Skip to main content
NCBI home page
Regenerative Therapy logoLink to Regenerative Therapy
. 2019 Apr 25;12:74–82. doi: 10.1016/j.reth.2019.03.008

A novel tool for suspension culture of human induced pluripotent stem cells: Lysophospholipids as a cell aggregation regulator

Masato Ibuki a,∗, Ikki Horiguchi b, Yasuyuki Sakai c
PMCID: PMC6933451  PMID: 31890769

Abstract

Suspension culture for the increase in human induced pluripotent stem cells (hiPSCs) has been one of the major challenges. Previously, we reported that albumin-associated lipids prevented aggregation of hiPSCs, whereas, lipids responsible for this function were unclear. Here, by using cell aggregation assay, we investigated principal lipids regulated aggregation size of hiPSCs. As a result, lysophosphatidic acid (LPA) and Sphingosine-1-phosphate (S1P), known as lysophospholipids acting as a signaling molecule, were identified. These lipids regulated the aggregation size in a dose-dependent manner. Aggregates formed with these lipids kept the high-expression rates of pluripotent marker genes and had the abilities of proliferation. These studies demonstrated that LPA and S1P were useful for suspension culture for hiPSCs without affecting the growth ability and pluripotency of hiPSCs. This knowledge will lead to the development of a simple and robust method for the mass culture of hiPSCs.

Keywords: Suspension culture, Lysophospholipid, Aggregation, Pluripotent stem cells, Spheroid

1. Introduction

A substantial number of hiPSCs (more than 109 cells) will be necessary for cell therapy of various diseases, such as myocardial infarction [1], diabetes [2], and hepatic failure [3]. Suspension culture has attracted attention as a mass culture method for hiPSCs for not only in clinical trials but also in commercialization. However, the scalable and cost-effective culturing of high-quality hiPSCs and their derivatives, especially for clinical applications, remains a challenge. Suspension culture based on aggregates provide simplicity and a reduction in the number of processing steps required compared to adhesion culture at large scale culture or expansion culture.

Current reports using bioreactor for expansion of human pluripotent stem cells sometimes implement with the strategy of seeding with single cells suspension, which often forms aggregates with heterogeneous sizes. The size of aggregates greatly affects the state and quality of the subsequent cells, so controlling aggregate size is essential for the homogeneity, reproducibility, and efficiency of the desired process [4]. Excessive agglomeration of aggregates can lead to growth arrest, cell death, or uncontrolled spontaneous differentiation as well as human embryonic stem cells (hESCs) [5], [6]. To avoid excessive agglomeration of aggregates and make their further growth, mechanically and hydrodynamically regulation have been attempted [7]. Such as impeller shearing easily prevents excess aggregation [8]. However, too high shear stress could affect cell viability and pluripotency of hiPSCs [7]. Therefore, the regulation of cell aggregation using unmechanical methodology is important for the establishment of versatile suspension culture systems.

Before, we reported a new biochemical approach for regulating the aggregation of hiPSCs by using lipids associated albumin in suspension culture [9], whereas, the lipids responsible for the suppressive effect of aggregation were unclear. In this report, we identified principal lipids regulating aggregation size of hiPSCs. This study aimed to develop a simple and robust method for the suspension culture of hiPSCs and suggested to be a breakthrough technology for the large-scale and cost-effective production of hiPSCs for regenerative medicine.

2. Materials and methods

2.1. Maintenance of human induced pluripotent stem cell lines

The hiPSCs line, TkDN4-M was provided by Centre for Stem Cell Biology and Regenerative Medicine, The University of Tokyo, Japan. The hiPSCs line, 201B7 was provided by Kyoto University, Japan. The hiPSCs line, RPChiPS771 was purchased from ReproCELL, Japan. TkDN4-M and 201B7 were cultured on truncated recombinant human vitronectin-coated dishes with Essential 8™ medium (both from Thermo Fischer Scientific). RPChiPS771 was cultured on truncated recombinant human vitronectin-coated dishes with StemFit AK02N (from Ajinomoto, Japan). For subculture, single cells were seeded with 10 μM Y-27632 (FUJIFILM Wako Pure Chemical Corporation, Japan) in the medium. The initial seeding was fixed at a viable cell density of 1 × 104 cells/cm2. Cells were incubated at 37 °C in a humidified atmosphere with 5% CO2, and the medium was changed every day with fresh medium without Y-27632. On day 4, cells were subcultured as described below. Cells were treated Accutase (from Innovative Cell Technologies) for 4 min incubation at 37 °C, and hiPSCs colonies were dissociated into single cells by pipetting with fresh medium containing 10 μM Y-27632. After centrifugation, the supernatant was discarded, and cells were re-suspended in fresh medium with 10 μM Y-27632. Viable cells were counted on a hemocytometer with the trypan blue exclusion method, and cells were re-seeded in a new culture dish.

