Abstract
We previously reported that E2F1 expression is up-regulated and positively correlated with the malignant phenotypes of colorectal cancer (CRC). However, the underlying mechanisms leading to the aberrant up-regulation of E2F1 in CRC have not been clarified. In this study, we observed that miR-526b-3p directly targets the 3’UTR of E2f1 mRNA, leading to reduced E2F1 expression. Overexpression of miR-526b-3p inhibited the proliferation of CRC cells by decreasing the level of E2F1. We also found that the Ying Yang 1 (YY1)-dependent transcriptional suppression of miR-526b-3p is responsible for the up-regulation of E2F1 in CRC, in which YY1 binds to the promoter of miR-526b gene and recruits histone deacetylase (HDAC). Knockdown of YY1 led to cell cycle arrest and diminished colony formation in CRC cells partly through relieving the miR-526b-3p suppression. Clinical analysis showed that YY1 and E2F1 were negatively correlated with miR-526b-3p in CRC tissues. Moreover, a high level of YY1 and E2F1, or a low level of miR-526b-3p, predicted poor survival of CRC patients. In conclusion, our findings highlight the dysregulation of the YY1/miR-526b-3p/E2F1 axis in CRC development, implicating a novel regulatory pathway for E2F1 as a potential therapeutic target in CRC.
Keywords: E2F1, miR-526b-3p, Ying Yang 1, colorectal cancer, proliferation
Introduction
Colorectal cancer (CRC) is one of the most common malignant and lethal cancers worldwide with high incidence [1]. It has been well-recognized that dysregulation of tumor suppressors and promoters is involved in CRC tumorigenesis and progression. As a well-characterized E2F family member, E2F1 exerts a complex role in cancer. Although E2F1 has been recognized as a strong inducer of apoptosis, especially after DNA damage, increased E2F1 expression was detected in cancers and promoted the cell cycle or proliferation through its transcriptional products [2]. We previously reported that E2F1 is involved in the regulation of invasion, migration, and proliferation of CRC cells, and a high E2F1 level indicated a poor prognosis of CRC patients [3,4]. We also found that overexpression of E2F1 contributed to the oxaliplatin-resistance of CRC cells [5]. However, the mechanisms leading to the abnormally high expression of E2F1 in CRC remain elusive.
As well-documented tumor suppressors, microRNAs (miRNAs) inhibit various oncogenes by inducing translational repression or transcript degradation. A growing body of evidence suggests that miRNAs involved in the dysregulation of E2F1 play a crucial role in cancer development, especially in proliferation [6]. Recently, Yan et al. found that miR-1205 suppressed non-small cell lung cancer growth by directly binding to the coding sequence of E2F1 [7]. Additionally, both miR-342-3p and miR-377 target the 3’UTR of E2f1 to suppress glioma proliferation [8]. miR-362-3p, which is mainly expressed in CRC with no recurrence, when compared with CRC with recurrence, decreased E2F1 expression and caused cell cycle arrest [9].
Overexpression of transcription factor Yin Yang 1 (YY1) is frequently correlated with tumor growth, metastasis, and chemotherapy resistance [10]. YY1 plays a role in regulating gene transcription depending upon the context in which it binds to DNA. Many YY1-inhibited genes, including several miRNAs, exhibit tumor suppressive potential [11-13]. High YY1 expression was detected in CRC cell lines or tissue samples, and poorly differentiated CRC tumors showed even higher YY1 expression than those in moderately and well-differentiated tumors [14]. Mechanistically, YY1 was reported to promote CRC growth and reduce apoptosis through the inhibition of p53 and the activation of Wnt signaling pathways [15,16]. Other evidence revealed a close association between YY1 and sex-determining region Y-box 2 (SOX2) expressions in CRC, suggesting a potential involvement of YY1 in cancer stem cells [17]. However, it is not currently known how YY1 drives the proliferation of CRC cells.
In the present study, we demonstrated that the highly expressed YY1 in CRC impeded the transcription of miR-526b-3p, functioning as a tumor suppressor by directly targeting E2F1. Increased E2F1 then enhanced CRC growth and tumorigenicity. Clinical analysis also confirmed the existence of a YY1/miR-526-3p/E2F1 axis in CRC tissues and a relationship between this axis and CRC patient prognosis.
