We sequenced the complete coding genome of the western equine encephalitis virus (WEEV) strain Fleming. This strain was originally isolated in 1938 from a human WEEV case.
ABSTRACT
We sequenced the complete coding genome of the western equine encephalitis virus (WEEV) strain Fleming. This strain was originally isolated in 1938 from a human WEEV case.
ANNOUNCEMENT
Western equine encephalitis virus (WEEV), a member of the Alphavirus genus, Togaviridae family, is a single-stranded, positive-sense RNA virus. WEEV clusters within the western equine encephalitis (WEE) antigenic complex, which includes five other virus species, namely, Sindbis, Aura, Fort Morgan, Highlands J, and Whataroa viruses (1, 2). Strains of WEEV are genetically and antigenically homogeneous, with >94% amino acid similarity between the structural glycoproteins.
Maintained through an enzootic transmission cycle between mosquitoes and birds (3), WEEV infects equids and humans naturally through a mosquito bite, and the incubation period is 5 to 10 days (4, 5). Infection with WEEV produces low-level, sporadic viremia in equids and humans, making these species dead-end hosts (6). Disease can progress from a febrile illness to meningismus, weakness, tremors, and altered mental status (<10% of symptomatic patients) (7–9). Juvenile and geriatric populations are more susceptible to severe clinical illness and neurological sequelae, with a 4 to 10% case fatality rate (7). The last recorded human cases of WEEV were in 2009 in Uruguay (10), and virus is rarely detected in mosquito pools (11). A trivalent alphavirus virus-like particle vaccine was recently developed (12) and is undergoing human safety testing. Due to the rarity of WEEV cases, the McMillan strain (GenBank accession number GQ287640) is the only complete human isolate sequence available.
WEEV strain Fleming was isolated from a human case in California in 1938 (13–15). The source material, WEEV Fleming B567 585 suckling mouse pass 5 (SM-5), lyophilized on 11 October 1967, was obtained from Robert Tesh (University of Texas Medical Branch, Galveston, TX). Reconstituted virus was passaged three times in Vero cells cultured in Leibovitz’s L-15 medium plus 10% fetal bovine serum (SM-5, Vero-3; lot number 038). Material shipped to the U.S. Army Medical Research Institute of Infectious Diseases (USAMRIID) was stored at −80°C. RNA was extracted using TRIzol LS reagent and converted to cDNA (16). Briefly, three primers, FR26RV-N (GCCGGAGCTCTGCAGATATCNNNNNN), FR40RV-T (GCCGGAGCTCTGCAGATATCT20), and a template-switching oligonucleotide (TSO), Venter SISPA [GCCGGAGCTCTGCAGATATCGGCCATTATGGCC(Ribo-GGG)], were used in combination with reverse transcriptase with terminal transferase activity (Maxima H minus) to convert the entire genomic RNA to cDNA, including the 5′ and 3′ ends. Purified cDNA was amplified by sequence-independent single primer amplification (SISPA) (17, 18) with MyTaq DNA polymerase using primer FR20RV (GCCGGAGCTCTGCAGATATC). Purified PCR products were fragmented on a Covaris LE220 ultrasonicator. Libraries were prepared with the TruSeq DNA sample preparation kit. After quantification by real-time PCR with the KAPA library quantification kit, libraries diluted to 10 nM were sequenced on an Illumina MiSeq instrument with a 200-bp paired-end protocol.
Sequence reads were quality filtered with PRINSEQ lite v0.20.4 (19) and SISPA. Illumina adapter sequences were removed with Cutadapt v1.7 (20). A subset of the filtered sequence reads (∼150,000) was assembled with Lasergene SeqMan NGen v15 to an average sequence depth of 1,268×.
Final assembly resulted in a genome length of 11,521 nucleotides with a GC content of 49%. It was determined to be complete by detection of a TSO sequence at the 5′ end and poly(A) tail at the 3′ end.
The complete genome sequence of WEEV strain Fleming shared 99% base identity with the McMillan strain (GenBank accession number GQ287640) isolated in Canada in 1941 from a human brain sample.
Data availability.
The GenBank accession number for WEEV strain Fleming is MN477208. Raw sequencing reads have been deposited in the NCBI SRA under BioProject accession number PRJNA579577.
ACKNOWLEDGMENTS
This work was funded in part by the Medical Countermeasure Systems-Joint Vaccine Acquisition Program under work plan B.07.
We thank Robert Tesh of the University of Texas Medical Branch in Galveston, TX, for providing the lyophilized WEEV Fleming B567 585 suckling mouse pass 5 material.
The views expressed in this article are those of the authors and do not necessarily reflect the official policy or position, expressed or implied, of the U.S. Army, the U.S. Department of Defense, or the institutions with which the authors are affiliated.