2.2. Aggregation assay

The method for aggregation assay to detect the lipid that acts as a suppressor of aggregation describes in Fig. 1 briefly. hiPSCs cultured on truncated recombinant human vitronectin-coated dishes were dissociated into single cells by soaking for 3–5 min in Accutase and suspended in medium containing 10 μM Y-27632. The cell density of the collected single hiPSCs suspension was calculated by cell counting with trypan blue staining. Then, 1.3 mL of 2 × 105 cells/mL cell suspension in fresh medium containing 2 mg/mL BSA and 10 μM Y-27632 was seeded into a flat-bottom 12- well plate (Sumilon Multi-well plate, Sumitomo Bakelite Co, Ltd, Japan). After inoculation, candidate lipids were added to the culture medium and the cells were then incubated for 1 day on a rotary shaker (OS-762, Optima, Japan) with shaking at 83–90 rpm. Aggregates were observed by phase contrast microscopy (Axio Observer. D1 or Primovert, Carl Zeiss, Germany) and the aggregate sizes after 1 day were measured using Zen software (Carl Zeiss, Germany).

Fig. 1.

Fig. 1

Open in a new tab

Schematic illustrations of aggregation assay for detection of aggregation inhibitor.

To determine the effect of suppression of aggregation, we examined aggregation assay with reagents: lipid-rich albumin (AlbuMAX™ II, Thermo Fischer Scientific), fatty-acid-free bovine serum albumin (BSA, FUJIFILM Wako Pure Chemical Corporation, Japan), Chemically Defined Lipid Concentrate (CDLC, Thermo Fisher Scientific), 1-Oleoyl Lysophosphatidic Acid (18:1) (LPA, 1-Oleoyl LPA, Cayman Chemical Company, Ann Arbor, USA), Sphingosine-1-phosphate (18:1) (S1P, Cayman Chemical Company, Ann Arbor, USA), 1-Palmitoyl Lysophosphatidic Acid (16:0) (1-Palmitoyl LPA, Cayman Chemical Company, Ann Arbor, USA), 1-Oleoyl Lysophosphocholine (18:1) (1-Oleoyl LPC, Sigma–Aldrich), 1,2-Dipalmitoyl-sn-glycero-3-phosphatic acid (PA, Cayman Chemical Company, Ann Arbor, USA), L-α-lysophosphatidylinositol (LPI, Merck Millipore, USA). The concentration of the reagent was decided with references [9], [10].

2.3. Suspension culture with lysophospholipids

To investigate the ability of cell proliferation and pluripotency, hiPSCs were cultured continuously after the formation of cell aggregates. After dissociating the hiPSCs colony into single cells, 2 × 105 cells/ml were seeded with 10 μM Y-27632 and 2 mg/mL BSA into a flat-bottom 12-well plate (1.3 mL per well) (Sumilon Multi-well plate, Sumitomo Bakelite Co, Ltd, Japan). After inoculation, LPA or S1P were added to the culture medium to yield a final concentration of 0.2 μg/mL and the cells were then incubated for 2 days on a rotary shaker (OS-762, Optima, Japan) with shaking at 90 rpm. Subsequently, the medium was replaced with culture medium without the lipids and additional medium changes were performed every day.

2.4. Glucose consumption measurement and cell counting

Medium samples were collected during the daily medium changes after day two of incubation. Glucose consumption was measured using a biosensor BF-5iD (Oji-Keisoku Kiki, Japan). Aggregates were collected from suspension cultures on day five. Collected aggregates were dissociated into single cells by incubating for 10 min in Accutase and pipetting. Live cells were counted using the trypan blue exclusion test. P-values were determined by a two-tailed paired Student's t-test from comparison with the cell number of BSA condition and cell number of LPA or S1P condition.

