisplayForward?ligandId=8741 can alleviate diabetic kidney damage and cisplatin‐induced renal injury (Kim et al., 2011). Furthermore, studies have found that increasing SIRT1 activity in podocytes can effectively reduce the progression of diabetic nephropathy (Hong et al., 2018). The protective effects of SIRT1 have been well documented in the kidneys. However, the mechanism of action of SIRT1 in adriamycin‐induced nephropathy remains unclear.

Rehmannia glutinosa is a traditional Chinese herbal medicine that is said to replenish vitality and strengthen the liver, kidney and heart. R. glutinosa is widely used to treat a variety of ailments (Zhang, Li, & Jia, 2008). Catalpol ((2S,3R,4S,5S,6R)‐2‐(((1aS,1bS,2S,5aR,6S,6aS)‐6‐hydroxy‐1a‐(hydroxymethyl)‐1a,1b,2,5a,6,6a‐hexahydrooxireno[2′,3′:4,5]cyclopenta[1,2‐c]pyran‐2‐yl)oxy)‐6‐(hydroxymethyl)tetrahydro‐2H‐pyran‐3,4,5‐triol; CAT), which is a biologically active ingredient of R. glutinosa, has a variety of biological activities, including antioxidation, anti‐inflammatory, antiapoptotic, anticancer, neuroprotective, and hypoglycaemic effects (Hu, Sun, & Hu, 2010; Wang & Zhan‐Sheng, 2018; Yan et al., 2018; Zhou et al., 2015). Catalpol can significantly improve renal function in diabetic nephropathy (Dong & Chen, 2013), which provides the possibility that catalpol can alleviate kidney damage in adriamycin‐induced nephropathy. Moreover, catalpol has been proven to regulate inflammatory processes by up‐regulating SIRT1 (Xiong et al., 2017), but the role of SIRT1 in the development of adriamycin‐induced nephropathy is not fully understood.

Based on the above information, the aim of this study was to investigate the effects of catalpol on adriamycin‐induced nephropathy in mice and on the underlying mechanisms and to clarify the role of SIRT1 in adriamycin‐induced nephropathy.

2. METHODS

2.1. Animal studies

All animal care and experimental procedures were performed in compliance with the University's Guidelines for the Care and Use of Laboratory Animals. Animal studies are reported in compliance with the ARRIVE guidelines (Kilkenny et al., 2010) and with the recommendations made by the British Journal of Pharmacology. All the animal studies complied with the principles for replacement, refinement, or reduction (the 3Rs).

Adult male Kunming mice (20–25 g) were purchased from the Experimental Animal Centre of Dalian Medical University (Dalian, China). The experimental groups were designed as follows: 36 mice were divided randomly into six groups (n = 6): (1) control (vehicle); (2) catalpol (CAT; 120 mg·kg−1); (3) adriamycin (ADR); (4) ADR + CAT (40 mg·kg−1); (5) ADR + CAT (80 mg·kg−1); and (6) ADR + CAT (120 mg·kg−1). Catalpol was given by intragastric administration daily for 4 weeks after a single injection of adriamycin. The control groups were given an equivalent volume of saline. adriamycin (10 mg·kg−1) was given as a bolus injection through the tail vein on the first day. Body weight was recorded, and 24‐hr urine samples were collected once a week for 4 weeks (Wang, Wang, Tay, & Harris, 2000). Mice were killed by cervical dislocation after anaesthesia with pentobarbital sodium (40 mg·kg−1) at Week 4 after adriamycin injection. Blood samples and kidney tissue samples were collected for further assays.

2.2. Biochemical assays

The levels of blood urea nitrogen, creatinine, and tissue malondialdehyde, SOD, reduced GSH, and urine protein were measured according to the manufacturers' instructions supplied by Nanjing Jiancheng Institute of Biotechnology (Nanjing, China); the absorbances of these assays were determined at 520, 546, 530, 405, 405, and 595 nm, respectively, by a microplate reader (Tecan, Austria).

2.3. Kidney histopathological analysis

The right renal cortex was excised for histopathology and fixed in 10% neutral formalin for 24 hr, embedded in paraffin, and cut into 5‐μm sections for morphological and apoptosis examination by haematoxylin‐eosin staining and TUNEL kit (Promega, USA), respectively.

2.4. Cell culture and treatment

The mouse podocyte mouse podocyte clone 5 (MPC‐5) cell line (Ximbio; Cat# 152136, RRID:CVCL_AS87) was cultured in DMEM containing 10% (v/v) FBS in an incubator at 37°C with 5% CO2 and 95% humidity. MPC‐5 cells were seeded at a density of 1 × 105 cells per well and cultured for 24 hr. Then drug intervention experiments were conducted by replacing the media with a serum‐free medium containing adriamycin (1 μM) or catalpol at different concentrations for 48 hr or EX527 (10 μM) for 4 hr.

2.5. CCK‐8 assay for cell viability

MPC‐5 cells were cultured in a 96‐well plate at a density of 5 × 103 cells per well. After 24‐hr incubation, the medium was replaced with serum‐free DMEM medium containing catalpol or adriamycin at different concentrations for 48 hr. Then the cell viability was determined according to the CCK‐8 kit instructions by a microplate reader (Bio‐Rad, Hercules, USA) at 450 nm.

2.6. siRNA transfection

Podocyte cells were plated in six‐well plates, and siRNA (50 nM) was diluted in Lipofectamine 2000 (Invitrogen) and transfected according to the manufacturer's protocol. The sequence of SIRT1 siRNA was as follows: F: 5′‐AGAUAUCAAUACAAUUGAAdTdT‐3′ and R: 5′‐UUCAAUUGUAUUGAUAUCUdTdT‐3′. After 4 hr of transfection, the medium was replaced with DMEM containing 10% FBS and continually incubated for 48 hr. Then cells were treated with adriamycin or catalpol for an additional 48 hr, and protein expression was measured by western blot analysis.

2.7. Intracellular accumulation of adriamycin and apoptosis assay

The cells were cultured in a six‐well plate at a density of 106 cells per well. After 24 hr of incubation, cells were treated with the indicated agents for 48 hr. Then cells were stained with Hoechst 33342 or TUNEL and observed by inverted fluorescence microscopy (Olympus OIS IX81, Japan) in random microscopic fields. In the Hoechst 33342 staining, the nucleus is blue, and the bright blue fluorescence represents apoptosis. In the TUNEL staining, green fluorescence represents apoptosis, and red fluorescence represents the accumulation of adriamycin. Moreover, a FITC‐annexin V/SYTOX™ (Thermo Fisher Scientific, USA) double‐staining assay was carried out by flow cytometric analysis. The apoptotic rate = apoptotic cells/all cells.

2.8. Western blotting analysis

The immuno‐related procedures used comply with the recommendations made by the British Journal of Pharmacology. A portion of the total protein (40 μg) was used for western blotting. The ChemiDocTM XRS + Imaging system was used to detect the protein bands, and Image Lab 3.0 software was applied to quantify the protein expression levels. β‐actin was chosen as an internal loading control for western blot analysis because of its high, relatively constant expression. The other detailed protocols were described in our previous paper (D. Huang, Wang, et al., 2017). The Western blot procedures used complied with the recommendations made by the British Journal of Pharmacology (Alexander et al., 2018).

2.9. Quantitative real‐time PCR

The experimental protocol was performed according to our previous description (Wen et al., 2018). In brief, total RNA isolation and cDNA synthesis was carried out by using an RNAiso Plus® Reagent kit and SYBR® Premix Ex Taq™ kit, respectively (Takara Biotechnology, Dalian, China). Real‐time RT‐PCR was performed on an ABIPRISM® 7500 real‐time PCR System (Applied Biosystems, MA, USA). The primers of genes used for the PCR assay are shown in Table 1.

Table 1.

