Abstract
Bacterial contamination of fermented foods is a serious global food safety challenge that requires effective control strategies. This study characterized presumptive E. coli isolated from Obushera, a traditional fermented cereal beverage from Uganda. Thereafter, the antimicrobial effect of lactic acid bacteria (LAB) previously isolated from Obushera, against the E. coli, was examined. The presumptive E. coli was incubated in brain heart infusion broth (pH = 3.6) at 25°C for 48 h. The most acid-stable strains were clustered using (GTG)5 rep-PCR fingerprinting and identified using 16S rRNA sequencing. E. coli was screened for Shiga toxins (Stx 1 and Stx 2) and Intimin (eae) virulence genes as well as antibiotic resistance. The spot-on-the-lawn method was used to evaluate antimicrobial activity. Eighteen isolates were acid stable and are identified as E. coli, Shigella, and Lysinibacillus. The Stx 2 gene and antibiotic resistance were detected in some E. coli isolates. The LAB were antagonistic against the E. coli. Lactic acid bacteria from traditional fermented foods can be applied in food processing to inhibit pathogens. Obushera lactic acid bacteria could be used to improve the safety of fermented foods.
1. Introduction
There is an increased consumption of fermented cereal-based foods such as Obushera [1]. Obushera is a traditionally fermented sorghum and/or millet beverage from Uganda. Traditionally, the beverage is spontaneously fermented predominantly by lactic acid bacteria (LAB) [2]. However, given the challenges of spontaneous fermentations, pure starters like Lactobacillus (Lb.) plantarum MNC 21, Lactococcus (L.) lactis MNC 24, and Weisella (W.) confusa MNC 20 were developed [2, 3]. These starters are rapid and excellent lactic acid producers that can lower the pH to <4.5 in just 12 h of fermentation. The resultant lactic acid produced in such fermentations can inhibit pathogens [4, 5]. In fact, rapid product acidification (pH ≤ 4.0) in lactic-fermented products is recommended since it is very inhibitory to pathogens [6]. However, it appears that some foodborne pathogens are very acid tolerant. Recently, Byakika et al. [1] reported the presence of presumptive E. coli in Obushera (pH ≤ 4.0 and titratable acidity = 0.1–3.1%). Indeed, several reports of undesirable microorganisms in various acidic foods exist [7–11]. This is of great concern because the tolerance to acid stress by pathogens aggravates their virulence [12, 13].
Outbreaks involving acidic foods have increased the attention given to the acid tolerance properties of pathogens [14]. Bacteria may acquire acid tolerance by horizontal gene transfer [15]. Upon exposure to low pH, they use an acid-induced tolerance response (ATR) to survive [16, 17]. The ATR is a phenomenon where microorganisms show increased resistance to acid stress following the exposure to mildly acidic environments [18, 19]. So, for adequate pathogen inhibition, high LAB counts are needed to rapidly lower the pH below 4 [20–22]. Given the increasing demand for safe foods, cultures that are inhibitory to foodborne pathogens are inevitable, more so, since the successful use of antibiotics in the treatment of foodborne illnesses is no longer guaranteed. This is due to overuse and misuse of antibiotics which have created resistance among pathogens [23]. Therefore, this study evaluated the antimicrobial effect of Lb. plantarum MNC 21, L. lactis MNC 24, W. confusa MNC 20, and Lb. rhamnosus yoba 2012 against acid-resistant, antibiotic-resistant and potentially pathogenic E. coli isolated from Obushera.
2. Materials and Methods
2.1. Materials
2.1.1. Lactic Acid Bacteria
Lb. plantarum MNC 21 (Gene bank accession number: JF512470), L. lactis MNC 24 (Gene bank accession number: JF512471), and W. confusa MNC 20 (Gene bank accession number: JQ754455) were isolated from Obushera [2]. Lb. rhamnosus yoba 2012 (originally named Lb. rhamnosus GG) (Yoba for Life Foundation Amsterdam, the Netherlands) was obtained from the Uganda Industrial Research Institute (IURI), Kampala, Uganda. Stock cultures were stored at −20°C in Ringer's solution containing 15% glycerol. The LAB strains were independently propagated according to the procedure described by Mukisa et al. [3]. Briefly, from the stock cultures, 0.1 mL of each strain was separately delivered into 100 mL of sterile MRS broth (Laboratorios CONDA, Madrid, Spain) and incubated anaerobically at 30°C for 24 h. The cells were washed and recovered by centrifugation (7,500 ×g for 10 min). The cell pellets were suspended in 100 mL of sterile Ringer's solution (Oxoid Ltd, Basingstoke, Hampshire, England).
2.1.2. E. coli
Presumptive E. coli (n = 32) previously isolated from Obushera by Byakika et al. [1] was used. From the stock cultures, 0.1 mL was separately inoculated in 100 mL of sterile brain heart infusion (BHI) broth (Laboratorios CONDA, Madrid, Spain) and incubated at 30°C for 24 h. The cells were washed and recovered by centrifugation (7,500 ×g for 10 min). The cell pellets were suspended in 10 mL of sterile Ringer's solution (Oxoid Ltd., Basingstoke, Hampshire, England).
2.2. Biochemical Characterization
The isolates were characterized by Gram staining, catalase, oxidase, and indole tests using standard methods.
2.3. Acid Tolerance
The acid tolerance of the presumptive E. coli isolates was determined by adding each cell suspension to 10 mL of lactate acidified BHI broth (pH = 3.6, titratable acidity = 1.5%) to give a final cell concentration of about 107 cfu/mL. The broth was incubated at 25°C. The cells were enumerated at intervals of 0, 24, and 48 h. E. coli was enumerated by pour plating using E. coli-coliforms chromogenic agar (Laboratorios CONDA, Madrid, Spain) and incubating at 37°C for 24 h. Only isolates that survived the acidified broth for up to 48 h were used for further analyses.
2.4. DNA Extraction, PCR, and Sequencing
Genomic DNA of the pure presumptive acid-tolerant E. coli isolates was extracted from pure colonies using the GenElute bacterial genomic DNA kit (Sigma-Aldrich, St. Louis, Missouri, USA) following manufacturer's instructions. The extracted DNA was used for (1) (GTG)5-Rep-PCR, (2) detection of virulence genes, and (3) 16S rRNA sequencing.