2.5. Real-time quantitative reverse transcription-polymerase chain reaction (qRT-PCR)

Collected cells were dissolved in TRIzol reagent (Thermo Fisher Scientific). Total RNA samples extracted and purified using the TRIzol method and PureLink RNA Mini Kit (Thermo Fisher Scientific) according to the manufacturer's protocol. The cDNA was synthesized using the ReverTra Ace® qPCR RT Master Mix (Toyobo, Japan). qRT-PCR was performed on QuantStudio™ 7 Flex (Thermo Fisher Scientific) using KOD SYBR® qPCR Mix (Toyobo, Japan). β-Actin was used as the housekeeping gene for relative quantification of target gene expression. Primers are listed in Table 1. PCR cycling began with template denaturation and hot start at 98 °C for 2 min, then 5 cycles of 98 °C for 10 s and 68 °C for 30 s, 40 cycles of 98 °C for 10 s and 60 °C for 10 s and 68 °C for 30 s performed on a QuantStudio™ 7 Flex System with data collected during each cycle at the extension step. The qRT-PCR results were imported into Microsoft Excel and the average value of duplicate Ct values using the 2(−Δct) method.

Table 1.

List of primers used for quantitative reverse transcription–polymerase chain reaction (qRT-PCR).

Gene Forward primer (5′-3′) Reverse primer (5′-3′)
b-Actin CCTCATGAAGATCCTCACCGA TTGCCAATGGTGATGACCTGG
OCT4 AGTGGGTGGAGGAAGCTGACAAC TCGTTGTGCATAGTCGCTGCTTGA
SOX2 CACCAATCCCATCCACACTCAC GCAAAGCTCCTACCGTACCAC
Nanog AGCCTCCAGCAGATGCAAGAACTC TTGCTCCACATTGGAAGGTTCCCA
KLF4 AACTGACCAGGCACTACCGTAA CCTCATCGGGAAGACAGTGTGA
LPA-R1 ACCACAGTGCTTCTACAACGAG AGTAGGCCAACCCAGCAAAG
LPA-R2 CTGTCGAGCCTGCTTGTCTTC ACTCACAGCCTAAACCATCCAG
LPA-R3 AATTGCCTCTGCAACATCTC AGACAGTCATCACCGTCTTC
LPA-R4 CTCTTCGCAAGCCTGCTACTC GTTCAGAGTTGCAAGGCACAAG
LPA-R5 ACAGCTCCTCAACCAACAGTTC GTGGTGCAGTGCGTAGTAGG
LPA-R6 CATCTGCGTCCTCAAAGTCC AAGAACAGAATGCTTCCGTACA
S1P-R1 TGCTTCTGCTCTCCATCGTCA CTTCACCTTGCAGCCCACATC
S1P-R2 GTGGCCATTGCCAAGGTCAA GCAGTAGATGCGCACGTACAG
S1P-R3 GGTGAAGTCCAGCAGCCGTAA AGTTGAGCACAGCCAACACGA
S1P-R4 CTCTACTCCAAGCGCTACATCC AAGGCCAGCAGGATCATCAG
S1P-R5 CGGACTCTGGTATCAGAACC CATCACCATCTCTGTCGTTTG
LPI-R TCCATGTGTTTCTCCAACGTC GAACGCGATATCCGTTACCAG
Open in a new tab

b-Actin, actin beta; OCT4, POU class 5 homeobox 1; SOX2, SRY-box 2; Nanog, Nanog homeobox; KLF4, Kruppel like factor 4; LPA-R, lysophosphatidic acid receptor; S1P-R, sphingosine-1-phosphate receptor; LPI-R, lysophosphatidylinositol receptor.

2.6. Flow cytometry

For flow cytometric analyses, the cultured aggregates were dissociated into single cells with TrypLE select and fixed with 4% PFA for 20 min at room temperature. Fixed cells were washed with phosphate buffered saline (PBS) containing 3% fetal bovine serum (FBS). To permeabilize for staining to intracellular protein markers, cells were treated in methanol on ice overnight. After blocking with 3% FBS/PBS, the cells were stained with antibodies; anti-OCT4-PE (653704, Biolegend, USA), and anti-Nanog-Alexa Fluor® 647 (674010, Biolegend, USA). These samples were compared to the samples of cells stained with isotype controls; mouse IgG2b-PE (400314, Biolegend, USA), mouse IgG1-Alexa Fluor® 647 (400136, Biolegend, USA). Flow cytometry data were acquired using a Guava® EasyCyte HT flow cytometer (Merck Millipore, USA) and analyzed using Guava®-InCyte software (Merck Millipore, USA).

2.7. Statistical analyses

Data are expressed as the mean ± SEM. For comparisons of discrete data sets, unpaired Student's t-tests were used. Two-tailed P < 0.05 was considered significant.