Primers used for RT‐qPCR

Gene Forward 5′‐3′ Reverse 5′‐3′
GAPDH AGGAGTAAGAAACCCTGGAC CTGGGATGGAATTGTGAG
TRPC6 GACGCTGATGTGGAGTGGAA TCTGCCCTCCTCAAAGTAGGAA
SIRT1 TGATTGGCACCGATCCTCG CCACAGCGTCATATCATCCAG
Desmin GTTTCAGACTTGACTCAGGCAG TCTCGCAGGTGTAGGACTGG
Nephrin CAGCGATGATGCGGAGTACG CAGCTACCCAGGTAACTGTGC
MRP2 GTGTGGATTCCCTTGGGCTTT CACAACGAACACCTGCTTGG
TNF‐α CAGGCGGTGCCTATGTCTC CGATCACCCCGAAGTTCAGTAG
IL‐6 CTGCAAGAGACTTCCATCCAG AGTGGTATAGACAGGTCTGTTGG
P‐gp AATGTTTCGTTATGCAGGTTGGC TGGCTCTTTTATCGGCCTCAC

2.10. Ca2+ fluorescence measurement

A novel fluorescently labelled calcium indicator, fluo‐4 AM, was used to measure the change in Ca2+ levels in MPC‐5 cells. Cells cultured in six‐well plates were treated with the indicated drugs for 48 hr. Then the cells were immediately washed three times with ice‐cold PBS and lysed with the lysis buffer. Finally, the fluorescence intensity was detected by using a multimode microplate reader (TriStar2, Germany) with an excitation wavelength of 494 nm and an emission wavelength of 516 nm.

2.11. Measurement of intracellular ROS

Intracellular ROS levels were measured by labelling with DCFH‐DA (Beyotime Biotechnology, China). MPC‐5 cells were preincubated with a specific drug for 48 hr. Subsequently, the fluorescent probe was incorporated into collected cells for 30 min in the dark at room temperature. Eventually, the cells were analysed by flow cytometry.

2.12. elisa for cytokines

After treatment with the specific drugs, MPC‐5 cells were collected. The levels of https://www.guidetopharmacology.org/GRAC/LigandDisplayForward?ligandId=5074 and https://www.guidetopharmacology.org/GRAC/LigandDisplayForward?ligandId=4998 were measured by the corresponding elisa kits (Proteintech Group, Wuhan, China) according to the manufacturer's instructions.

2.13. Molecular docking

The docking simulations were conducted using a Sybyl/Surflex module (RRID:SCR_000196) to explore the potential interactions between catalpol and SIRT1. The SIRT1 protein (PDB ID: 4ZZH) and SIRT1 activators including resveratrol, http://www.guidetopharmacology.org/GRAC/LigandDisplayForward?ligandId=9515, and http://www.guidetopharmacology.org/GRAC/LigandDisplayForward?ligandId=5346 were included in this docking study. These structures were downloaded from zinc 15 (http://zinc15.docking.org). The Surflex‐Dock program was used for the docking calculations with default parameters, and scores (total scores) represent binding affinities.

2.14. Data and statistical analysis

All statistical analyses were performed using the Prism program (Version 5.0.1, GraphPad, San Diego, CA, RRID:SCR_002798). Data are generally expressed as the mean ± SD. Statistical analysis was performed with one‐way ANOVA followed by Tukey's post hoc test when comparing multiple independent groups, and when comparing two different groups, the unpaired t test was carried out. Post hoc tests were run only if F achieved P < .05 and there was no significant variance inhomogeneity. Statistical significance was considered to be P < .05. The collection and analysis of all in vivo and in vitro data was performed in a blinded manner. The data and statistical analysis comply with the recommendations of the British Journal or Pharmacology on experimental design and analysis in pharmacology (Curtis et al., 2018).

2.15. Materials

Catalpol (98%) was purchased from Nanjing Jingzhu Biotech Ltd. Co (Nanjing, China). Adriamycin was obtained from Dalian Meilun Biology Technology Co., Ltd. (Dalian, China). The SIRT1 inhibitor https://www.guidetopharmacology.org/GRAC/LigandDisplayForward?tab=summary&ligandId=8100 was obtained from Selleck Chemicals (Houston TX). Cell Counting Kit‐8 (CCK‐8) was purchased from Biomaker (Houston, USA). In the molecular studies, the following antibodies were used: anti‐multidrug resistance‐associated protein 2 (MRP2; abcam, USA, Cat#ab203397, RRID:AB_2801378), anti‐TNF‐α (Cell Signalling Technology, Beverly, USA; Cat# 11948, RRID:AB_2687962), anti‐P‐glycoprotein (P‐gp; Cell Signalling Technology, Beverly, USA; Cat# 13978, RRID:AB_2798357), anti‐IL‐6 (Cell Signalling Technology, Beverly, USA; Cat# 12912, RRID:AB_2798059), anti‐desmin (Proteintech, Wuhan, China; Cat# 60226‐1‐lg, RRID:AB_11042773), anti‐SIRT1 (Proteintech, Wuhan, China; Cat# 13161‐1‐AP, RRID:AB_10646436), anti‐β‐actin (Proteintech, Wuhan, China; Cat# 66009‐1‐Ig, RRID:AB_2687938), anti‐transient receptor potential canonical channel 6 (TRPC6; Proteintech, Wuhan, China; Cat# 18236–1‐AP, RRID:AB_10859822), and anti‐nephrin (Wanlei Bio, Shenyang, China; Cat#WL02442, RRID:AB_2810867). All other reagents and solvents were of analytical grade and are commercially available.

2.16. Nomenclature of targets and ligands

Key protein targets and ligands in this article are hyperlinked to corresponding entries in http://www.guidetopharmacology.org, the common portal for data from the IUPHAR/BPS Guide to PHARMACOLOGY (Harding et al., 2018), and are permanently archived in the Concise Guide to PHARMACOLOGY 2017/18 (Alexander, Fabbro et al., 2017; Alexander, Kelly et al., 2017; Alexander, Striessnig et al., 2017).

3. RESULTS

3.1. Protective effects of catalpol on nephropathy caused by adriamycin in vivo

To evaluate the effects of catalpol on adriamycin‐induced nephropathy, the changes in the body weight and albuminuria of mice were assessed. As shown in Figure 1, the mice began to lose weight during the third week, and their albuminuria levels started to rise from the first week after the administration of adriamycin (Figure 1a,b). Catalpol treatment significantly increased body weight and decreased urine protein levels in a dose‐dependent manner (Figure 1a,b). In addition, catalpol treatment markedly suppressed the increase of serum creatinine, blood urea nitrogen, and tissue malondialdehyde caused by adriamycin administration (Figure 1c,d). The decrease in kidney tissue SOD and https://www.guidetopharmacology.org/GRAC/LigandDisplayForward?ligandId=6737 (Figure 1d) levels caused by adriamycin was markedly alleviated by catalpol treatment. Furthermore, the haematoxylin‐eosin staining results showed that in the adriamycin group, extensive dilatation, necrosis, interstitial inflammatory cell infiltration, and oedema occurred in the proximal tubules, and dilatation and adhesion of the renal capsular membrane and thickening of the basement membrane occurred in the glomerulus. In contrast, catalpol treatment significantly attenuated the tubular and glomerular damage, including interstitial inflammatory infiltration (yellow arrow), mesangial expansion in glomeruli (black arrow), and tubular vacuolization (blue arrow), in a dose‐dependent manner (Figure 1e). Similarly, the tissue TUNEL staining showed increased numbers of TUNEL‐positive cells in the adriamycin group tissues. After co‐administration of adriamycin and catalpol, TUNEL‐positive cells were strikingly decreased in a dose‐dependent manner (Figure 1f). Moreover, catalpol alone did not affect the number of TUNEL‐positive cells. These findings suggest that catalpol may exert a protective effect on nephropathy caused by adriamycin in vivo.

Figure 1.