Methods
Cell cultures and reagents
HIEC, HCT116, SW620, and RKO cells were maintained in the RPMI 1640 medium supplemented with 10% of fetal bovine serum (Gibco, Carlsbad, CA) in a humidified 5% CO2 atmosphere at 37°C. The antibodies against E2F1, YY1, and GAPDH were from Santa Cruz Biotechnology (Santa Cruz, CA). The small interfering RNA (siRNA) for E2F1 or YY1 and the short hairpin RNA (shRNA) for YY1 or miR-526b-3p were provided by GenePharma (Shanghai, China) and were transfected using Lipofectamine™ RNAiMAX (Invitrogen, Grand Island, NY). The sequences of siRNA and shRNA are shown in Table S1. The HCT116 cells stably transfected with shYY1 or shmiR-526b-3p were constructed using G418 (Sigma-Aldrich, Darmstadt, Germany).
Tissue samples
A total of 218 CRC samples (55 cases with frozen CRC and adjacent non-tumor normal tissues) were collected from the Sanmen People’s Hospital of Zhejiang Province after all patients signed the consent inform. The protocol of this study was approved by the Ethics Committee of the Sanmen People’s Hospital of Zhejiang Province. The 218 CRC samples were analyzed by immunohistochemistry, and the 55 frozen tissues were used to quantify miR-526b-3p, Yy1 mRNA, and E2f1 mRNA.
RNA extraction and quantitative PCR
Total RNA was extracted from the cells and tissues using the RNAiso Plus Kit (Takara Bio Inc., Otsu, Japan). For mRNA, cDNA was obtained by reverse transcription using the PrimeScript RT reagent Kit (Takara Bio, Inc), and qPCR was performed using the SYBR Green PCR Master Mix (Takara Bio Inc). For miRNA, reverse transcription was performed using a TaqMan microRNA RT Kit (Applied Biosystems, Foster City, CA), and the miR-526b-3p expression level was measured by qPCR using a TaqMan miRNA assay (Applied Biosystems). β-actin and U6 served as an internal control to normalize the mRNA and miRNA levels. The relative expression levels were calculated through the 2-ΔΔCT method.
Western blot analysis
The Bradford method was applied to measure the protein concentrations in whole-cell lysates. After electrophoresis, the proteins on SDS-PAGE were transferred to nitrocellulose membranes (Whatman, Maidstone, UK). The membranes were incubated using primary antibodies and the corresponding secondary antibodies. The fluorescence intensities were measured by the Odyssey infrared imaging system (LI-COR Biosciences, Lincoln, NE).
CCK-8 assay
We transfected the cells in logarithmic growth with the indicated siRNA, overexpression plasmid, or shRNA. At the indicated time after transfection, we added the cell counting kit-8 (CCK-8) solution (Dojindo, Gaithersburg, MD) and measured the OD450 by an automatic plate reader.
EdU incorporation assay
The 5-ethynyl-2-deoxyuridine (EdU) incorporation assay indicates DNA synthesis in cells. After transfection of the mentioned siRNA, overexpression plasmid, or shRNA, the cells were cultured in serum-free RPMI 1640 medium with 10 mM EdU for 2 h. The cells were then washed with PBS extensively and blocked with 10% of FBS in PBS for 30 min. The incorporated EdU was measured using the fluorescent azide coupling reaction (Invitrogen). We used a fluorescence microscope (Nikon, Tokyo, Japan) to capture cell images and the EdU incorporation rates were analyzed using ImageJ (NIH, Bethesda, MD).
Reporter gene assay
The 3’UTR of the E2f1 gene and the promoter of the miR-526b gene were amplified based on cDNA or genome DNA and then cloned into the pGL3 luciferase reporter vector (Promega, Madison, WI). Deletion or mutation reporter vectors were constructed by subcloning. The pre-plated cells were co-transfected with luciferase reporter plasmids, and the luciferase activity was determined by a dual-luciferase reporter assay system (Promega).