3. Results

3.1. Inhibition of initial aggregation of hiPSCs by lysophospholipids

Our group reported that albumin-associated lipids prevented excess aggregation of hiPSCs [9]. Therefore, we searched for lipids with an ability to suppress aggregation. To examine the ability to inhibit aggregation of hiPSCs, we used aggregation assay based on swirling suspension culture (Fig. 1). Albumin is known to act as a transporter for fatty acids, cholesterol, lysophospholipids, and so on in the blood [11], [12], [13], [14]. Under conditions such that large aggregates were formed when only lipid-free BSA (BSA) was added (Fig. 2A), when Chemically Defined Lipid Concentrate (CDLC, Thermo Fisher Scientific Inc.) which was a mixture containing fatty acid and cholesterol was added with BSA, large aggregates were formed (Fig. 2C), whereas when LPA or S1P, known as lysophospholipids, were added with BSA, a plurality of small clumps were formed as well as lipid-rich BSA (AlbuMAX™) (Fig. 2B, 2D, and 2E). Even though LPA with different acyl groups was used, cell aggregation was suppressed (Fig. 3A and 3B). On the other hand, LPC, PA, LPI didn't act as the suppressor of aggregation (Fig. 3C, 3D, and 3E).

Fig. 2.

Fig. 2

Open in a new tab

Aggregation assay treated with different reagent. Cells (TkDN4-M) were cultured in Essential 8™ medium containing 2 mg/mL BSA (A), 2 mg/mL AlbuMAXTM (B), 2 mg/mL BSA supplemented with 1 x CDLC (C), 0.2 μg/mL LPA (D), or 0.2 μg/mL S1P (E) for 1 day on a rotary shaker with shaking at 90 rpm. The white scale bar is 500 μm.

Fig. 3.

Fig. 3

Open in a new tab

Aggregation assay treated with different lipids. Cells (TkDN4-M) were cultured in Essential 8™ medium containing 2 mg/mL BSA supplemented with 0.2 μg/mL 1-Oleoyl LPA (A), 0.2 μg/mL 1-Palmitoyl LPA (B), 0.2 μg/mL 1-Oleoyl LPC (C), 0.2 μg/mL PA (D) or 0.2 μg/mL LPI (E) for 1 day on a rotary shaker with shaking at 90 rpm. (F)–(J) show the chemical structure of each lipid. The white scale bar is 500 μm.

To investigate the correlation between lipids concentration and aggregate size, aggregation assay was performed by adding various concentrations of lipids (Fig. 4). Box plots of aggregate diameters treated with various concentrations of LPA or S1P are shown in Fig. 4C and 4D. According to the size measurements, 20 μg/mL LPA resulted in regulated low diameter (39.9 ± 8.0 μm), whereas the lower concentration of LPA showed a larger size aggregate. For example, with 0.16 μg/mL LPA treatment, the aggregate sizes were more than 100 μm (124.9 ± 26.5 μm). These results indicate that the aggregate size increased with lower LPA or S1P concentrations.

Fig. 4.

Fig. 4

Open in a new tab

Morphologies and sizes of cultured aggregates after treatment with different concentrations of LPA or S1P. (A, B) Cells (TkDN4-M) were cultured in Essential 8™ medium containing 2 mg/mL BSA supplemented with different concentrations of LPA or S1P from 0.032 to 100 μg/mL for 1 day on a rotary shaker. The white scale bar is 500 μm (C, D) Box plots show aggregate diameters obtained by randomly 30 aggregates treated with various concentrations of LPA or S1P from 0.16 to 100 μg/mL for 1 day on a rotary shaker with shaking at 90 rpm.

To examine whether LPA has an effect of aggregation suppressing in other strains or other culture media with a higher concentration of LPA to consider the difference between the medium or the cell line, aggregation assay was carried out using 201B7 with Essential 8™ and RPChiPS771 with StemFit® AK02N. As a result, in both cell lines as well, LPA suppressed cell aggregation (Fig. 5). These results indicate that lysophospholipids, particularly LPA and S1P, suppress aggregation of hiPSCs.

Fig. 5.

Fig. 5

Open in a new tab

Aggregation assay using different hiPSCs lines and different medium with LPA. 201B7 cells were cultured in Essential 8™ medium containing 2 mg/mL BSA supplemented with 0 μg/mL LPA (A) or 0.5 μg/mL LPA for 1 day on a rotary shaker (B). RPChiPS771 cells were cultured in StemFit® AK02N medium containing 2 mg/mL BSA supplemented with 0 μg/mL LPA (C) or 0.5 μg/mL LPA (D) for 1 day on a rotary shaker with shaking at 83 rpm. The white scale bar is 200 μm.