For the (GTG)5-Rep-PCR, the protocol was carried out following the manufacturer's instructions. The 25 μL reaction consisted of 12.5 μL 1x master mix with standard buffer (New England Biolabs Inc., MA, U.S.A), 0.2 μM (GTG)5 primer (5′GTGGTGGTGGTGGTG3′) supplied by Macrogen, Inc., Seoul, South Korea, 2 μL DNA template, and sterile nuclease-free water. The amplification conditions were as follows: initial denaturation at 95°C for 10 min, 35 cycles of 95°C for 30 s, 40°C for 1 min, 65°C for 3 min, and a final elongation step at 65°C for 8 min. The amplified DNA products were analyzed by electrophoresis in a 2% agarose gel (Sigma-Aldrich, St. Louis, Missouri, USA). The gel was visualized by a UV transilluminator (Syngene G: Box gel documentation system, Fredrick, MD, USA). To generate the dendrogram, TIFF image analysis was carried out using GelJ version 1.0 software [24]. Similarities were calculated using the DICE correlation coefficient and the unweighted pair group method with arithmetic mean (UPGMA). Based on results from the dendrogram, representative strains were selected from each group that indicated similarity in the banding patterns.
Amplification of the 16S rRNA gene was carried out as described by Mukisa et al. [2]. Universal primers 1F (5′GAGTTTGATCCTGGCTCAG3′) and 5R/1492R (5′ GGTTACCTTGTTACGACTT 3′) supplied by Macrogen, Inc., Seoul, South Korea, were used. The PCR was set up in a total volume of 50 μL comprising of 0.2 μM of each primer, 25 μL 1x master mix with standard buffer (New England Biolabs Inc., MA, U.S.A), 4 μL DNA, and sterile nuclease-free water. The initial denaturation step was performed at 94°C for 3 min, followed by 30 cycles of denaturation (94°C, 30 s), annealing (55°C, 30 s), extension (72°C, 3 min), and final extension (72°C, 10 min). The extracted DNA was purified using a QIAquick PCR purification kit (Qiagen, Hilden, Germany) following the manufacturer's instructions. The pure DNA was sequenced with the same primers, using the BigDye® Terminator v3.1 Cycle sequencing kit (Applied Biosystems) and ABI 3730xl DNA analyzer (Applied Biosystems). Sequencing was performed by Macrogen Europe, Amsterdam, the Netherlands, and the identification was done by performing a nucleotide sequence database search at National Centre for Biotechnology Information (NCBI) using the Basic Local Alignment Search Tool (BLAST) program.
The DNA of the presumptive E. coli isolates was screened for presence of virulence genes: Shigatoxin I (Stx 1), Shigatoxin 2 (Stx 2), and intimin (eae). The 50 μL reaction consisted of 25 μL, 1X master mix with standard buffer (New England Biolabs Inc, MA, U.S.A.), 0.2 μM each of forward and reverse virulence gene primers, 4 μL DNA template, and sterile nuclease-free water. Table 1 shows the primers and PCR conditions used.
Table 1.
Primers and PCR conditions used for detection of virulence genes in E. coli isolated from Obushera.
| Gene | Primers | PCR conditions | Base pairs | References |
|---|---|---|---|---|
| stx 1 | 5′CTTCGGTATCCTATTCCCGG3′ 3′GGATGCATCTCTGGTCATTG5′ |
30 cycles (94°C, 30 s; 56°C, 30 s; 72°C, 30 s) | 448 | [25] |
| stx 2 | 5′CCATGACAACGGACAGCAGTT3′ 3′CCTGTCAACTGAGCAGCACTTTG5′ |
30 cycles (94°C, 30 s; 56°C, 30 s; 72°C, 30 s) | 779 | [25] |
| eae | 5′GTGGCGAATACTGGCGAGACT3′ 3′CCCCATTCTTTTTCACCGTCG5′ |
30 cycles (94°C, 30 s; 55°C, 30 s; 72°C, 1 min) | 891 | [26] |
2.5. Antibiotic Resistance
The susceptibility of the confirmed E. coli isolates to thirteen antibiotics was examined according to the Kirby–Bauer disk diffusion method [27]. The antibiotics were obtained from Bioanalyse (Ankara, Turkey) and included ampicillin (10 μg), amoxicillin (25 μg), amoxicillin-clavulanic acid (30 μg), cephalexin (30 μg), ceftriaxone (30 μg), gentamicin (10 μg), kanamycin (30 μg), tetracycline (30 μg), chloramphenicol (30 μg), ciprofloxacin (5 μg), levofloxacin (15 μg), trimethoprim-sulphamethoxazole (25 μg), and nitrofurantoin (300 μg). For the test, fresh culture suspensions were standardised to 0.5 McFarland (equivalent to 8 log cfu/mL). Using sterile cotton swabs, sterile prepoured plate count agar (PCA) (Laboratorios CONDA, Madrid, Spain) plates were swabbed with standardised culture suspensions and incubated at 37°C for 1 h. Antibiotic discs were then placed on the agar surface and incubated at 37°C for 24 h. The diameter of the inhibition zone was measured in mm (Figure 1). Isolates were categorized as resistant, intermediate, or susceptible according to the guidelines of the Clinical and Laboratory Standard Institute [27]. The multiple antibiotic resistance (MAR) index was computed as a/b, where a is the number of antibiotics the isolate was resistant to and b is the total number of antibiotics to which the isolate was exposed [28].
Figure 1.

Measurement of the inhibition zone diameter to determine antibiotic susceptibility/resistance using the Kirby–Bauer disk diffusion method. Image showing inhibition zones of ceftriaxone (30 μg) against E. coli BMC 4.
2.6. Antimicrobial Activity
The antimicrobial activity of the LAB starters against E. coli was tested using the spot-on-the lawn method as described by Byaruhanga et al. [29] with a few modifications. Briefly, sterile prepoured plate count agar (Laboratorios CONDA, Madrid, Spain) plates were spotted with 10μL of 6 log cfu/mL of each LAB and incubated at 30°C for 24 h. About 10 mL of molten PCA (45°C) seeded with 4 log cfu/mL of E. coli was used as the overlay medium and incubated at 30°C for 24 h. The level of inhibition was determined by measuring the diameter (mm) of zone of clearing around the producer colonies (Figure 2).
Figure 2.

Measurement of inhibition zone diameter to determine antimicrobial activity using the spot-on-the lawn method. Image showing the inhibition zone of Lb. plantarum MNC 21 (colony in the center) against E. coli BMC 4.