Figure 1

Catalpol attenuated adriamycin‐induced nephrotoxicity (in vivo). Changes in body weight (a), urine protein (b), plasma creatinine and plasma BUN (c), tissue GSH, tissue MDA and tissue SOD (d), histopathology (e), and TUNEL staining (f) after co‐administration of catalpol. Data are analysed by one‐way ANOVA and unpaired t test and presented as the mean ± SD (n = 6), # P < .05, significantly different from the control group; *P < .05, significantly different from the model group; ns, not significant. ADR, adriamycin; BUN, blood urea nitrogen; CAT, catalpol; MDA, malondialdehyde

3.2. Catalpol protects podocytes from adriamycin‐induced injury in vitro

To examine the protective effects of catalpol on podocytes, cytotoxicity and apoptosis were evaluated. As shown in Figure 2, catalpol had no toxic effect on MPC‐5 cells even at a high concentration of 100 μM (Figure 2a), while the cell viability declined by almost 50% when MPC‐5 cells were exposed to 1‐μM adriamycin (Figure 2b). Notably, catalpol significantly improved the cell viability in a concentration‐dependent manner when the adriamycin‐treated MPC‐5 cells were cotreated with catalpol (Figure 2c). In addition, adriamycin markedly induced the apoptosis of podocytes, while catalpol markedly reduced the number of apoptotic cells (Figure 2d,f) as assayed by flow cytometry analysis. The antiapoptotic effect of catalpol was further analysed by Hoechst 33342 staining. Adriamycin‐treated cells showed bright fluorescence, which indicated condensed chromatin and fragmented nuclei; that is, cells were apoptotic. After the combined catalpol and adriamycin treatment, the apoptotic cells were markedly reduced (Figure 2e,g).

Figure 2.

Figure 2

Catalpol attenuated adriamycin‐induced damage by inhibiting apoptosis (in vitro). Cell viability after treatment with various concentrations of catalpol (a), adriamycin (b), and co‐administration of catalpol and adriamycin (c). The changes in flow cytometry (d) and Hoechst 33342 staining (e) after co‐administration of catalpol and ADR. Statistical analysis of flow cytometry (f) and Hoechst 33342 staining (g). Data are analysed by one‐way ANOVA and unpaired t test and presented as the mean ± SD (n = 6). # P < .05, significantly different from the control group; *P < .05, significantly different from the model group; ns, not significant.. ADR, adriamycin; CAT, catalpol

3.3. SIRT1 plays a key role in the reno‐protective action of catalpol

To elucidate the molecular mechanism of the protective effect of catalpol, we investigated the changes in protein and mRNA expression levels of SIRT1 and inflammatory cytokines in podocytes. When the cells were treated with adriamycin for 48 hr, the protein and mRNA expression levels of SIRT1 decreased. Notably, catalpol treatment significantly reversed these changes in SIRT1 expression, in a concentration‐dependent manner. In contrast, catalpol treatment markedly suppressed the increased protein/mRNA expression levels of IL‐6 and TNF‐α induced by adriamycin treatment (Figure 3a–c,g). Consistent with these in vitro findings, SIRT1 protein expression was up‐regulated, and the protein expression levels of TNF‐α and IL‐6 were down‐regulated when mice were treated with catalpol for 28 days (Figure 3d–f). Moreover, the cellular ROS accumulation markedly increased after the cells were treated with adriamycin for 48 hr, and catalpol treatment down‐regulated the cellular ROS accumulation caused by adriamycin. Furthermore, the SIRT1 protein expression level was significantly down‐regulated, while the protein expression levels of IL‐6 and TNF‐α were up‐regulated, following the preincubation of podocytes with siRNA against SIRT1 and EX527 (Figure 4f), respectively. More importantly, flow cytometry analysis revealed an increased apoptotic ratio following treatment with EX527 and siRNA targeting SIRT1 compared with that of the ADR + CAT control (Figure 4i,j). The Hoechst 33342 staining analysis indicated that the nuclear morphological changes induced by adriamycin, such as chromatin condensation, nuclear fragmentation, and chromatin margination, were significantly reversed by catalpol. An increase in the fluorescence intensity occurred after catalpol was combined with EX527 or siRNA targeting SIRT1, which suggested that the antiapoptotic effect of catalpol was blocked (Figure 4k,l). In addition, incubation with EX527 or siRNA targeting SIRT1 caused an increase in ROS production compared with the ADR + CAT treatment alone, which suggested that the anti‐inflammatory effect of catalpol was blocked (Figure 4g,h).

Figure 3.

Figure 3

Catalpol regulated the expression of SIRT1 and inflammatory factors. In vitro, catalpol regulated the protein expression level of SIRT1, TNF‐α, and IL‐6 (a), and the statistical analysis of the relative expression levels of proteins is shown (b). The levels of TNF‐α and IL‐6 in cells were measured by elisa kit (c). catalpol regulated the mRNA expression level of SIRT1, TNF‐α, and IL‐6 (g) after co‐administration of catalpol and ADR. The level of ROS in cells was measured (h), and the statistical analysis of ROS accumulation is shown (i). In vivo, catalpol regulated the protein expression level of SIRT1, TNF‐α, and IL‐6 (d), and the statistical analysis of the relative protein expression levels is shown (e). The levels of TNF‐α and IL‐6 in cells were measured by elisa kit (f). Data are analysed by one‐way ANOVA and unpaired t test and presented as the mean ± SD (n = 6). # P < .05, significantly different from the control group; *P < .05, significantly different from the model group; ns, not significant. ADR, adriamycin; CAT, catalpol; SIRT1, sirtuin 1

Figure 4.

Figure 4

SIRT1 is involved in the protection of catalpol against adriamycin‐induced injury. Mouse podocyte clone 5 cells were transfected with either control siRNA or SIRT1 siRNA for 48 hr or incubated with EX527 for 4 hr. Then the cells were treated with adriamycin or catalpol or both catalpol and adriamycin for 48 hr. The SIRT1, TNF‐α, and IL‐6 protein levels in the cell lysates were measured by western blotting (a–d). The levels of TNF‐α (e) and IL‐6 (f) in cells were measured by elisa kit. The changes in ROS accumulation (g, h), flow cytometry (i, j), and Hoechst 33342 staining (k, l) are shown. Data are analysed by one‐way ANOVA and unpaired t test and presented as the mean ± SD (n = 6). # P < .05, significantly different from the control group. *P < .05, significantly different from the adriamycin group. & P < .05 significantly different from the adriamycin + catalpol group; ns, not significant.. ADR, adriamycin; CAT, catalpol; SIRT1, sirtuin 1

3.4. Catalpol regulates the expression of MRP2 in adriamycin‐induced nephropathy

To investigate whether catalpol could decrease the intracellular accumulation of adriamycin to attenuate adriamycin‐induced damage, the effect of catalpol on the expression of renal drug efflux transporters, such as https://www.guidetopharmacology.org/GRAC/ObjectDisplayForward?objectId=780 and https://www.guidetopharmacology.org/GRAC/ObjectDisplayForward?objectId=768, was investigated. The results indicated that MRP2 protein expression was markedly down‐regulated following adriamycin treatment. As expected, the protein expression level of MRP2 was significantly restored by catalpol treatment either in vitro (Figure 5a,b) or in vivo (Figure 5c,d), even though catalpol treatment alone did not change the expression level of MRP2. Moreover, the changes in the expression of MRP2 mRNA was consistent with that of the MRP2 protein (Figure 5e). In contrast, another renal efflux transporter, P‐gp, was almost unaffected by adriamycin or catalpol treatment (Figure 5a–d,f). TUNEL staining suggested that the combined adriamycin and catalpol treatment alleviated apoptosis by reducing the intracellular accumulation of adriamycin and that catalpol treatment alone had no effect on apoptosis (Figure 5g). These findings suggest that catalpol may decrease the intracellular accumulation of adriamycin by enhancing MRP2 expression.

Figure 5.