3.2. Glucose consumption and cell yields

To investigate cell proliferation and pluripotency, cultures were continued in floating, following formation of aggregates under each condition (only 2 mg/mL BSA, 2 mg/mL BSA with 0.2 μg/mL LPA, or 5 mg/mL BSA with 0.2 ug/mL S1P) (Fig. 6). Day 1 after inoculation, the aggregates of more than 1 mm diameter were formed with only BSA (Fig. 6A), whereas the aggregates of around 100 μm diameter were formed with LPA or S1P (Fig. 6B and 6C). After treatment with LPA or S1P, excess aggregation was not observed until day 5 (Fig. 6E and 6F). As a result of measurement of the glucose concentration, the consumption of glucose in the aggregates formed under the addition of only BSA was saturated after the third day (Fig. 6G). On the other hand, when LPA or S1P was further added, glucose consumption increased continuously for 5 days (Fig. 6G). Since the cell yield under the LPA or S1P condition was higher than the one under the only BSA condition, it showed that cell proliferation was improved by LPA or S1P treatment because the size of aggregates was suitable for proliferation (Fig. 6H).

Fig. 6.

Fig. 6

Fig. 6

Open in a new tab

Cell growth analysis and evaluation of pluripotency of hiPSCs aggregates cultured with lipids. (A–F) Cells (TkDN4-M) were cultured in Essential 8™ medium containing 2 mg/mL BSA without lipids (A, D), with 0.2 μg/mL LPA (B, E) or with 0.2 μg/mL S1P for 2 days (C, F). Morphology of aggregates formed with each condition on day 1 (A, B, C) and day 5 (D, E, F) on a rotary shaker with shaking at 90 rpm. The white scale bar is 200 μm. (G) Calculated glucose consumption of hiPSCs treated with each condition (H) Cell yields on day 5 based on trypan blue staining. (I, J) Relative gene expression analyses of pluripotent markers of aggregates treated with different condition (relative to β-Actin housekeeping gene). (K–R) Flow cytometry analyses of pluripotent markers. Error bars represent standard deviations (three independent experiments). ***P < 0.001. The samples were collected on day 5 of suspension culture (3D) or adhesion culture on vitronectin (2D).

3.3. Expression of pluripotent markers

To confirm the pluripotency of hiPSCs cultured with the lipids, we examined qRT-PCR and FACS from samples of collected cells. qRT-PCR analyses revealed that the cell aggregates formed with LPA or S1P expressed pluripotency genes at the same level or more as compared with hiPSCs cultured under two-dimensional (2D) adhesion condition (Fig. 6I and 6J). Furthermore, FACS analyses revealed that over 90% of the cell population in aggregates formed with LPA or S1P expressed OCT4 or Nanog (Fig. 6M, 6N, 6Q, 6R) as well as 2D culture, whereas, the cell population cultured with only BSA decreased OCT4 positive cells compared with 2D. These results demonstrated that the cell aggregates with the lipids kept the high-expression rates of pluripotent markers, similar to the rates observed for hiPSCs cultured under 2D condition.

3.4. Gene expression of receptors of lysophospholipids in hiPSCs

LPA and S1P are endogenous bioactive lipids which mediate a variety of biological cell responses such as cell proliferation, migration, differentiation, and apoptosis [15]. Their actions are mediated by binding to the G-protein-coupled endothelial differentiation gene (Edg) receptor subfamily, referred to as LPA-receptor 1–6 and S1P-receptor 1–515. Therefore, we analyzed whether the expression of these receptors in hiPSCs. qRT-PCR revealed that all receptors were expressed in hiPSCs (Fig. 7). Expression levels of S1P receptor 2, S1P receptor 4, and LPI receptor were lower than other receptors.

Fig. 7.

Fig. 7

Open in a new tab

Expression analysis of LPA and S1P receptors. qRT-PCR data showed receptor genes of LPA or S1P expressed in the hiPSCs (TkDN4-M) (relative to β-Actin housekeeping gene). Error bars represent standard deviations (three independent experiments).