Chromatin immunoprecipitation
Formaldehyde at 1% for 10 min was used to cross-link chromatin and the cross-linked chromatin was sonicated by ultrasonic cell disruptor. After centrifugation, we added protein A/G PLUS-Agarose (Santa Cruz) into the supernatants for overnight immunoprecipitation at 4°C with an antibody against YY1 or normal IgG. After reversing the cross-linking, we purified and amplified the precipitated DNA fragments by qPCR using the following primers for miR-526b: TTTACATCCTAGCCTGTGATC (forward), and CAGCAATGGATTTTAAGCCAAG (reverse).
Flow cytometry
Approximately 1×106 HCT116 cells stably transfected with shYY1 or shmiR-526b-3p were re-suspended and fixed with PBS containing 70% ethanol at -20°C for 1 h. Before analysis, cells were re-suspended in PBS containing 100 mg/ml RNaseA (Roche, Basel, Switzerland) and 50 mg/ml propidium iodide (PI) (Sigma-Aldrich) for 30 min. We analyzed the cells immediately using a FACSCalibur flow cytometer with the CellQuest 3.0 software system (BD, San Jose, CA).
Colony formation in soft agar
The HCT116 cells stably transfected with shYY1 or shmiR-526b-3p were suspended in 0.3% agar and plated into 6-well plates, which were pre-coated with 1.0 ml of 0.6% agar. We replaced the culture medium every four days for three weeks, stained the colonies using crystal violet, and quantified the numbers of colonies by using Image J software.
Immunohistochemistry
Immunohistochemistry was carried out and analyzed as shown in our previous study [5]. To evaluate the score for CRC tissues, at least eight individual fields of each slide were included for counting 100 cancer cells/field at 200×. The immunohistochemistry score for each tissue was evaluated and calculated as described previously [5].
Statistical analysis
The statistical analysis was performed using SPSS 22.0 and GraphPad Prism 5.0. The results are presented as the mean ± S.E.M. of three separate experiments. Statistical data analysis included the two-tailed Student’s t test, Mann-Whitney U test, chi-square, and ANOVA. The Wilcoxon matched-pairs test was used for the analysis of CRC and corresponding para-CRC tissues. The Spearman and Pearson tests were used for correlation analysis. Overall survival was analyzed by Kaplan-Meier plots and log-rank tests. A P-value <0.05 was considered to be statistically significant.
Results
Knockdown of E2F1 reduces the proliferation of CRC cells
E2F1 expression was analyzed using the Cancer Genome Atlas (TCGA) database, which indicated that the E2F1 level was higher in CRC tissues than in the normal (Figure 1A). Consistently, the mRNA level of E2F1 was significantly higher in CRC than in adjacent tissues (Figure 1B). Then, we examined the protein expression of E2F1 in three CRC cell lines and a colonic epithelial cell line. The results showed that E2F1 expression was significantly increased in CRC cells, especially in HCT116 (Figure 1C). Consistent with our previous findings, E2F1 knockdown caused an obvious reduction in cell viability in both HCT116 and SW620 cells (Figure 1D).
Figure 1.

The knockdown of E2F1 reduces the proliferation of CRC cells. A. The mRNA level of E2F1 in CRC and normal intestinal tissues based on TCGA database, N=327. A Mann-Whitney test was performed to compare the difference between the normal and cancer groups. B. The mRNA levels of E2F1 in 55 paired CRC and corresponding normal tissues were measured by qPCR, using β-actin as an internal control. -ΔCt (ΔCt: Ct (E2F1)-Ct (β-actin)) represented the relative expression level. A Wilcoxon matched pairs test was performed to compare the difference between the normal and cancer groups. C. Left panel: western blot analyses of E2F1 in HIEC, HCT116, SW620, and RKO cells; Right panel: the band density in the left panel was calculated by Image J software. D. Cell viability was examined in HCT116 and SW620 cells with E2F1 knockdown. *P<0.05; **P<0.01.
miR-526b-3p inhibits E2F1 expression by targeting the 3’UTR of E2f1 mRNA
To explore the reason behind the high expression of E2F1 in CRC, we predicted the potential miRNA binding site at the 3’UTR of E2f1 mRNA by two different prediction algorithms, TargetScan and miRanda. The seed sequence of miR-526b-3p is complementary to the 3’UTR and is highly conserved among nine different species (Figure 2A). We then determined the miR-526b-3p level in CRC cell lines and normal colonic epithelial cells, which indicated that CRC cells had significantly lower miR-526b-3p expression levels than normal epithelial cells (Figure 2B). The E2F1 expression levels were both reduced by miR-526b-3p mimics in HCT116 and SW620 cells (Figure 2C and 2D). Furthermore, luciferase assay showed that miR-526b-3p repressed the activity of the reporter with wild-type 3’UTR of E2f1 mRNA. Notably, miR-526b-3p was not able to induce changes in the levels of the reporter when the miR-526b-3p binding site was mutated (Figure 2E). These results reveal a specific inhibitory effect of miR-526b-3p on E2F1 expression via direct interaction with 3’UTR.