2.7. Statistical Analyses
The data were analyzed using one-way Analysis of variance (ANOVA) to test for significant differences (p < 0.05) among treatments. Mean comparisons were done using the least significant difference (LSD). The statistical analyses were done using XLSTAT software (version 2010.5.02, Addinsoft, France).
3. Results and Discussion
3.1. Biochemical Characterization of Presumptive E. coli Isolates
Results showed that all the presumptive isolates were Gram negative, indole positive, catalase positive, and oxidase negative which were typical of E. coli [30].
3.2. Acid-Tolerant Strains
Figure 3 shows the counts of presumptive E. coli counts in BHI broth (pH = 3.6, T.A = 1.5%) at 0 and 48 h. The average initial cell count was 7.6 log cfu/mL. At 48 h, counts ranged between 0 and 2.5 log cfu/mL with only 18 out of 32 still detectable.
Figure 3.
Changes in counts of presumptive E. coli between 0 and 48 h of incubation in acidified brain heart infusion broth.
At pH = 3.6, the main inhibitory component in the BHI broth was lactic acid (titratable acidity = 1.5%). Acid levels in some foods could exceed 1% (w/v) in some foods resulting in an ultimate pH of 3.5–4.5 [31, 32]. According to Raybaudi-Massilia et al. [4] and Davidson [33], organic acids inhibit pathogens by entering into cells in an undissociated form and dissociating within the cytoplasm. This lowers the intracellular pH, and to maintain balance, the cell uses ATP to expel the excess hydrogen ions. This exhausts the cell of energy required for growth and other metabolic processes resulting in death. To counteract this, some pathogens employ ATR to survive acid stress. This acid adaptation involves initial sublethal acid shock resulting in changes in gene expression. There is upregulation of numerous rescue proteins: F0F1-ATPase, glutamic acid decarboxylase, groEL, groES, and σ factors all of which shield the pathogens from the lethal effects of the acid [34–36]. Several authors have implicated ATR in the facilitation of pathogen virulence [36–38]. Leyer et al. [8] noted the acid tolerance of E. coli O157 : H7 as a key factor in its virulence because it protected the cells from the lethal effects of gastric acid. In another study, Gorden and Small [39] observed more acid tolerance among enteroinvasive and enteropathogenic E. coli than in the nonpathogenic strains. Acid adaptation is not only problematic in facilitating virulence but also induces cross-protection against other environmental stresses such as heat and salt that may be encountered in food processing [40, 41]. Shen et al. [42] noted that acid adaptation reduced the susceptibility of Salmonella Typhimurium to low temperature and other detrimental factors in lactic-fermented milk products.
In this study, the presumptive E. coli was isolated from Obushera (pH = 3.2–5.6; T.A = 0.1–3.1%) Byakika et al. [1] showed acid tolerance but to varying extents (Figure 3). It is postulated that some of the isolates could have employed the ATR to survive in the acidified beverage. The ATR could have been triggered during fermentation of the beverage because substrate acidification is a gradual process that could facilitate adaptation. In contrast, inoculation in BHI broth (pH = 3.6, T.A = 1.5%) without prior exposure to mild acid conditions could explain the rapid inhibition of some isolates (Figure 3). Therefore, it is possible that isolates that survived for 48 h in BHI broth had high acid tolerance. There are several reports supporting the survival and adaptation of food pathogens such as E. coli, Staphylococcus aureus, Listeria monocytogenes, and Salmonella spp. to acidic environments [8, 14, 43–45]. In fact, outbreaks of diseases by E. coli O157 : H7 and Salmonella enterica in apple cider and orange juice (pH = 3.5 to 4.0) have been reported [9, 10]. This suggests that there is no guarantee for pathogens to be inhibited at stressful acid conditions. Therefore, the ability of lactic acid to induce the ATR in pathogens should be considered by food processors and other mechanisms put in place to prevent the growth of acid-resistant pathogens in acidified foods.
3.3. (GTG)5 Rep-PCR Genetic Fingerprinting and Identification
Based on their banding patterns, the different presumptive E. coli isolates were clustered based on 70% similarity as shown in Figure 4. Results from the 16S rRNA sequencing (Table 2) showed that three of the representative isolates from cluster analysis were closest relatives of E. coli (%ID = 97–98%, Evalue = 0.0). The rest were closest relatives of Shigella sonnei, Shigella flexneri, or Lysinibacillus macroides (%ID = 97–98%, E value = 0.0).
Figure 4.
Cluster analysis of (GTG)5-Rep-PCR fingerprints of presumptive E. coli isolates. Dotted line shows clusters of isolates that showed 70% similarity which was the threshold for closely related isolates.
Table 2.
Identities of presumptive E. coli isolates based on 16S rRNA sequencing.
| Presumptive identity | Code | Closest relatives | Identity score, % sequence similaritya | E value |
|---|---|---|---|---|
| BMC∗ | ||||
| Escherichia coli | 4, 8, 19 | Escherichia coli | 97-98 | 0.0 |
| 25 | Shigella sonnei, Shigella flexneri | 97 | 0.0 | |
| 30 | Shigella flexneri | 97 | 0.0 | |
| 31 | Lysinibacillus macroides | 98 | 0.0 |
aPercent similarity with related sequences from the NCBI database. ∗Numerical code for a specific isolate.
Repetitive extragenic palindromic (rep)-PCR has previously been shown to have high discriminatory power for E. coli strains of diverse origins [46, 47]. (GTG)5 Rep-PCR in particular is widely used as a high throughput genotyping tool for E. coli because the amplification of DNA sequences flanked between the polynucleotide (GTG)5 repetitive sequences generates typical DNA fingerprints for discriminating [48, 49]. Presumptive E. coli isolates were efficiently discriminated by (GTG)5-rep-PCR fingerprinting as shown in Figure 4. This means that E. coli isolates studied were from different sources and possess genetic variations and hence could express differences in virulence.