4. Discussion

In the present study, we demonstrated that lysophosphatidic acid (LPA) and Sphingosine-1-phosphate (S1P), known as lysophospholipids acting as a signaling molecule, suppressed aggregation of hiPSCs in suspension. The regulation of cell aggregation is important for effective proliferation in suspension culture. Actually, huge aggregates were hardly able to grow (Fig. 6D and E) The reason might be an insufficient supply of oxygen, nutrients, and growth factors such basic fibroblast growth factor (bFGF) for the center cells of the aggregates [16], [17]. On the other hand, it is possible that suitable size aggregates tend to promote not only cell growth but also pluripotency, which is supported by our glucose consumption and qRT-PCR analyses (Fig. 6D–G). S1P acts as a factor for the maintenance of human embryonic stem cells in an undifferentiated state via its receptors [18]. In this study, the receptor gene of LPA or S1P expressed in hiPSCs (Fig. 7). Therefore, lysophospholipids signaling may accelerate the pluripotency of hiPSCs aggregates.

Lysophospholipids such as LPA and S1P are known to perform various functions on cells via these receptors which have a potential of G protein-coupled receptor (GPCR) [19]. These GPCRs activate several signaling molecules such as RHO, PI3K, PLC, RAS, and AC (Fig. 8) [19]. LPA and S1P have been reported to be involved in intercellular adhesion and migration in various cells [20], [21]. Addition of LPA to cultures of cancer cells promotes migration while suppressing focal adhesions and adherens junction mediated by RHO/ROCK (Rho-associated kinase) signaling [20], [22]. In adherens junction, E-cadherin is a key component of cell-cell adhesion and plays an important role in the undifferentiated state of iPSCs [23]. Therefore, it is possible that LPA and S1P bind to the receptor, and activate RHO/Rock signaling, and indirectly control cell-cell adhesion of aggregation. On the other hand, the ability of other lysophospholipids (such as LPI and LPC) to suppress cell aggregation was not observed. It predicts the reason why the expression level of the receptors for LPI or LPC was low level (Fig. 7) and RHO was not sufficiently activated by these lysophospholipids in hiPSCs.

Fig. 8.

Fig. 8

Open in a new tab

Schematic image of the possible mechanisms underlying the inhibition of iPS aggregation mediated by LPA or S1P via each receptor on hiPSCs. RHO, Rho GTPase; Rock, Rho-associated kinase; PLC, phospholipase C; RAS, RAS GTPase; PI3K, phosphatidylinositol 3-kinase; AC, adenylyl cyclase.

Controlling the size of aggregates is important not only to maintain the proliferative potential and pluripotency (Fig. 6) [24] but also to induce differentiated cells from hiPSCs effectively for clinical use of cell therapy and regenerative medicine [25], [26], [27], [28], [29], [30]. If the initial aggregates size of embryoid bodies is 150 μm, it is reported that the destiny leads to the mesoderm [28]. Although it is possible to create aggregates with a micro-fabricated microwell by controlling the size on the lab scale, mass culture requires a large area, which is difficult to manufacture cells for regenerative medicine on the commercial scale. It is preferable to use bioreactors already on sales such as Erlenmeyer flask and culture bag on the viewpoint of cost and versatility. In our unpublished study, we have confirmed that it can be grown in suspension culture of hiPSCs using Erlenmeyer flask, culture bags, and spinner flasks conventionally used for floating culture of mammalian cells such as CHO cells. Also, it is ideal for simplifying the manufacturing process that differentiation culture can be operated in the same system as it is.

5. Conclusion

We demonstrated that LPA and S1P prevented aggregation of hiPSCs in suspension culture. The result indicated that hiPSCs aggregate formed with these lipids could proliferate and keep the pluripotency. In conclusion, LPA and S1P regulate the aggregation size of hiPSCs. These lipids would contribute to simplify and generalize the suspension culture of pluripotent stem cells and help to realize regenerative medicine at an early stage.

Conflicts of interest

The authors declare that they have no conflict of interest.

Acknowledgments

This research was supported by the grant from the Centers for Clinical Application Research on Specific Disease/Organ (Type B) of Research Center Network for Realization of Regenerative Medicine of Japan Agency for Medical Research and Development (AMED), Japan.

Footnotes

Peer review under responsibility of the Japanese Society for Regenerative Medicine.