Figure 2.

miR-526b-3p inhibits E2F1 expression by targeting the 3’UTR of E2f1 mRNA. A. The miR-526b-3p seed sequence complementary to the 3’UTR of E2f1 mRNA was predicted by TargetScan Human 7.2 and miRanda. B. The level of miR-526b-3p in HIEC, HCT116, SW620, and RKO cells was analyzed by qPCR. *P<0.05; **P<0.01. C. The mRNA level of E2F1 in HCT116 and SW620 cells transfected with scramble or miR-526b-3p mimics was analyzed by qPCR. *P<0.05. D. Western blot analyses of E2F1 in HCT116 and SW620 cells transfected with scramble or miR-526b-3p mimics. E. Left panel: the potential sequences for miR-526b-3p binding were mutated as indicated. Right panel: the function of the wild-type or mutated E2F1 3’UTR was analyzed by luciferase reporter assay in HCT116 cells transfected with scramble or miR-526b-3p mimics. **P<0.01; ***P<0.001.
miR-526b-3p attenuates the proliferation of CRC cells by inhibiting E2F1
To clarify the role of miR-526b-3p in the proliferation of CRC cells, HCT116 and SW620 cells were transfected with miR-526b-3p mimics, and then the cell viability and DNA synthesis were examined. The results showed that miR-526-3p inhibited cell proliferation and interrupted EdU incorporation, whereas further overexpression of E2F1 rescued cell growth and DNA synthesis (Figure 3A and 3B), suggesting that E2F1 mediates the inhibitory effect of miR-526b-3p on CRC cell proliferation.
Figure 3.

miR-526b-3p attenuates the proliferation of CRC cells by inhibiting E2F1. A. Cell viability was measured in HCT116 and SW620 cells co-transfected with miR-526b-3p mimics or E2F1 overexpression plasmids vs scramble/EV: ***P<0.001; vs miR-526b-3p/E2F1: #P<0.05; ##P<0.01; ###P<0.001. B. DNA synthesis of HCT116 or SW620 cells was measured by EdU incorporation assay after co-transfection with miR-526b-3p mimics or E2F1 overexpression plasmids. Left panel: representative images; Right panel: percentage of cells with EdU incorporation was measured using image-J.
YY1 represses the transcription of the miR-526b gene
To understand why miR-526b-3p was silenced in CRC, the promoter of the miR-526b gene was deeply analyzed. Serial deletion constructs of the promoter were studied by a luciferase reporter assay, and it was shown that the transcriptional activity of the miR-526b promoter was remarkably increased when deleting the region between -600 and -300, suggesting a critical regulatory element located at this region (Figure 4A). Using the ‘JASPAR’ database, two potential YY1 binding sites (-582/-570; -365/-353) were found in the promoter sequence (Figure 4B). However, only the mutation at the -365/-353 site significantly increased the reporter activity (Figure 4C). The expression of YY1 was also found to increase in CRC tissues compared with adjacent tissues (Figure S1A and S1B). In line with the above findings, knockdown of YY1 increased the miR-526b-3p level and meanwhile reduced E2F1 expression in HCT116 and SW620 cells (Figure 4D and 4E). ChIP-PCR and ChIP-qPCR analysis further verified that YY1 interacted with the miR-526b promoter around the -365/-353 site (Figure 4F). Previous studies reported that HDACs served as epigenetic co-repressors with YY1 [18,19]. Accordingly, we addressed the role of HDACs in the expressions of miR-526b-3p and E2F1. We found that trichostatin A (TSA), a classical HDAC inhibitor, significantly increased the level of miR-526b-3p and silenced the E2F1 expression even when overexpressing YY1 (Figure 4G and 4H), suggesting that HDACs participate in YY1-mediated transcription silence of miR-526b-3p. These findings indicate that the highly expressed YY1 in CRC suppresses the transcription of miR-526b-3p, eventually promoting E2F1 expression.