Some of the isolates with E. coli characteristic appearance on E. coli-Coliforms chromogenic agar were actually Shigella spp. (Table 2). In similarity with E. coli, some Shigella spp. have β-D glucuronidase which cleaves X-glucuronide in the chromogenic mixture of the agar resulting in the formation of blue colonies [50]. Like Shigella, Lysinibacillus macroides may also produce β-D glucuronidase enzyme, characteristic to E. coli. Shigella is known to cause Shigellosis, an acute invasive enteric infection clinically manifested by bloody diarrhea [51]. It is an endemic infection in many developing countries and is associated with considerable morbidity and mortality. For instance, between December 1999 and March 2000, about 4,000 cases of bloody diarrhea due to Shigella dysenteriae serotype 1 were reported in Kenama, Sierra Leone [52]. Although it is expected that lactic acid and other antimicrobial compounds in fermented foods can inhibit pathogens, Shigella has the potential of developing protective mechanisms towards acidic environments [53]. In contrary, Lysinibacillus spp. are pervasive bacteria rarely associated with human disease and merely regarded as environmental contaminants [54]. Nonetheless, some species such as Lysinibacillus sphaericus are reported to cause bacteremia in immune-compromised persons. For instance, the organism caused bacteremia in children with cancer and those undergoing bone marrow transplants in Italy [54]. Therefore, like E. coli, the presence of acid-resistant Shigella spp. and Lysinibacillus spp. in Obushera is a serious food safety concern and may indicate the survival of other potential pathogens in similar fermented cereal-based beverages.
3.4. Virulence Genes in E. coli
The Stx 2 gene was detected in E. coli BMC 4 and E. coli BMC 8, whereas none of the three genes considered in this study (Stx 1, Stx 2, and eae) were detected in E. coli BMC 19.
E. coli is among the most important causes of foodborne illness worldwide [55, 56]. Different virulent genes exist and are crucial for the pathogenicity of any bacterium. Among other serotypes of E. coli, the Shiga toxin producing E. coli (STEC) is the most important cause of foodborne diseases [57]. Shiga toxin producing E. coli (STEC) harbor many types of virulent factors particularly Shiga toxins (Stx 1 and Stx 2), intimin (eae), and hemolysin (hlyA). These genes are responsible for settlement, adhesion, and invasion of the gastrointestinal mucosa by STEC [55, 56]. The toxins encoded by these genes inhibit protein synthesis and cause cell apoptosis [58]. They are also responsible for endothelial damage by causing cell swelling and separation from the basal membrane, fibrin, and thrombi. This narrows the capillary lumen and reduces blood flow to the glomeruli, resulting in renal failure [59]. In effect, STEC is responsible for diarrhea, hemolytic uremic syndrome, and hemorrhagic colitis [60]. The presence of virulence genes in our isolates agrees with other authors' results who reported similar genes in microorganisms isolated from acidic foods [23, 61, 62].
Byakika et al. [1] attributed the occurrence of E. coli and other undesirable microorganisms in Obushera to poor production hygiene. In addition to poor production hygiene, most of the Obushera processors do not pasteurize their product after fermentation. The raw materials, food processors, and packaging materials were also reported as possible sources of the contamination.
3.5. Antibiotic Susceptibility
Table 3 shows the number of E. coli that were susceptible, intermediately susceptible, and resistant to the different antibiotics. Two of the three isolates were resistant to ampicillin, amoxicillin, gentamicin, and trimethoprim-sulphamethoxazole. Only one of the isolates was resistant to ceftriaxone and tetracycline.
Table 3.
Prevalence of antibiotic susceptibility among E. coli (n = 3) isolated from Obushera.
| Antibiotic | Susceptible | Intermediate | Resistant |
|---|---|---|---|
| Ampicillin (Amp) 10 μg | 1 | 2 | |
| Amoxicillin (Ax) 25 μg | 1 | 2 | |
| Amoxicillin-clavulanic acid (Amc) 30 μg | 3 | ||
| Cephalexin (Cl) 30 μg | 3 | ||
| Ceftriaxone (Cro) 30 μg | 2 | 1 | |
| Gentamicin (Cn) 10 μg | 1 | 2 | |
| Kanamycin (K) 30 μg | 1 | 2 | |
| Tetracycline (Te) 30 μg | 2 | 1 | |
| Chloramphenicol (C) 30 μg | 3 | ||
| Ciprofloxacin (Cip) 5 μg | 3 | ||
| Levofloxacin (Lev) 15 μg | 3 | ||
| Trimethoprim-sulphamethoxazole (Stx) 25 μg | 1 | 2 | |
| Nitrofurantoin (F) 300 μg | 3 |
Table 4 shows the antibiotic resistant profiles and multiple antibiotic resistance (MAR) indices of the isolates, respectively. The MAR index for E. coli BMC 4, E. coli BMC 8, and E. coli BMC 19 was 0.00, 0.46, and 0.23, respectively.
Table 4.
Antibiotic resistance profiles and multiple antibiotic resistance (MAR) indices of E. coli isolated from Obushera.
| Isolate | Antibiotic resistant profile | Number of antibiotics | MAR index |
|---|---|---|---|
| E. coli BMC 4 | — | — | 0.00 |
| E. coli BMC 8 | AxAmCnCroStxTe | 6 | 0.46 |
| E. coli BMC 19 | AmCnStx | 3 | 0.23 |
Am: ampicillin 10 μg; Ax: amoxicillin 25 μg; Cro: ceftriaxone 30 μg; Cn: gentamicin 10 μg; Te: tetracycline 30 μg; Stx: trimethoprim-sulphamethoxazole 25 μg. A total of 13 antibiotics were tested.
O'Bryan et al. [63] reported that bacteria may possess innate resistance to antibiotics or may acquire it from other microorganisms. The acquisition of the resistance results from chromosomal mutation or gene transfer from one organism to another by plasmids. Bacterial pathogens can also employ biochemical types of resistance such as antibiotic inactivation, target modification, or removal of the antibiotic from the cell by efflux pumps. Antibiotic resistance is a serious global concern because a resistant infection can spread from one person to many others [64]. Antibiotic resistance genes can also be transferred between bacteria in the food chain. Walsh and Duffy [65] reported the transfer of ampicillin resistance genes from Salmonella typhimurium to Salmonella agona and E. coli K12 in pasteurized milk and minced beef.
The resistance of our isolates to the different antibiotics is in agreement with findings of other authors [23, 56, 66–71]. The occurrence of MAR among foodborne pathogens (Table 4) has also been previously documented [65, 69]. Illnesses associated with MAR microorganisms are challenging to treat [65]. The MAR index of E. coli BMC 8 was much greater than 0.2 possibly indicating that it originated from a high risk source of contamination where antibiotics are often used [72]. The resistance of E. coli BMC 8 to a number of human-based antibiotics (Table 2) implies that it was of anthropogenic origin. The link between human-based antibiotic resistance of foodborne pathogens and transmission by food handlers was previously suggested [23, 56, 67, 70]. This suggests that the processors may be involved in the cross-contamination of Obushera with antibiotic-resistant E. coli.