Figure 5

Catalpol regulated the protein expression level of renal drug transporters to enhance the excretion of adriamycin. In vivo, catalpol regulated the protein expression level of renal transporters (c). Statistical analysis of MRP2 and P‐gp (d) in mouse kidneys after co‐administration of adriamycin and catalpol. In vitro, changes in the mRNA expression level of MRP2 (e) and P‐gp (h), in the protein expression level of MRP2 and P‐gp (a, b), and in the intracellular accumulation of adriamycin (g) were observed. Data are analysed by one‐way ANOVA and unpaired t test and presented as the mean ± SD. # P < .05, significantly different from the control group. *P < .05, significantly different from the adriamycin group; ns, not significant. ADR, adriamycin; CAT, catalpol; MRP2, multidrug resistance‐associated protein 2; P‐gp, P‐glycoprotein

3.5. Catalpol regulates the expression of TRPC6 protein in adriamycin‐induced nephropathy

TRPC6, a cation channel mediating the release of cytosolic compartmentalized calcium, plays a crucial role in adriamycin‐induced nephropathy by regulating the expression of nephrin and desmin. Further studies were carried out to explore the relationship between catalpol and the TRPC6 channels signalling pathway. The results indicated that catalpol significantly reversed the increased protein expression level of TRPC6 and desmin, as well as the decreased protein expression of nephrin caused by adriamycin treatment (Figure 6a–d) in mice. Consistent with these findings, the increased protein and mRNA expression levels of TRPC6 and desmin, as well as the decreased expression level of nephrin in podocytes, caused by adriamycin, were markedly alleviated by catalpol treatment in a concentration‐dependent manner (Figure 6e–h). Moreover, adriamycin triggered an increase in intracellular free calcium in podocytes, which was markedly blocked by catalpol treatment (Figure 6l). These data suggest that catalpol reversed the adriamycin‐induced decrease in the nephrin protein expression level and an increase in the desmin protein expression level by inhibiting expression of TRPC6 channels

Figure 6.

Figure 6

Catalpol regulated the protein expression level of TRPC6. In vivo, catalpol regulated the protein expression of TRPC6 (a). Statistical analysis of nephrin (b), desmin (c), and TRPC6 (d) in mouse kidneys after co‐administration of adriamycin and catalpol. In vitro, changes in the mRNA expression level of nephrin (i), desmin (j), TRPC6 (k), in the protein expression level of nephrin (f), desmin (g), TRPC6 (h), and in the intracellular free calcium level were observed. Data are analysed by one‐way ANOVA and unpaired t test and presented as the mean ± SD. # P < .05, significantly different from the control group. *P < .05 significantly different from the adriamycin group; ns, not significant. ADR, adriamycin; CAT, catalpol; TRPC6, transient receptor potential canonical channel 6

3.6. SIRT1 expression is related to the catalpol‐mediated regulation of the expression of TRPC6 channels and MRP2 in adriamycin‐induced nephropathy

We next sought to further illuminate whether SIRT1 is involved in the regulation of TRPC6 and MRP2 expression. In all groups, after transfection of SIRT1 siRNA or incubation with EX527, TRPC6 expression increased and MRP2 expression decreased. Notably, the catalpol‐mediated down‐regulation of TRPC6 and up‐regulation of MRP2 was mostly inhibited by SIRT1 siRNA transfection or pre‐incubation with EX527 (Figure 7a,b). As a result, the intracellular accumulation of adriamycin increased, which induced apoptosis (Figure 7e). The intracellular free calcium level also increased (Figure 7f). Moreover, a decrease in nephrin expression and an increase in desmin expression were observed (Figure 7a,b). Together, these results indicate that the SIRT1 level is related to the expression of TRPC6 and MRP2 protein.

Figure 7.

Figure 7

Catalpol decreases TRPC6 expression and increases MRP2 expression through SIRT1 activation. MPC‐5 cells were transfected with either control siRNA or SIRT1 siRNA for 48 hr or incubated with EX527 for 4 hr. Then the cells were treated with adriamycin or catalpol or both catalpol and adriamycin concurrently for 48 hr. MRP2, nephrin, TRPC6, and desmin protein levels in the cellular lysate were measured by western blotting (n = 6; a–d). The changes in intracellular free calcium (f) and TUNEL staining (e) are shown. Data are analysed by one‐way ANOVA and unpaired t test and presented as the mean ± SD. # P < .05 significantly different from the control group. *P < .05 significantly different from the adriamycin group. & P < .05 significantly different from the adriamycin + catalpol group; ns, not significant. ADR, adriamycin; CAT, catalpol; MRP2, multidrug resistance‐associated protein 2; SIRT1, sirtuin 1; TRPC6, transient receptor potential canonical channel 6

3.7. Effects of catalpol assessed by docking studies

Molecular simulations were conducted to explore the molecular interaction between catalpol and SIRT1. The optimal conformation of catalpol within SIRT1 was compared with that of SIRT1 activators, including resveratrol, SRT2140, and quercetin. As shown in Figure 8, the bioactive conformation of catalpol with SIRT1 yielded a higher total score value than that of other SIRT1 activators (6.4519 vs. 4.1586, 6.0038, and 5.4237), which suggested that catalpol might have a higher affinity for SIRT1 than other SIRT1 activators. Furthermore, the docking results indicated that in the active sites of SIRT1, six H‐bond interactions occurred between catalpol (Asn417, Leu418, Glu410, Lys375, Ser370, and Lys377). In contrast, resveratrol and SRT2104 formed three and four H‐bonds respectively, with active sites of SIRT1 (Figure 8a,b). There were six H‐bond interactions between quercetin and the active sites of SIRT1, but catalpol had a higher total score value than that of quercetin (Figure 8c). These results suggest that catalpol is a potential SIRT1 activator due to its strong affinity for SIRT1.

Figure 8.

Figure 8

Molecule docking simulation of compounds with 4ZZH. Resveratrol (a), SRT2104 (b), quercetin (c), and catalpol (d) bind to the active site of 4ZZH

4. DISCUSSION

The adriamycin‐induced rodent nephrotoxicity model is considered to represent “general” progressive chronic renal disease (Ajith et al., 2008; Lee & Harris, 2011; Taskin, Ozdogan, Kunduz, & Dursun, 2014). Many drugs, such as vitamins, quercetin, and sildenafil, have been applied to treat rodent adriamycin‐induced nephropathy even though the detailed mechanism of adriamycin‐induced nephropathy remains unclear (Khalil, Mohammed, Abd El‐Fattah, & Zaglool, 2018; Khames, Khalaf, Gad, & Abd El‐Raouf, 2017; Kumral et al., 2016). Notably, naturally occurring antioxidants, such as vitamins and flavonoids, have been widely studied in the treatment of nephropathy, which is considered to be of great clinical relevance (Injac & Strukelj, 2008). Catalpol is an active ingredient derived from R. glutinosa, and has been widely used to treat various diseases due to its antioxidant and antiapoptotic effects (Bi et al., 2009; Liu et al., 2017; Zhang et al., 2008). Therefore, this study was designed to investigate the protective effects of catalpol on adriamycin‐induced nephropathy and to elucidate the underlying molecular mechanism(s).

Sirtuins are a class of NAD‐dependent deacetylases, comprising seven members (SIRT1‐7), which play a key role in the process of inflammation, apoptosis, and energy metabolism (Morris, 2013). Previous studies have confirmed the beneficial effects of SIRT1 in many organs, including the brain (Li et al., 2017), liver (Zhang et al., 2017), heart (Prola et al., 2017), and kidney (Bai et al., 2016). Diabetic mice with conditional deletion of SIRT1 in podocytes were found to develop more proteinuria and kidney injury than wild‐type mice (Liu et al., 2014). Accordingly, activation of SIRT1 is considered to be a therapeutic strategy to improve kidney function (Kong et al., 2015). In the present study, SIRT1 expression was strikingly decreased in adriamycin‐damaged kidney tissue and podocytes, whereas catalpol treatment significantly up‐regulated the expression of SIRT1 (Figure 3). Moreover, the activation effect of catalpol on SIRT1 was inhibited, and levels of SIRT1‐regulated downstream cytokines (TNF‐α and IL‐6) increased, resulting in the aggravation of apoptosis and inflammation when the podocytes were incubated with SIRT1 siRNA or the SIRT1‐specific inhibitor EX527 (Figure 4). These findings strongly suggest that SIRT1 plays a crucial role in the protective effect of catalpol on adriamycin‐induced kidney damage.