REFERENCES
- 1.International Committee on Taxonomy of Viruses. 2012. Virus taxonomy: classification and nomenclature of viruses; ninth report of the International Committee on Taxonomy of Viruses. Elsevier Academic Press, San Diego, CA. [Google Scholar]
- 2.Griffin D. 2007. Alphaviruses, p 1023–1068. In Knipe DM, Howley PM (ed), Fields virology, vol 1 Lippincott Williams & Wilkins, Philadelphia, PA. [Google Scholar]
- 3.Jennings WL, Allen RH, Lewis AL. 1966. Western equine encephalomyelitis in a Florida horse. Am J Trop Med Hyg 15:96–97. doi: 10.4269/ajtmh.1966.15.96. [DOI] [PubMed] [Google Scholar]
- 4.Hayes RO. 1981. Eastern and western encephalitis, p 29–57. In Beran GW. (ed), Handbook series in zoonoses: viral zoonoses, vol 1 CRC Press, Boca Raton, FL. [Google Scholar]
- 5.Reeves WC, Hammon WM, Longshore WA Jr., Mc CH, Geib AF. 1962. Epidemiology of the arthropod-borne viral encephalitides in Kern County, California, 1943–1952. Publ Public Health Univ Calif 4:1–257. [PubMed] [Google Scholar]
- 6.Reisen W, Monath T. 1988. The arboviruses: epidemiology and ecology. CRC Press, Boca Raton, FL. [Google Scholar]
- 7.Bennett JE, Dolin R, Blaser MJ. 2015. Mandell, Douglas, and Bennett’s principles and practice of infectious diseases, 8th ed Saunders, Philadelphia, PA. [Google Scholar]
- 8.Mossel EC, Ledermann JP, Phillips AT, Borland EM, Powers AM, Olson KE. 2013. Molecular determinants of mouse neurovirulence and mosquito infection for Western equine encephalitis virus. PLoS One 8:e60427. doi: 10.1371/journal.pone.0060427. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Nagata LP, Hu WG, Parker M, Chau D, Rayner GA, Schmaltz FL, Wong JP. 2006. Infectivity variation and genetic diversity among strains of Western equine encephalitis virus. J Gen Virol 87:2353–2361. doi: 10.1099/vir.0.81815-0. [DOI] [PubMed] [Google Scholar]
- 10.Delfraro A, Burgueno A, Morel N, Gonzalez G, Garcia A, Morelli J, Perez W, Chiparelli H, Arbiza J. 2011. Fatal human case of Western equine encephalitis, Uruguay. Emerg Infect Dis 17:952–954. doi: 10.3201/eid1705.101068. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Robb LL, Hartman DA, Rice L, deMaria J, Bergren NA, Borland EM, Kading RC. 2019. Continued evidence of decline in the enzootic activity of western equine encephalitis virus in Colorado. J Med Entomol 56:584–588. doi: 10.1093/jme/tjy214. [DOI] [PubMed] [Google Scholar]
- 12.Ko SY, Akahata W, Yang ES, Kong WP, Burke CW, Honnold SP, Nichols DK, Huang YS, Schieber GL, Carlton K, DaSilva L, Traina-Dorge V, Vanlandingham DL, Tsybovsky Y, Stephens T, Baxa U, Higgs S, Roy CJ, Glass PJ, Mascola JR, Nabel GJ, Rao SS. 2019. A virus-like particle vaccine prevents equine encephalitis virus infection in nonhuman primates. Sci Transl Med 11:eaav3113. doi: 10.1126/scitranslmed.aav3113. [DOI] [PubMed] [Google Scholar]
- 13.Hardy JL. 1987. The ecology of western equine encephalomyelitis virus in the Central Valley of California, 1945–1985. Am J Trop Med Hyg 37:18S–32S. doi: 10.4269/ajtmh.1987.37.18s. [DOI] [PubMed] [Google Scholar]
- 14.Hardy JL, Presser SB, Chiles RE, Reeves WC. 1997. Mouse and baby chicken virulence of enzootic strains of western equine encephalomyelitis virus from California. Am J Trop Med Hyg 57:240–244. doi: 10.4269/ajtmh.1997.57.240. [DOI] [PubMed] [Google Scholar]
- 15.Calisher CH, Karabatsos N, Lazuick JS, Monath TP, Wolff KL. 1988. Reevaluation of the western equine encephalitis antigenic complex of alphaviruses (family Togaviridae) as determined by neutralization tests. Am J Trop Med Hyg 38:447–452. doi: 10.4269/ajtmh.1988.38.447. [DOI] [PubMed] [Google Scholar]
- 16.Leguia M, Loyola S, Rios J, Juarez D, Guevara C, Silva M, Prieto K, Wiley M, Kasper MR, Palacios G, Bausch DG. 2015. Full genomic characterization of a Saffold virus isolated in Peru. Pathogens 4:816–825. doi: 10.3390/pathogens4040816. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Djikeng A, Halpin R, Kuzmickas R, Depasse J, Feldblyum J, Sengamalay N, Afonso C, Zhang X, Anderson NG, Ghedin E, Spiro DJ. 2008. Viral genome sequencing by random priming methods. BMC Genomics 9:5. doi: 10.1186/1471-2164-9-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Reyes GR, Kim JP. 1991. Sequence-independent, single-primer amplification (SISPA) of complex DNA populations. Mol Cell Probes 5:473–481. doi: 10.1016/s0890-8508(05)80020-9. [DOI] [PubMed] [Google Scholar]
- 19.Schmieder R, Edwards R. 2011. Quality control and preprocessing of metagenomic datasets. Bioinformatics 27:863–864. doi: 10.1093/bioinformatics/btr026. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Martin M. 2011. Cutadapt removes adapter sequences from high-throughput sequencing reads. EMBnet J 17:10–12. doi: 10.14806/ej.17.1.200. [DOI] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
The GenBank accession number for WEEV strain Fleming is MN477208. Raw sequencing reads have been deposited in the NCBI SRA under BioProject accession number PRJNA579577.