3.6. Antimicrobial Activity
The extent of inhibition of E. coli by LAB is shown in Figure 5. All the E. coli were inhibited (inhibition zone diameter > 11 mm), but there was no specific trend observed. Lb. plantarum MNC 21 and Lb. rhamnosus yoba 2012 had the highest (24.5 mm) and lowest (16.8 mm) inhibition (p < 0.05) against E. coli BMC 4, respectively. In the same context, L. lactis MNC 24 exhibited the highest inhibition (24.8 mm) against E. coli BMC 8.
Figure 5.

E. coli inhibition by lactic acid bacteria. Error bars show standard deviations of four independent determinations.
The use of LAB to inhibit food pathogens has been previously reported [73]. Lactic acid produced by LAB is the major organic compound in pathogen inhibition [4, 33]. Lb. plantarum MNC 21, W. confusa MNC 20, and L. lactis MNC 24 are fast and high lactic acid producers [2, 3]. Therefore, their ability to inhibit E. coli (Figure 5) is primarily attributed to the lactic acid. It is known that organic acids are most effective when in high levels, so for sufficient pathogen inhibition, large numbers of LAB are required [31, 74]. Previous studies have shown that pathogens do not survive well in prefermented foods in which LAB exist in large numbers (log 6-7) and pH ≤ 4 [21, 75]. In contrast, the same inhibitory effect may be jeopardized where LAB and pathogens are introduced in the food simultaneously [31, 76]. Therefore, the antimicrobial effect of acid fermentations should be seen as an adjunct to good hygiene practices rather than a substitute [31].
The objective of this study was to evaluate the antimicrobial effect of Lb. plantarum MNC 21, L. lactis MNC 24, W. confusa MNC 20, and Lb. rhamnosus yoba 2012 against acid-resistant, antibiotic-resistant, and potentially pathogenic E. coli isolated from Obushera. Findings indicated that the LAB starter cultures can inhibit growth of E. coli implying that they can be used to improve the safety of Obushera and other cereal-based beverages. The findings of this study should be validated by conducting food-based matrix studies. Further research should also explore the inhibitory effect of the LAB as co-cultures.
Acknowledgments
This research was funded by Mr. Samuel K. Byakika. The authors acknowledge the technical help provided by Mr. Johnson Francis Mayega of the Department of Environmental Management, Makerere University, and Mr. Male Allan Ssekamatte of the Breeding, Plant Pathology and Biotechnology Unit, International Centre for Tropical Agriculture (CIAT).
Data Availability
The data used to support the findings of this study are included within the article.
Conflicts of Interest
The authors declare that they have no conflicts of interest regarding the publication of this article.
References
- 1.Byakika S., Mukisa I. M., Byaruhanga Y. B., Male D., Muyanja C. Influence of food safety knowledge, attitudes and practices of processors on microbiological quality of commercially produced traditional fermented cereal beverages, a case of Obushera in Kampala. Food Control. 2019;100:212–219. doi: 10.1016/j.foodcont.2019.01.024. [DOI] [Google Scholar]
- 2.Mukisa I. M., Porcellato D., Byaruhanga Y. B., et al. The dominant microbial community associated with fermentation of Obushera (sorghum and millet beverages) determined by culture-dependent and culture-independent methods. International Journal of Food Microbiology. 2012;160(1):1–10. doi: 10.1016/j.ijfoodmicro.2012.09.023. [DOI] [PubMed] [Google Scholar]
- 3.Mukisa I. M., Ntaate D., Byakika S. Application of starter cultures in the production of Enturire—a traditional sorghum-based alcoholic beverage. Food Science & Nutrition. 2017;5(3):609–616. doi: 10.1002/fsn3.438. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Raybaudi-Massilia R. M., Mosqueda-Melgar J., Soliva-Fortuny R., Martín-Belloso O. Control of pathogenic and spoilage microorganisms in fresh-cut fruits and fruit juices by traditional and alternative natural antimicrobials. Comprehensive Reviews in Food Science and Food Safety. 2009;8(3):157–180. doi: 10.1111/j.1541-4337.2009.00076.x. [DOI] [PubMed] [Google Scholar]
- 5.Wemmenhove E., van Valenberg H. J. F., van Hooijdonk A. C. M., Wells-Bennik M. H. J., Zwietering M. H. Factors that inhibit growth of Listeria monocytogenes in nature-ripened Gouda cheese: a major role for undissociated lactic acid. Food Control. 2017;84:413–418. [Google Scholar]
- 6.Rattanachaikunsopon P., Phumkhachorn P. Lactic acid bacteria: their antimicrobial compounds and their uses in food production. Annals of Biological Research. 2010;1:218–228. [Google Scholar]
- 7.Weagant S. D., Bryant J. L., Bark D. H. Survival of Escherichia coli O157 : H7 in mayonnaise and mayonnaise-based sauces at room and refrigerated temperatures. Journal of Food Protection. 1994;57(7):629–631. doi: 10.4315/0362-028x-57.7.629. [DOI] [PubMed] [Google Scholar]
- 8.Leyer G. J., Wang L. L., Johnson E. A. Acid adaptation of Escherichia coli O157 : H7 increases survival in acidic foods. Applied and Environmental Microbiology. 1995;61:3752–3755. doi: 10.1128/aem.61.10.3752-3755.1995. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Center for Disease Control and Prevention. Outbreak of Escherichia coli O157 : H7 infections associated with drinking unpasteurized commercial apple juice—British Columbia, California, Colorado, and Washington, October 1996. Morbidity and Mortality Weekly Report. 1996;45(44):p. 975. [PubMed] [Google Scholar]
- 10.Center for Disease Control and Prevention. Outbreak of Salmonella serotype Muenchen infections associated with unpasteurized orange juice—United States and Canada, June 1999. Morbidity and Mortality Weekly Report. 1999;48(27):582–585. [PubMed] [Google Scholar]
- 11.Lucero Estrada C. S. M., Alcaráz L. E., Satorres S. E., Manfredi E., Velázquez L. D. C. Presence of enterotoxigenic Staphylococcus aureus in artisan fruit salads in the city of San Luis, Argentina. Brazilian Journal of Microbiology. 2013;44(4):1155–1161. doi: 10.1590/s1517-83822014005000001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Berk P. A., Jonge R., Zwietering M. H., Abee T., Kieboom J. Acid resistance variability among isolates of Salmonella enterica serovar Typhimurium DT104. Journal of Applied Microbiology. 2005;99(4):859–866. doi: 10.1111/j.1365-2672.2005.02658.x. [DOI] [PubMed] [Google Scholar]
- 13.Pereira S. A., Alves Â, Ferreira V., Teixeira P. C. M. The impact of environmental stresses in the virulence traits of Listeria monocytogenes relevant to food safety. 2018. https://www.intechopen.com/books/listeria-monocytogenes/the-impact-of-environmental-stresses-in-the-virulence-traits-of-listeria-monocytogenes-relevant-to-f.