Importantly, accumulating evidence reinforces the notion that efflux transporters, such as P‐gp and MRP2, are important for the intracellular accumulation of adriamycin (Hidemura et al., 2003; Vaclavikova et al., 2008), which prompted us to investigate the effect of P‐gp and MRP2 on adriamycin‐induced injury. The results demonstrated that adriamycin decreased the expression of MRP2 but did not affect P‐gp expression. Notably, treatment with catalpol led to an increase in the expression of MRP2 but not P‐gp, which might reduce the intracellular accumulation of adriamycin, as indicated by the alleviation of apoptosis (Figure 5). Interestingly, this effect of catalpol on MRP2 was blocked by SIRT1 siRNA transfection or EX527 pre‐incubation (Figure 7), which suggests that catalpol might partly alleviate adriamycin‐induced nephropathy by regulating MRP2 via SIRT1. Previous studies have demonstrated that SIRT1 plays a crucial role in regulating the expression of MRP2 (Choi et al., 2013). Our results also confirm the hypothesis that the activation of SIRT1 increases the expression of MRP2.

Podocytes, the target of glomerular damage, play an important role in the development and progression of kidney diseases (Qu et al., 2018; Sun, Zhao, & Meng, 2012). For podocytes, nephrin is a crucial structural and signalling molecule that regulates many signalling pathways and suppresses cell death (Yu, 2014). Desmin is a Type III intermediate filament that regulates the sarcomere architecture of podocytes (Zou et al., 2006). Nephrin and desmin are biomarkers of podocyte injury (Kakimoto et al., 2014; Perez‐Hernandez et al., 2016). In addition, previous research has demonstrated that TRPC6 channels are involved in the expression of nephrin and desmin in adriamycin‐induced nephropathy (H. Huang, You, et al., 2017). Additionally, TRPC6 channels provide a major calcium ion influx pathway in podocytes, regulating intracellular free calcium ions (Ji et al., 2018). In the current study, we demonstrated that catalpol alleviated adriamycin‐induced injury by down‐regulating the expression of TRPC6 channels (Figure 6). Furthermore, we found that the down‐regulation of SIRT1 expression caused an increase in the expression of TRPC6 and desmin and a decrease in nephrin expression as well as a large accumulation of adriamycin (Figure 7). Taken together, these results suggest that catalpol modifies expression of TRPC6 channels by up‐regulating SIRT1 expression, resulting in a protective effect on podocytes. Compared with the in vivo experiment that is designed to mimic the chronic renal injury by treatment with adriamycin for 4 weeks, the in vitro experiments were conducted in podocytes (MPC‐5 cells), so as to illustrate the relevant mechanisms involved in the acute podocyte injury by incubation with adriamycin for 48 hr. The in vitro results from podocytes suggested that the acute podocytotoxicity induced by adriamycin could be a major contributor to the final chronic renal injury, which could be significantly alleviated by catalpol.

Due to the crucial role of SIRT1 in various diseases, activation of SIRT1 may be viewed as an alternative therapeutic strategy to implement in the near future (Kumar & Chauhan, 2016). Resveratrol, a recognized activator of SIRT1, has been reported to exert a significant effect on improving the function of SIRT1 (Gonzalez‐Rodriguez et al., 2015). However, the application of resveratrol is limited by its poor water solubility and low bioavailability (Walle, Hsieh, DeLegge, Oatis, & Walle, 2004). In our study, we found that catalpol showed a good activation effect on SIRT1 in adriamycin‐induced nephropathy (Figure 3). Compared with resveratrol, catalpol has good water solubility and high oral bioavailability (Zhao et al., 2016), making it a more practical choice than resveratrol. Remarkably, docking simulations further demonstrated that catalpol binds tightly to SIRT1 so it may be more effective than resveratrol (Figure 8). Catalpol can efficiently orient itself in the active site of SIRT1 via hydrogen‐bond interactions, indicating a higher total score than that of resveratrol. Additionally, compared to SRT2104 and quercetin, catalpol showed a higher total binding affinity score. These findings imply that catalpol might be a promising activator of SIRT1. Nevertheless, the current study is a preliminary study, and further experiments are needed to verify this hypothesis.

The pharmacokinetics of catalpol have also been previously reported. Catalpol is a water‐soluble compound that is only slightly metabolized in the liver and is mainly eliminated via the kidney. Despite the fact that catalpol can be transformed by intestinal bacteria, due to its glucoside structure (Tao et al., 2016), a high plasma exposure in normal rats can be reached with a C max of 2.14 μg·ml−1 (equal to ~5.9 μM; Zhao et al., 2015). When rats with chronic kidney disease were given catalpol, the C max increased to 7.94 μg·ml−1 (Zhao et al., 2015), which suggests that the kidney is the major elimination pathway for catalpol. Moreover, catalpol showed the highest distribution in rat kidney compared with other tissues (Xue et al., 2015), which implies that the tissue‐specific enrichment of catalpol favours its renal protective functions.

In conclusion, this study demonstrated the protective effects of catalpol against adriamycin‐induced nephropathy in vitro and in vivo. In mice exposed to adriamycin, catalpol decreased the level of inflammatory cytokines in the kidney, improved the function of podocytes, and alleviated kidney injury by increasing the expression of SIRT1 and MRP2, as well as decreasing the expression of TRPC6. In addition, catalpol attenuated adriamycin‐induced damage by decreasing the accumulation of adriamycin and intracellular free calcium. Furthermore, using SIRT1 siRNA and the SIRT1‐specific inhibitor EX527, we confirmed that the regulation of the SIRT1/MRP2 and SIRT1/TRPC6 pathways is at least partly involved in the protective effect of catalpol (Figure 9).

Figure 9.

Figure 9

Scheme of the signalling pathway involved in the effect of catalpol on adriamycin‐induced nephrocyte injury in vitro. Catalpol acts on inflammation, apoptosis and podocyte structure. Furthermore, catalpol down‐regulates the level of TRPC6 channels to decrease the level of Ca2+ in cells and up‐regulates MRP2 expression to reduce the intracellular accumulation of adriamycin by inducing the expression of SIRT1. CAT, catalpol; MRP2, multidrug resistance‐associated protein 2; SIRT1, sirtuin 1; TRPC6, transient receptor potential canonical channel 6

AUTHOR CONTRIBUTIONS

J.Z. performed the experiments; J.Z. and R.B. contributed to the response to reviewers; J.W. and K.L. contributed to the writing; and J.W. and K.L. contributed to the study design.

CONFLICT OF INTEREST

The authors declare no conflicts of interest.

DECLARATION OF TRANSPARENCY AND SCIENTIFIC RIGOUR

This Declaration acknowledges that this paper adheres to the principles for transparent reporting and scientific rigour of preclinical research as stated in the BJP guidelines for https://bpspubs.onlinelibrary.wiley.com/doi/full/10.1111/bph.14207, https://bpspubs.onlinelibrary.wiley.com/doi/full/10.1111/bph.14208, and https://bpspubs.onlinelibrary.wiley.com/doi/full/10.1111/bph.14206, and as recommended by funding agencies, publishers and other organisations engaged with supporting research.

ACKNOWLEDGEMENTS

This work was supported by the National Natural Science Foundation of China (nos. 81874324 and U1608283) and the Dalian Science and technology innovation fund (no. 2018J12SN065).

Zhang J, Bi R, Meng Q, et al. Catalpol alleviates adriamycin‐induced nephropathy by activating the SIRT1 signalling pathway in vivo and in vitro. Br J Pharmacol. 2019;176:4558–4573. 10.1111/bph.14822

Jiangnan Zhang and Ran Bi should be considered joint first author.

Contributor Information

Jingjing Wu, Email: wjj@dlmedu.edu.cn.