References

  • 1.Jing D., Parikh A., Canty J.M., Tzanakakis E.S., Tzanakakis E.S. Stem cells for heart cell therapies. Tissue Eng B Rev. 2008;14:393–406. doi: 10.1089/ten.teb.2008.0262. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Lock L.T., Tzanakakis E.S. Stem/progenitor cell sources of insulin-producing cells for the treatment of diabetes. Tissue Eng. 2007;13:1399–1412. doi: 10.1089/ten.2007.0047. [DOI] [PubMed] [Google Scholar]
  • 3.Serra M., Brito C., Udia Correia C., Alves P.M. Process engineering of human pluripotent stem cells for clinical application. Trends Biotechnol. 2012;30:350–359. doi: 10.1016/j.tibtech.2012.03.003. [DOI] [PubMed] [Google Scholar]
  • 4.Bauwens C.L., Song H., Thavandiran N., Ungrin M., Massé S., Nanthakumar K. Geometric control of cardiomyogenic induction in human pluripotent stem cells omnipolar EGM technology view project current density imaging view project geometric control of cardiomyogenic induction in human pluripotent stem cells. Tissue Eng Part A. 2011:1901–1909. doi: 10.1089/ten.TEA.2010.0563. [DOI] [PubMed] [Google Scholar]
  • 5.Chen A.K.-L., Chen X., Choo A.B.H., Reuveny S., Oh S.K.W. Critical microcarrier properties affecting the expansion of undifferentiated human embryonic stem cells. Stem Cell Res. 2011;7:97–111. doi: 10.1016/j.scr.2011.04.007. [DOI] [PubMed] [Google Scholar]
  • 6.Nie Y., Bergendahl V., Hei D.J., Jones J.M., Palecek S.P. Scalable culture and cryopreservation of human embryonic stem cells on microcarriers. Biotechnol Prog. 2009;25:20–31. doi: 10.1002/btpr.110. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Kropp C., Massai D., Zweigerdt R. Progress and challenges in large-scale expansion of human pluripotent stem cells. Process Biochem. 2017;59:244–254. [Google Scholar]
  • 8.Olmer R., Lange A., Selzer S., Kasper C., Haverich A., Martin U. Suspension culture of human pluripotent stem cells in controlled, stirred bioreactors. Tissue Eng C Methods. 2012;18:772–784. doi: 10.1089/ten.tec.2011.0717. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Horiguchi I., Sakai Y. Serum replacement with albumin-associated lipids prevents excess aggregation and enhances growth of induced pluripotent stem cells in suspension culture. Biotechnol Prog. 2016;32:1009–1016. doi: 10.1002/btpr.2301. [DOI] [PubMed] [Google Scholar]
  • 10.Gaits F., Fourcade O., Balle F.L., Gueguen G., Gaigé B., Gassama-Diagne A. Lysophosphatidic acid as a phospholipid mediator: pathways of synthesis. FEBS Lett. 1997;410:54–58. doi: 10.1016/s0014-5793(97)00411-0. [DOI] [PubMed] [Google Scholar]
  • 11.Yatomi Y., Ohmori T., Rile G., Kazama F., Okamoto H., Sano T. Sphingosine 1-phosphate as a major bioactive lysophospholipid that is released from platelets and interacts with endothelial cells. Blood. 2000;96:3431–3438. [PubMed] [Google Scholar]
  • 12.Meierhofer T., van den Elsen J.M.H., Cameron P.J., Muñoz-Berbel X., Jenkins A.T.A. The interaction of serum albumin with cholesterol containing lipid vesicles. J Fluoresc. 2010;20:371–376. doi: 10.1007/s10895-009-0522-7. [DOI] [PubMed] [Google Scholar]
  • 13.Brodersen R., Andersen S., Vorum H., Nielsen S.U., Pedersen A.O. Multiple fatty acid binding to albumin in human blood plasma. Eur J Biochem. 1990;189:343–349. doi: 10.1111/j.1432-1033.1990.tb15495.x. [DOI] [PubMed] [Google Scholar]
  • 14.van der Vusse G.J. Albumin as fatty acid transporter. Drug Metab Pharmacokinet. 2009;24:300–307. doi: 10.2133/dmpk.24.300. [DOI] [PubMed] [Google Scholar]
  • 15.Binder B.Y.K., Williams P.A., Silva E.A., Leach J.K. Lysophosphatidic acid and sphingosine-1-phosphate: a concise review of biological function and applications for tissue engineering. Tissue Eng B Rev. 2015;21:531–542. doi: 10.1089/ten.teb.2015.0107. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Okudaira T., Amimoto N., Mizumoto H., Kajiwara T. Formation of three-dimensional hepatic tissue by the bottom-up method using spheroids. J Biosci Bioeng. 2016;122:213–218. doi: 10.1016/j.jbiosc.2015.12.019. [DOI] [PubMed] [Google Scholar]