- 14.Tosun H., Seckin A. K., Gönül ŞA. Acid adaptation effect on survival of Escherichia coli O157 : H7 in fermented milk products. Turkish Journal of Veterinary and Animal Sciences. 2007;31:61–66. [Google Scholar]
- 15.Brussow H., Canchaya C., Hardt W.-D. Phages and the evolution of bacterial pathogens: from genomic rearrangements to lysogenic conversion. Microbiology and Molecular Biology Reviews. 2004;68(3):560–602. doi: 10.1128/mmbr.68.3.560-602.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Buchanan R. L., Edelson S. G. Culturing enterohemorrhagic Escherichia coli in the presence and absence of glucose as a simple means of evaluating the acid tolerance of stationary-phase cells. Applied and Environmental Microbiology. 1996;62:4009–4013. doi: 10.1128/aem.62.11.4009-4013.1996. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Chorianopoulos N., Giaouris E., Grigoraki I., Skandamis P., Nychas G.-J. Effect of acid tolerance response (ATR) on attachment of Listeria monocytogenes Scott A to stainless steel under extended exposure to acid or/and salt stress and resistance of sessile cells to subsequent strong acid challenge. International Journal of Food Microbiology. 2011;145(2-3):400–406. doi: 10.1016/j.ijfoodmicro.2011.01.001. [DOI] [PubMed] [Google Scholar]
- 18.Foster J. W. Salmonella acid shock proteins are required for the adaptive acid tolerance response. Journal of Bacteriology. 1991;173(21):6896–6902. doi: 10.1128/jb.173.21.6896-6902.1991. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Jin J., Zhang B., Guo H., et al. Mechanism analysis of acid tolerance response of Bifidobacterium longum subsp. longum BBMN 68 by gene expression profile using RNA-sequencing. PLoS One. 2012;7(12) doi: 10.1371/journal.pone.0050777.e50777 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Simango C., Rukure G. Survival of bacterial enteric pathogens in traditional fermented foods. Journal of Applied Bacteriology. 1992;73(1):37–40. doi: 10.1111/j.1365-2672.1992.tb04966.x. [DOI] [PubMed] [Google Scholar]
- 21.Svanberg U., Sjögren E., Lorri W., Svennerholm A.-M., Kaijser B. Inhibited growth of common enteropathogenic bacteria in lactic-fermented cereal gruels. World Journal of Microbiology & Biotechnology. 1992;8(6):601–606. doi: 10.1007/bf01238797. [DOI] [PubMed] [Google Scholar]
- 22.Gadaga T. H., Nyanga L. K., Mutukumira A. N. The occurrence, growth and control of pathogens in African fermented foods. 2004. https://tspace.library.utoronto.ca/bitstream/1807/55346/1/nd04009.html.
- 23.Ranjbar R., Dehkordi F. S., Shahreza M. H. S., Rahimi E. Prevalence, identification of virulence factors, O-serogroups and antibiotic resistance properties of Shiga-toxin producing Escherichia coli strains isolated from raw milk and traditional dairy products. Antimicrobial Resistance & Infection Control. 2018;7(1):p. 53. doi: 10.1186/s13756-018-0345-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Heras J., Domínguez C., Mata E., et al. GelJ—a tool for analyzing DNA fingerprint gel images. BMC Bioinformatics. 2015;16(1):p. 270. doi: 10.1186/s12859-015-0703-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Tahamtan Y., Hayati M., Namavari M. Prevalence and distribution of the stx 1, stx 2 genes in Shiga toxin producing E. coli (STEC) isolates from cattle. Iranian Journal of Microbiology. 2010;2(1):8–13. [PMC free article] [PubMed] [Google Scholar]
- 26.Huasai S., Chen A., Wang C.-J., Li Y., Tongrige B. Occurrence and characteristics of virulence genes of Escherichia coli strains isolated from healthy dairy cows in Inner Mongolia, China. Brazilian Journal of Microbiology. 2012;43(2):528–534. doi: 10.1590/s1517-83822012000200013. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Clinical and Laboratory Standard Institute. Performance standards for antimicrobial susceptibility testing; twenty-third information supplement. 2013. http://www.facm.ucl.ac.be/intranet/CLSI/CLSI-M100S23-susceptibility-testing-2013-no-protection.pdf.