Kexin Liu, Email: kexinliu@dlmedu.edu.cn.

REFERENCES

  1. Ajith, T. A. , Aswathy, M. S. , & Hema, U. (2008). Protective effect of Zingiber officinale roscoe against anticancer drug doxorubicin‐induced acute nephrotoxicity. Food and Chemical Toxicology, 46, 3178–3181. 10.1016/j.fct.2008.07.004 [DOI] [PubMed] [Google Scholar]
  2. Alexander, S. P. H. , Fabbro, D. , Kelly, E. , Marrion, N. V. , Peters, J. A. , Faccenda, E. , … CGTP Collaborators (2017). The Concise Guide To PHARMACOLOGY 2017/18: Enzymes. British Journal of Pharmacology, 174, S272–S359. 10.1111/bph.13877 [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Alexander, S. P. H. , Kelly, E. , Marrion, N. V. , Peters, J. A. , Faccenda, E. , Harding, S. D. , … CGTP Collaborators (2017). The Concise Guide To PHARMACOLOGY 2017/18: Transporters. British Journal of Pharmacology, 174, S360–S446. 10.1111/bph.13883 [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Alexander, S. P. H. , Roberts, R. E. , Broughton, B. R. S. , Sobey, C. G. , George, C. H. , Stanford, S. C ., … Ahluwalia, A. (2018). Goals and practicalities of immunoblotting and immunohistochemistry: A guide for submission to the British Journal of Pharmacology. British Journal of Pharmacology, 175(3), 407–411. 10.1111/bph.14112 [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Alexander, S. P. H. , Striessnig, J. , Kelly, E. , Marrion, N. V. , Peters, J. A. , Faccenda, E. , … CGTP Collaborators (2017). The Concise Guide To PHARMACOLOGY 2017/18: Voltage‐gated ion channels. British Journal of Pharmacology, 174, S160–S194. 10.1111/bph.13884 [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Bai, X. Z. , He, T. , Gao, J. X. , Liu, Y. , Liu, J. Q. , Han, S. C. , … Hu, D. H. (2016). Melatonin prevents acute kidney injury in severely burned rats via the activation of SIRT1. Scientific Reports, 6, 32199 10.1038/srep32199 [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Bi, J. , Jiang, B. , Hao, S. , Zhang, A. , Dong, Y. , Jiang, T. , & An, L. (2009). Catalpol attenuates nitric oxide increase via ERK signaling pathways induced by rotenone in mesencephalic neurons. Neurochemistry International, 54, 264–270. 10.1016/j.neuint.2008.12.003 [DOI] [PubMed] [Google Scholar]
  8. Bucciarelli, E. , Binazzi, R. , Santori, P. , & Vespasiani, G. (1976). Nephrotic syndrome in rats due to adriamycin chlorhydrate. Lavori dell'Istituto di Anatomia e Istologia Patologica, Università Degli Studi di Perugia, 36, 53–69. [PubMed] [Google Scholar]
  9. Cabeza, L. , Ortiz, R. , Prados, J. , Delgado, A. V. , Martin‐Villena, M. J. , Clares, B. , … Arias, J. L. (2017). Improved antitumor activity and reduced toxicity of doxorubicin encapsulated in poly(ε‐caprolactone) nanoparticles in lung and breast cancer treatment: An in vitro and in vivo study. European Journal of Pharmaceutical Sciences, 102, 24–34. 10.1016/j.ejps.2017.02.026 [DOI] [PubMed] [Google Scholar]
  10. Chen, A. , Sheu, L. F. , Ho, Y. S. , Lin, Y. F. , Chou, W. Y. , Chou, T. C. , & Lee, W. H. (2015). Experimental focal segmental glomerulosclerosis in mice. Nephron, 78, 440–452. [DOI] [PubMed] [Google Scholar]
  11. Choi, H. K. , Cho, K. B. , Phuong, N. T. , Han, C. Y. , Han, H. K. , Hien, T. T. , … Kang, K. W. (2013). SIRT1‐mediated FoxO1 deacetylation is essential for multidrug resistance‐associated protein 2 expression in tamoxifen‐resistant breast cancer cells. Molecular Pharmaceutics, 10, 2517–2527. 10.1021/mp400287p [DOI] [PubMed] [Google Scholar]
  12. Curtis, M. J. , Alexander, S. , Cirino, G. , Docherty, J. R. , George, C. H. , Giembycz, M. , … Ahluwalia, A. (2018). Experimental design and analysis and their reporting II: Updated and simplified guidance for authors and peer reviewers. British Journal of Pharmacology, 175, 987–993. 10.1111/bph.14153 [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Dong, Z. , & Chen, C. X. (2013). Effect of catalpol on diabetic nephropathy in rats. Phytomedicine, 20, 1023–1029. 10.1016/j.phymed.2013.04.007 [DOI] [PubMed] [Google Scholar]
  14. Fan, H. , Yang, H. C. , You, L. , Wang, Y. Y. , He, W. J. , & Hao, C. M. (2013). The histone deacetylase, SIRT1, contributes to the resistance of young mice to ischemia/reperfusion‐induced acute kidney injury. Kidney International, 83, 404–413. 10.1038/ki.2012.394 [DOI] [PubMed] [Google Scholar]
  15. Gonzalez‐Rodriguez, A. , Santamaria, B. , Mas‐Gutierrez, J. A. , Rada, P. , Fernandez‐Millan, E. , Pardo, V. , … Valverde, Á. M. (2015). Resveratrol treatment restores peripheral insulin sensitivity in diabetic mice in a sirt1‐independent manner. Molecular Nutrition & Food Research, 59, 1431–1442. 10.1002/mnfr.201400933 [DOI] [PubMed] [Google Scholar]
  16. Harding, S. D. , Sharman, J. L. , Faccenda, E. , Southan, C. , Pawson, A. J. , Ireland, S. , … NC‐IUPHAR (2018). The IUPHAR/BPS guide to pharmacology in 2018: Updates and expansion to encompass the new guide to immunopharmacology. Nucl Acids Res, 46, D1091–D1106. 10.1093/nar/gkx1121 [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Hidemura, K. , Zhao, Y. L. , Ito, K. , Nakao, A. , Tatsumi, Y. , Kanazawa, H. , … Hasegawa, T. (2003). Shiga‐like toxin II impairs hepatobiliary transport of doxorubicin in rats by down‐regulation of hepatic P glycoprotein and multidrug resistance‐associated protein Mrp2. Antimicrobial Agents and Chemotherapy, 47, 1636–1642. 10.1128/AAC.47.5.1636-1642.2003 [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Hong, Q. , Zhang, L. , Das, B. , Li, Z. , Liu, B. , Cai, G. , … Lee, K. (2018). Increased podocyte Sirtuin‐1 function attenuates diabetic kidney injury. Kidney International, 93, 1330–1343. 10.1016/j.kint.2017.12.008 [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Hu, L. , Sun, Y. , & Hu, J. (2010). Catalpol inhibits apoptosis in hydrogen peroxide‐induced endothelium by activating the PI3K/Akt signaling pathway and modulating expression of Bcl‐2 and Bax. European Journal of Pharmacology, 628, 155–163. 10.1016/j.ejphar.2009.11.046 [DOI] [PubMed] [Google Scholar]
  20. Huang, D. , Wang, C. , Duan, Y. , Meng, Q. , Liu, Z. , Huo, X. , … Liu, K. (2017). Targeting Oct2 and P53: Formononetin prevents cisplatin‐induced acute kidney injury. Toxicology and Applied Pharmacology, 326, 15–24. 10.1016/j.taap.2017.04.013 [DOI] [PubMed] [Google Scholar]