  • 17.Horiguchi I., Urabe Y., Kimura K., Sakai Y. Effects of glucose, lactate and basic FGF as limiting factors on the expansion of human induced pluripotent stem cells. J Biosci Bioeng. 2018;125:111–115. doi: 10.1016/j.jbiosc.2017.08.004. [DOI] [PubMed] [Google Scholar]
  • 18.Pébay A., Wong R.C.B., Pitson S.M., Wolvetang E.J., Peh G.S.-L., Filipczyk A. Essential roles of sphingosine-1-phosphate and platelet-derived growth factor in the maintenance of human embryonic stem cells. Stem Cell. 2005;23:1541–1548. doi: 10.1634/stemcells.2004-0338. [DOI] [PubMed] [Google Scholar]
  • 19.Riaz A., Huang Y., Johansson S. G-Protein-Coupled lysophosphatidic acid receptors and their regulation of AKT signaling. Int J Mol Sci. 2016;17:215. doi: 10.3390/ijms17020215. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Sawada K., Morishige K., Tahara M., Ikebuchi Y., Kawagishi R., Tasaka K. Lysophosphatidic acid induces focal adhesion assembly through RHO/RHO-associated kinase pathway in human ovarian cancer cells. Gynecol Oncol. 2002;87:252–259. doi: 10.1006/gyno.2002.6831. [DOI] [PubMed] [Google Scholar]
  • 21.Hong G., Baudhuin L.M., Xu Y. Sphingosine-1-phosphate modulates growth and adhesion of ovarian cancer cells. FEBS Lett. 1999;460:513–518. doi: 10.1016/s0014-5793(99)01400-3. [DOI] [PubMed] [Google Scholar]
  • 22.Sahai E., Marshall C.J. ROCK and Dia have opposing effects on adherens junctions downstream of Rho. Nat Cell Biol. 2002;4:408–415. doi: 10.1038/ncb796. [DOI] [PubMed] [Google Scholar]
  • 23.Pieters T., Van Roy F. Role of cell-cell adhesion complexes in embryonic stem cell biology. J Cell Sci. 2014;127:2603–2613. doi: 10.1242/jcs.146720. [DOI] [PubMed] [Google Scholar]
  • 24.Wang Y., Chou B.-K., Dowey S., He C., Gerecht S., Cheng L. Scalable expansion of human induced pluripotent stem cells in the defined xeno-free E8 medium under adherent and suspension culture conditions. Stem Cell Res. 2013;11:1103–1116. doi: 10.1016/j.scr.2013.07.011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Toyoda T., Mae S., Tanaka H., Kondo Y., Funato M., Hosokawa Y. Cell aggregation optimizes the differentiation of human ESCs and iPSCs into pancreatic bud-like progenitor cells. Stem Cell Res. 2015;14:185–197. doi: 10.1016/j.scr.2015.01.007. [DOI] [PubMed] [Google Scholar]
  • 26.Bauwens C.L., Peerani R., Niebruegge S., Woodhouse K.A., Kumacheva E., Husain M. Control of human embryonic stem cell colony and aggregate size heterogeneity influences differentiation trajectories. Stem Cell. 2008;26:2300–2310. doi: 10.1634/stemcells.2008-0183. [DOI] [PubMed] [Google Scholar]
  • 27.Hwang Y.-S., Chung B.G., Ortmann D., Hattori N., Moeller H.-C., Khademhosseini A. Microwell-mediated control of embryoid body size regulates embryonic stem cell fate via differential expression of WNT5a and WNT11. Proc Natl Acad Sci USA. 2009;106:16978–16983. doi: 10.1073/pnas.0905550106. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Cha J.M., Bae H., Sadr N., Manoucheri S., Edalat F., Kim K. Embryoid body size-mediated differential endodermal and mesodermal differentiation using polyethylene glycol (PEG) microwell array. Macromol Res. 2015;23:245–255. [Google Scholar]
  • 29.Yabe S.G., Fukuda S., Takeda F., Nashiro K., Shimoda M., Okochi H. Efficient generation of functional pancreatic β-cells from human induced pluripotent stem cells. J Diabetes. 2017;9:168–179. doi: 10.1111/1753-0407.12400. [DOI] [PubMed] [Google Scholar]
  • 30.Rizki-Safitri A., Shinohara M., Miura Y., Danoy M., Tanaka M., Miyajima A. Efficient functional cyst formation of biliary epithelial cells using microwells for potential bile duct organisation in vitro. Sci Rep. 2018;8:11086. doi: 10.1038/s41598-018-29464-w. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Regenerative Therapy are provided here courtesy of Japanese Society for Regenerative Medicine

RESOURCES