- 28.Krumperman P. H. Multiple antibiotic resistance indexing of Escherichia coli to identify high-risk sources of fecal contamination of foods. Applied and Environmental Microbiology. 1983;46:165–170. doi: 10.1128/aem.46.1.165-170.1983. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Byaruhanga Y. B., Bester B. H., Watson T. G. Growth and survival of Bacillus cereus in mageu, a sour maize beverage World. World Journal of Microbiology and Biotechnology. 1999;15(3):329–333. doi: 10.1023/a:1008967117381. [DOI] [Google Scholar]
- 30.Cowan S. T., Steel K. J. Cowan and Steel’s Manual for the Identification of Medical Bacteria. 3rd. Cambridge, UK: Cambridge University Press; 2003. [Google Scholar]
- 31.Adams M. R., Nicolaides L. Review of the sensitivity of different foodborne pathogens to fermentation. Food Control. 1997;8(5-6):227–239. doi: 10.1016/s0956-7135(97)00016-9. [DOI] [Google Scholar]
- 32.Wood B. J. Microbiology of Fermented Foods. Berlin, Germany: Springer Science & Business Media; 2012. [Google Scholar]
- 33.Davidson P. M. Chemical preservatives and natural antimicrobial compounds. In: Doyle M. P., Beuchat L. R., Montville T. L., editors. Food Microbiology: Fundamentals and Frontiers. 2nd. Washington, DC, USA: ASM Press; 2001. pp. 593–627. [Google Scholar]
- 34.Phan-Thanh L., Mahouin F., Aligé S. Acid responses of Listeria monocytogenes. International Journal of Food Microbiology. 2000;55(1–3):121–126. doi: 10.1016/s0168-1605(00)00167-7. [DOI] [PubMed] [Google Scholar]
- 35.Cotter P. D., Gahan C. G. M., Hill C. A glutamate decarboxylase system protects Listeria monocytogenes in gastric fluid. Molecular Microbiology. 2001;40(2):465–475. doi: 10.1046/j.1365-2958.2001.02398.x. [DOI] [PubMed] [Google Scholar]
- 36.Ferreira A., Sue D., O’byrne C. P., Boor K. J. Role of Listeria monocytogenes B in survival of lethal acidic conditions and in the acquired acid tolerance response. Applied and Environmental Microbiology. 2003;69(5):2692–2698. doi: 10.1128/aem.69.5.2692-2698.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.O’Driscoll B., Gahan C. G., Hill C. Adaptive acid tolerance response in Listeria monocytogenes: isolation of an acid-tolerant mutant which demonstrates increased virulence. Applied and Environmental Microbiology. 1996;62:1693–1698. doi: 10.1128/aem.62.5.1693-1698.1996. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Foster D. B. Modulation of the enterohemorrhagic E. coli virulence program through the human gastrointestinal tract. Virulence. 2013;4(4):315–323. doi: 10.4161/viru.24318. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Gorden J., Small P. Acid resistance in enteric bacteria. Infection and Immunity. 1993;61(1):364–367. doi: 10.1128/iai.61.1.364-367.1993. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Leyer G. J., Johnson E. A. Acid adaptation induces cross-protection against environmental stresses in Salmonella typhimurium. Applied and Environmental Microbiology. 1993;59:1842–1847. doi: 10.1128/aem.59.6.1842-1847.1993. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Haberbeck L. U., Wang X., Michiels C., Devlieghere F., Uyttendaele M., Geeraerd A. H. Cross-protection between controlled acid-adaptation and thermal inactivation for 48 Escherichia coli strains. International Journal of Food Microbiology. 2017;241:206–214. doi: 10.1016/j.ijfoodmicro.2016.10.006. [DOI] [PubMed] [Google Scholar]
- 42.Shen H.-W., Yu R.-C., Chou C.-C. Acid adaptation affects the viability of Salmonella typhimurium during the lactic fermentation of skim milk and product storage. International Journal of Food Microbiology. 2007;114(3):380–385. doi: 10.1016/j.ijfoodmicro.2006.09.033. [DOI] [PubMed] [Google Scholar]
- 43.Kroll R. G., Patchett R. A. Induced acid tolerance in Listeria monocytogenes. Letters in Applied Microbiology. 1992;14(5):224–227. doi: 10.1111/j.1472-765x.1992.tb00691.x. [DOI] [Google Scholar]
- 44.Inatsu Y., Bari M. L., Kawasaki S., Isshiki K. Survival of Escherichia coli O157 : H7, Salmonella enteritidis, Staphylococcus aureus, and Listeria monocytogenes in Kimchi. Journal of Food Protection. 2004;67(7):1497–1500. doi: 10.4315/0362-028x-67.7.1497. [DOI] [PubMed] [Google Scholar]
- 45.Erdoğrul Ö., Erb F., Toroğlu S. Survival of acid-adapted and non-adapted Staphylococcus aureus in various food samples. Annals of Microbiology. 2006;56(1):25–27. doi: 10.1007/bf03174965. [DOI] [Google Scholar]
- 46.Brocchi M., Ferreira A., Lancellotti M., et al. Typing of avian pathogenic Escherichia coli strains by REP-PCR. Pesquisa Veterinária Brasileira. 2006;26(2):69–73. doi: 10.1590/s0100-736x2006000200002. [DOI] [Google Scholar]
- 47.Sekhar M. S., Sharif M., Rao T. S., Kiranmayi C. B., Muralidhar M. Discrimination of Beta-lactam Resistant Escherichia coli isolated from poultry and poultry farm workers using (GTG)5-Rep-PCR. Journal of Animal Science. 2018;8:85–91. [Google Scholar]
- 48.Mohapatra B. R., Broersma K., Mazumder A. Comparison of five rep-PCR genomic fingerprinting methods for differentiation of a fecal Escherichia coli from humans, poultry and wild birds. FEMS Microbiology Letters. 2007;277(1):98–106. doi: 10.1111/j.1574-6968.2007.00948.x. [DOI] [PubMed] [Google Scholar]
- 49.De Vuyst L., Camu N., De Winter T., et al. Validation of the (GTG)5-rep-PCR fingerprinting technique for rapid classification and identification of acetic acid bacteria, with a focus on isolates from Ghanaian fermented cocoa beans. International Journal of Food Microbiology. 2008;125(1):79–90. doi: 10.1016/j.ijfoodmicro.2007.02.030. [DOI] [PubMed] [Google Scholar]
- 50.Laboratorios CONDA. E. coli coliforms chromogenic medium. 2019. https://www.condalab.com/pdf/1340.pdf.