  21. Huang, H. , You, Y. , Lin, X. , Tang, C. , Gu, X. , Huang, M. , … Huang, F. (2017). Inhibition of TRPC6 signal pathway alleviates podocyte injury induced by TGF‐β1. Cellular Physiology and Biochemistry, 41, 163–172. 10.1159/000455985 [DOI] [PubMed] [Google Scholar]
  22. Injac, R. , & Strukelj, B. (2008). Recent advances in protection against doxorubicin‐induced toxicity. Technology in Cancer Research & Treatment, 7, 497–516. 10.1177/153303460800700611 [DOI] [PubMed] [Google Scholar]
  23. Ji, T. , Zhang, C. , Ma, L. , Wang, Q. , Zou, L. , Meng, K. , … Jiao, J. (2018). TRPC6‐mediated Ca2+ signaling is required for hypoxia‐induced autophagy in human podocytes. Cellular Physiology and Biochemistry, 48, 1782–1792. 10.1159/000492351 [DOI] [PubMed] [Google Scholar]
  24. Kakimoto, T. , Okada, K. , Hirohashi, Y. , Relator, R. , Kawai, M. , Iguchi, T. , … Utsumi, H. (2014). Automated image analysis of a glomerular injury marker desmin in spontaneously diabetic Torii rats treated with losartan. The Journal of Endocrinology, 222, 43–51. 10.1530/JOE-14-0164 [DOI] [PubMed] [Google Scholar]
  25. Khalil, S. R. , Mohammed, A. T. , Abd El‐Fattah, A. H. , & Zaglool, A. W. (2018). Intermediate filament protein expression pattern and inflammatory response changes in kidneys of rats receiving doxorubicin chemotherapy and quercetin. Toxicology Letters, 288, 89–98. 10.1016/j.toxlet.2018.02.024 [DOI] [PubMed] [Google Scholar]
  26. Khames, A. , Khalaf, M. M. , Gad, A. M. , & Abd El‐Raouf, O. M. (2017). Ameliorative effects of sildenafil and/or febuxostat on doxorubicin‐induced nephrotoxicity in rats. European Journal of Pharmacology, 805, 118–124. 10.1016/j.ejphar.2017.02.046 [DOI] [PubMed] [Google Scholar]
  27. Kilkenny, C. , Browne, W. , Cuthill, I. C. , Emerson, M. , & Altman, D. G. (2010). Animal research: Reporting in vivo experiments: The ARRIVE guidelines. British Journal of Pharmacology, 160, 1577–1579. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Kim, D. H. , Jung, Y. J. , Lee, J. E. , Lee, A. S. , Kang, K. P. , Lee, S. , … Kim, W. (2011). SIRT1 activation by resveratrol ameliorates cisplatin‐induced renal injury through deacetylation of p53. American Journal of Physiology. Renal Physiology, 301, F427–F435. 10.1152/ajprenal.00258.2010 [DOI] [PubMed] [Google Scholar]
  29. Kong, L. , Wu, H. , Zhou, W. , Luo, M. , Tan, Y. , Miao, L. , & Cai, L. (2015). Sirtuin 1: A target for kidney diseases. Molecular Medicine, 21, 87–97. 10.2119/molmed.2014.00211 [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Kumar, A. , & Chauhan, S. (2016). How much successful are the medicinal chemists in modulation of SIRT1: A critical review. European Journal of Medicinal Chemistry, 119, 45–69. 10.1016/j.ejmech.2016.04.063 [DOI] [PubMed] [Google Scholar]
  31. Kume, S. , Kitada, M. , Kanasaki, K. , Maegawa, H. , & Koya, D. (2013). Anti‐aging molecule, Sirt1: A novel therapeutic target for diabetic nephropathy. Archives of Pharmacal Research, 36, 230–236. 10.1007/s12272-013-0019-4 [DOI] [PubMed] [Google Scholar]
  32. Kumral, A. , Giris, M. , Soluk‐Tekkesin, M. , Olgac, V. , Dogru‐Abbasoglu, S. , Turkoglu, U. , & Uysal, M. (2016). Beneficial effects of carnosine and carnosine plus Vitamin E treatments on doxorubicin‐induced oxidative stress and cardiac, hepatic, and renal toxicity in rats. Human & Experimental Toxicology, 35, 635–643. 10.1177/0960327115597468 [DOI] [PubMed] [Google Scholar]
  33. Lee, V. W. , & Harris, D. C. (2011). Adriamycin nephropathy: A model of focal segmental glomerulosclerosis. Nephrology (Carlton), 16, 30–38. 10.1111/j.1440-1797.2010.01383.x [DOI] [PubMed] [Google Scholar]
  34. Li, D. , Liu, N. , Zhao, H. H. , Zhang, X. , Kawano, H. , Liu, L. , … Li, H. P. (2017). Interactions between Sirt1 and MAPKs regulate astrocyte activation induced by brain injury in vitro and in vivo. Journal of Neuroinflammation, 14, 67 10.1186/s12974-017-0841-6 [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Li, X. , Chuang, P. Y. , D'Agati, V. D. , Dai, Y. , Yacoub, R. , Fu, J. , … He, J. C. (2015). Nephrin preserves podocyte viability and glomerular structure and function in adult kidneys. Journal of the American Society of Nephrology, 26, 2361–2377. 10.1681/ASN.2014040405 [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Liu, R. , Zhong, Y. , Li, X. , Chen, H. , Jim, B. , Zhou, M. M. , … He, J. C. (2014). Role of transcription factor acetylation in diabetic kidney disease. Diabetes, 63, 2440–2453. 10.2337/db13-1810 [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Liu, Y. , Tang, Q. , Shao, S. , Chen, Y. , Chen, W. , & Xu, X. (2017). Lyophilized powder of catalpol and puerarin protected cerebral vessels from ischemia by its anti‐apoptosis on endothelial cells. International Journal of Biological Sciences, 13, 327–338. 10.7150/ijbs.17751 [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Mori, K. , Mukoyama, M. , & Nakao, K. (2011). PPAR‐α transcriptional activity is required to combat doxorubicin‐induced podocyte injury in mice. Kidney International, 79, 1274–1276. 10.1038/ki.2011.36 [DOI] [PubMed] [Google Scholar]
  39. Morris, B. J. (2013). Seven sirtuins for seven deadly diseases of aging. Free Radical Biology & Medicine, 56, 133–171. 10.1016/j.freeradbiomed.2012.10.525 [DOI] [PubMed] [Google Scholar]
  40. Nogueiras, R. , Habegger, K. M. , Chaudhary, N. , Finan, B. , Banks, A. S. , Dietrich, M. O. , … Tschöp, M. H. (2012). Sirtuin 1 and sirtuin 3: Physiological modulators of metabolism. Physiological Reviews, 92, 1479–1514. 10.1152/physrev.00022.2011 [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Octavia, Y. , Tocchetti, C. G. , Gabrielson, K. L. , Janssens, S. , Crijns, H. J. , & Moens, A. L. (2012). Doxorubicin‐induced cardiomyopathy: From molecular mechanisms to therapeutic strategies. Journal of Molecular and Cellular Cardiology, 52, 1213–1225. 10.1016/j.yjmcc.2012.03.006 [DOI] [PubMed] [Google Scholar]
  42. Perez‐Hernandez, J. , Olivares, M. D. , Forner, M. J. , Chaves, F. J. , Cortes, R. , & Redon, J. (2016). Urinary dedifferentiated podocytes as a non‐invasive biomarker of lupus nephritis. Nephrology, Dialysis, Transplantation, 31, 780–789. 10.1093/ndt/gfw002 [DOI] [PubMed] [Google Scholar]
  43. Prola, A. , Pires Da Silva, J. , Guilbert, A. , Lecru, L. , Piquereau, J. , Ribeiro, M. , … Lemaire, C. (2017). SIRT1 protects the heart from ER stress‐induced cell death through eIF2α deacetylation. Cell Death and Differentiation, 24, 343–356. 10.1038/cdd.2016.138 [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Qu, X. , Zhang, Y. , Zhang, S. , Zhai, J. , Gao, H. , Tao, L. , & Song, Y. (2018). Dysregulation of BSEP and MRP2 may play an important role in isoniazid‐induced liver injury via the SIRT1/FXR pathway in rats and HepG2 cells. Biological & Pharmaceutical Bulletin, 41, 1211–1218. 10.1248/bpb.b18-00028 [DOI] [PubMed] [Google Scholar]
  45. Rivankar, S. (2014). An overview of doxorubicin formulations in cancer therapy. Journal of Cancer Research and Therapeutics, 10, 853–858. 10.4103/0973-1482.139267 [DOI] [PubMed] [Google Scholar]
  46. Sternberg, S. S. (1970). Cross‐striated fibrils and other ultrastructural alterations in glomeruli of rats with daunomycin nephrosis. Laboratory Investigation, 23, 39–51. [PubMed] [Google Scholar]
  47. Sun, D. , Zhao, X. , & Meng, L. (2012). Relationship between urinary podocytes and kidney diseases. Renal Failure, 34, 403–407. 10.3109/0886022X.2011.649627 [DOI] [PubMed] [Google Scholar]
  48. Tao, J. , Zhao, M. , Wang, D. , Yang, C. , Du, L.‐Y. , Qiu, W. , & Jiang, S. (2016). Biotransformation and metabolic profile of catalpol with human intestinal microflora by ultra-performance liquid chromatography coupled with quadrupole time-of-flight mass spectrometry. Journal of Chromatography B, 1009-1010, 163–169. 10.1016/j.jchromb.2015.12.007 [DOI] [PubMed] [Google Scholar]
  49. Taskin, E. , Ozdogan, K. , Kunduz, K. E. , & Dursun, N. (2014). The restoration of kidney mitochondria function by inhibition of angiotensin‐II production in rats with acute adriamycin‐induced nephrotoxicity. Renal Failure, 36, 606–612. 10.3109/0886022X.2014.882737 [DOI] [PubMed] [Google Scholar]
  50. Vaclavikova, R. , Kondrova, E. , Ehrlichova, M. , Boumendjel, A. , Kovar, J. , Stopka, P. , … Gut, I. (2008). The effect of flavonoid derivatives on doxorubicin transport and metabolism. Bioorganic & Medicinal Chemistry, 16, 2034–2042. 10.1016/j.bmc.2007.10.093 [DOI] [PubMed] [Google Scholar]
  51. Walle, T. , Hsieh, F. , DeLegge, M. H. , Oatis, J. E. Jr. , & Walle, U. K. (2004). High absorption but very low bioavailability of oral resveratrol in humans. Drug Metabolism and Disposition, 32, 1377–1382. 10.1124/dmd.104.000885 [DOI] [PubMed] [Google Scholar]
  52. Wang, Y. , Wang, Y. P. , Tay, Y. C. , & Harris, D. C. (2000). Progressive adriamycin nephropathy in mice: Sequence of histologic and immunohistochemical events. Kidney International, 58, 1797–1804. 10.1046/j.1523-1755.2000.00342.x [DOI] [PubMed] [Google Scholar]
  53. Wang, Z. H. , & Zhan‐Sheng, H. (2018). Catalpol inhibits migration and induces apoptosis in gastric cancer cells and in athymic nude mice. Biomedicine & Pharmacotherapy, 103, 1708–1719. 10.1016/j.biopha.2018.03.094 [DOI] [PubMed] [Google Scholar]
  54. Wen, S. , Wang, C. , Huo, X. , Meng, Q. , Liu, Z. , Yang, S. , … Liu, K. (2018). JBP485 attenuates vancomycin‐induced nephrotoxicity by regulating the expressions of organic anion transporter (Oat) 1, Oat3, organic cation transporter 2 (Oct2), multidrug resistance‐associated protein 2 (Mrp2) and P‐glycoprotein (P‐gp) in rats. Toxicology Letters., 295, 195–204. 10.1016/j.toxlet.2018.06.1220 [DOI] [PubMed] [Google Scholar]
  55. Xiong, Y. , Shi, L. , Wang, L. , Zhou, Z. , Wang, C. , Lin, Y. , … Chen, D. (2017). Activation of sirtuin 1 by catalpol‐induced down‐regulation of microRNA‐132 attenuates endoplasmic reticulum stress in colitis. Pharmacological Research, 123, 73–82. 10.1016/j.phrs.2017.05.030 [DOI] [PubMed] [Google Scholar]
  56. Xue, B. Y. , Ma, B. , Zhang, Q. , Li, X. T. , Zhu, J. W. , Liu, M. , … Wu, Z. (2015). Pharmacokinetics and tissue distribution of aucubin, ajugol and catalpol in rats using a validated simultaneous LC–ESI‐MS/MS assay. Journal of Chromatography B, 1002, 245–253. 10.1016/j.jchromb.2015.08.026 [DOI] [PubMed] [Google Scholar]
  57. Yan, J. , Wang, C. , Jin, Y. , Meng, Q. , Liu, Q. , Liu, Z. , … Sun, H. (2018). Catalpol ameliorates hepatic insulin resistance in type 2 diabetes through acting on AMPK/NOX4/PI3K/AKT pathway. Pharmacological Research, 130, 466–480. 10.1016/j.phrs.2017.12.026 [DOI] [PubMed] [Google Scholar]
  58. Yu, S. (2014). Role of nephrin in podocyte injury induced by angiotension II. Journal of Receptor and Signal Transduction Research, 36, 1–5. [DOI] [PubMed] [Google Scholar]
  59. Zhang, N. , Hu, Y. , Ding, C. , Zeng, W. , Shan, W. , Fan, H. , … Yao, J. (2017). Salvianolic acid B protects against chronic alcoholic liver injury via SIRT1‐mediated inhibition of CRP and ChREBP in rats. Toxicology Letters, 267, 1–10. 10.1016/j.toxlet.2016.12.010 [DOI] [PubMed] [Google Scholar]
  60. Zhang, R. X. , Li, M. X. , & Jia, Z. P. (2008). Rehmannia glutinosa: Review of botany, chemistry and pharmacology. Journal of Ethnopharmacology, 117, 199–214. 10.1016/j.jep.2008.02.018 [DOI] [PubMed] [Google Scholar]
  61. Zhao, M. , Qian, D. , Liu, P. , Shang, E. X. , Jiang, S. , Guo, J. , … Tao, J. (2015). Comparative pharmacokinetics of catalpol and acteoside in normal and chronic kidney disease rats after oral administration of Rehmannia glutinosa extract. Biomedical Chromatography, 29, 1842–1848. 10.1002/bmc.3505 [DOI] [PubMed] [Google Scholar]
  62. Zhao, M. , Tao, J. , Qian, D. , Liu, P. , Shang, E. X. , Jiang, S. , … du, L. (2016). Simultaneous determination of loganin, morroniside, catalpol and acteoside in normal and chronic kidney disease rat plasma by UPLC‐MS for investigating the pharmacokinetics of Rehmannia glutinosa and Cornus officinalis Sieb drug pair extract. Journal of Chromatography. B, Analytical Technologies in the Biomedical and Life Sciences, 1009‐1010, 122–129. 10.1016/j.jchromb.2015.12.020 [DOI] [PubMed] [Google Scholar]
  63. Zhou, J. , Xu, G. , Ma, S. , Li, F. , Yuan, M. , Xu, H. , & Huang, K. (2015). Catalpol ameliorates high‐fat diet‐induced insulin resistance and adipose tissue inflammation by suppressing the JNK and NF‐κB pathways. Biochemical and Biophysical Research Communications, 467, 853–858. 10.1016/j.bbrc.2015.10.054 [DOI] [PubMed] [Google Scholar]
  64. Zou, J. , Yaoita, E. , Watanabe, Y. , Yoshida, Y. , Nameta, M. , Li, H. , … Yamamoto, T. (2006). Upregulation of nestin, vimentin, and desmin in rat podocytes in response to injury. Virchows Archiv, 448, 485–492. 10.1007/s00428-005-0134-9 [DOI] [PubMed] [Google Scholar]

Articles from British Journal of Pharmacology are provided here courtesy of The British Pharmacological Society

RESOURCES