- 51.Girma G. Prevalence, antibiogram and growth potential of Salmonella and Shigella in Ethiopia: implications for public health: a review. Research Journal of Microbiology. 2015;10(7):288–307. doi: 10.3923/jm.2015.288.307. [DOI] [Google Scholar]
- 52.Guerin P. J., Brasher C., Baron E., et al. Case management of a multidrug-resistant Shigella dysenteriae serotype 1 outbreak in a crisis context in Sierra Leone, 1999-2000. Transactions of the Royal Society of Tropical Medicine and Hygiene. 2004;98(11):635–643. doi: 10.1016/j.trstmh.2004.01.005. [DOI] [PubMed] [Google Scholar]
- 53.Oguntoyinbo F. A. Safety challenges associated with traditional foods of West Africa. Food Reviews International. 2014;30(4):338–358. doi: 10.1080/87559129.2014.940086. [DOI] [Google Scholar]
- 54.Wenzler E., Kamboj K., Balada-Llasat J.-M. Severe sepsis secondary to persistent Lysinibacillus sphaericus, Lysinibacillus fusiformis and Paenibacillus amylolyticus bacteremia. International Journal of Infectious Diseases. 2015;35:93–95. doi: 10.1016/j.ijid.2015.04.016. [DOI] [PubMed] [Google Scholar]
- 55.Momtaz H., Karimian A., Madani M., et al. Uropathogenic Escherichia coli in Iran: serogroup distributions, virulence factors and antimicrobial resistance properties. Annals of Clinical Microbiology and Antimicrobials. 2013;12(1):p. 8. doi: 10.1186/1476-0711-12-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 56.Dehkordi F. S., Yazdani F., Mozafari J., Valizadeh Y. Virulence factors, serogroups and antimicrobial resistance properties of Escherichia coli strains in fermented dairy products. BMC Research Notes. 2014;7(1):p. 217. doi: 10.1186/1756-0500-7-217. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 57.Kaufmann M., Zweifel C., Blanco M., et al. Escherichia coli O157 and non-O157 Shiga toxin-producing Escherichia coli in fecal samples of finished pigs at slaughter in Switzerland. Journal of Food Protection. 2006;69(2):260–266. doi: 10.4315/0362-028x-69.2.260. [DOI] [PubMed] [Google Scholar]
- 58.Karmali M. A., Gannon V., Sargeant J. M. Verocytotoxin-producing Escherichia coli (VTEC) Veterinary Microbiology. 2010;140(3-4):360–370. doi: 10.1016/j.vetmic.2009.04.011. [DOI] [PubMed] [Google Scholar]
- 59.Schüller S. Shiga toxin interaction with human intestinal epithelium. Toxins. 2011;3(6):626–639. doi: 10.3390/toxins3060626. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 60.Brett K. N., Hornitzky M. A., Bettelheim K. A., Walker M. J., Djordjevic S. P. Bovine non-O157 Shiga toxin 2-containing Escherichia coli isolates commonly possess stx2-EDL933 and/or stx2vhb subtypes. Journal of Clinical Microbiology. 2003;41(6):2716–2722. doi: 10.1128/jcm.41.6.2716-2722.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 61.Eman F. M., Ebtesam M. M. Incidence of Staphylococcus aureus and its enterotoxins in yoghurt. Benha Veterinary Medical Journal. 2015;28(2):107–114. doi: 10.21608/bvmj.2015.31875. [DOI] [Google Scholar]
- 62.Atef N., Ibrahim M., Sleim A.-S. A., Abdel-Mageed A.-R. Molecular characterization of pathogenic E. coli and Staphylococcus aureus isolated from some fermented milk products by using PCR. Alexandria Journal of Veterinary Sciences. 2017;54(1):p. 127. doi: 10.5455/ajvs.257648. [DOI] [Google Scholar]
- 63.O’Bryan C. A., Crandall P. G., Ricke S. C. Chapter 6—antimicrobial resistance in foodborne pathogens. Food Feed Safety Systems and Analysis. 2018;99:115. [Google Scholar]
- 64.Government of Canada. About antibiotic resistance. 2018. https://www.canada.ca/en/public-health/services/antibiotic-antimicrobial-resistance/about-antibiotic-resistance.html.
- 65.Walsh C., Duffy G. Antibiotic resistance in foodborne pathogens. 2013. https://arrow.dit.ie/cgi/viewcontent.cgi?article=1006&context=schfsehrep.
- 66.Stephan R., Schumacher S., Corti S., Krause G., Danuser J., Beutin L. Prevalence and characteristics of Shiga toxin-producing Escherichia coli in Swiss raw milk cheeses collected at producer level. Journal of Dairy Science. 2008;91(7):2561–2565. doi: 10.3168/jds.2008-1055. [DOI] [PubMed] [Google Scholar]
- 67.Ranjbar R., Masoudimanesh M., Dehkordi F. S., Jonaidi-Jafari N., Rahimi E. Shiga (Vero)-toxin producing Escherichia coli isolated from the hospital foods; virulence factors, o-serogroups and antimicrobial resistance properties. Antimicrobial Resistance & Infection Control. 2017;6(1):p. 4. doi: 10.1186/s13756-016-0163-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 68.Tark D.-S., Moon D. C., Kang H. Y., et al. Antimicrobial susceptibility and characterization of extended-spectrum β-lactamases in Escherichia coli isolated from bovine mastitic milk in South Korea from 2012 to 2015. Journal of Dairy Science. 2017;100(5):3463–3469. doi: 10.3168/jds.2016-12276. [DOI] [PubMed] [Google Scholar]
- 69.Adzitey F. Antibiotic resistance of Escherichia coli and Salmonella enterica isolated from cabbage and lettuce samples in Tamale metropolis of Ghana. International Journal of Food Contamination. 2018;5(1):1–7. doi: 10.1186/s40550-018-0068-z. [DOI] [Google Scholar]
- 70.Mashak Z. Virulence genes and phenotypic evaluation of the antibiotic resistance of vero toxin producing Escherichia coli recovered from milk, meat, and vegetables. Jundishapur Journal of Microbiology. 2018;11(5) doi: 10.5812/jjm.62288. [DOI] [Google Scholar]
- 71.Tshipamba M. E., Lubanza N., Adetunji M. C., Mwanza M. Molecular characterization and antibiotic resistance of foodborne pathogens in street-vended ready-to-eat meat sold in South Africa. Journal of Food Protection. 2018;81(12):1963–1972. doi: 10.4315/0362-028X.JFP-18-069. [DOI] [PubMed] [Google Scholar]
- 72.Paul S., Bezbaruah R. L., Roy M. K., Ghosh A. C. Multiple antibiotic resistance (MAR) index and its reversion in Pseudomonas aeruginosa. Letters in Applied Microbiology. 1997;24(3):169–171. doi: 10.1046/j.1472-765x.1997.00364.x. [DOI] [PubMed] [Google Scholar]
- 73.Mirzaei E. Z., Lashani E., Davoodabadi A. Antimicrobial properties of lactic acid bacteria isolated from traditional yogurt and milk against Shigella strains. GMS Hygiene and Infection Control. 2018;13:1–5. doi: 10.3205/dgkh000307. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 74.Neal-McKinney J. M., Lu X., Duong T., et al. Production of organic acids by probiotic lactobacilli can be used to reduce pathogen load in poultry. PLoS One. 2012;7(9) doi: 10.1371/journal.pone.0043928.e43928 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 75.Simango C., Rukure G. Survival of Campylobacter jejuni and pathogenic Escherichia coli in mahewu, a fermented cereal gruel. Transactions of the Royal Society of Tropical Medicine and Hygiene. 1991;85(3):399–400. doi: 10.1016/0035-9203(91)90305-i. [DOI] [PubMed] [Google Scholar]
- 76.Yusof R. M., Morgan J. B., Adams M. R. Bacteriological safety of a fermented weaning food containing L-lactate and nisin. Journal of Food Protection. 1993;56(5):414–417. doi: 10.4315/0362-028x-56.5.414. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
The data used to support the findings of this study are included within the article.