Figure 4.

YY1 represses the transcription of the miR-526b gene. A. Transcription activity of the truncated miR-526b promoter was measured by luciferase reporter assay in HCT116 cells. **P<0.01. B. The potential sequences for YY1 binding were mutated as indicated. C. Transcription activity of the wild-type or mutated miR-526b promoter was measured by luciferase reporter assay in HCT116. **P<0.01. D. The level of miR-526b-3p in HCT116 and SW620 cells with knockdown of YY1. **P<0.01. E. Western blot analyses of E2F1 in HCT116 and SW620 cells with knockdown of YY1. F. The binding of YY1 to miR-526b promoter was examined by ChIP-PCR. Left panel: ChIP-PCR products in the input, ChIP and IgG groups were analyzed by agarose gel electrophoresis; Right panel: quantitative PCR analysis. G. The level of miR-526b-3p in HCT116 and SW620 cells transfected with YY1 overexpression plasmids or treated with 100 ng/mL TSA. **P<0.01; ***P<0.001. H. Western blot analyses of E2F1 in HCT116 and SW620 cells transfected with YY1 overexpression plasmids or treated with 100 ng/mL TSA.
YY1 promotes CRC cell proliferation by suppressing miR-526b-3p
HCT116 cells with a stable knockdown of YY1 or miR-526b-3p were generated. As expected, the knocking down of YY1 induced significant up-regulation of miR-526b-3p but a down-regulation of E2F1 in HCT116 cells, and depriving miR-526b-3p completely restored E2F1 expression (Figure 5A and 5B). Compared with the control, a significant inhibition of proliferation and DNA synthesis appeared in HCT116 cells with a stable knockdown of YY1, while silencing miR-526b-3p partially rescued the proliferation and DNA synthesis (Figure 5C and 5D). Cell cycle analysis revealed that YY1-silenced HCT116 cells underwent arrest in G1 phases, with a significant depletion of cells entering the S phase. However, HCT116 cells with a stable knockdown of both YY1 and miR-526b-3p went through a relatively slight S phase arrest (Figure 5E). Consistently, knockdown of YY1 decreased the colony formation numbers of HCT116 cells, and eliminating miR-526b-3p rescued the attenuated tumorigenesis to a certain extent (Figure 5F). The above findings indicate that miR-526b-3p is essential for YY1-driven CRC proliferation.
Figure 5.
YY1 promotes CRC cell proliferation by suppressing miR-526b-3p. A. Western blot analyses of E2F1 in HCT116 cells with stable knockdown of YY1 or miR-526b-3p. B. The level of miR-526b-3p in HCT116 cells with stable knockdown of YY1 or miR-526b-3p. **P<0.01; ***P<0.001. C. Cell viability was measured in HCT116 cells with stable knockdown of YY1 or miR-526b-3p. vs shCtrl: *P<0.05; **P<0.01; ***P<0.001. vs shYY1/shmiR-526b-3p: #P<0.05; ###P<0.001. D. DNA synthesis of HCT116 with stable knockdown of YY1 or miR-526b-3p was measured by EdU incorporation assay. Left panel: representative images; Right panel: percentage of cells with EdU incorporation was measured using image-J. E. Cell cycle profiles of HCT116 cells with stable knockdown of YY1 or miR-526b-3p were analyzed by flow cytometry. Left panel: representative images; Right panel: percentage of cells at different phases. F. Surviving colonies of HCT116 cells with stable knockdown of YY1 or miR-526b-3p. Left panel: representative images; Right panel: ratios of colony numbers relative to control.
Activation of the YY1/miR-526b-3p/E2F1 axis is correlated with a poor prognosis in CRC patients
Immunohistochemical staining was applied to evaluate YY1 and E2F1 expressions in CRC tissues. As shown in Figure 6A, the case with high expression of YY1 and E2F1 had a stronger KI67 staining than that with low expression of both proteins. Moreover, the YY1 expression was significantly associated with the E2F1 expression in the CRC cases (Figure 6B). Additionally, the expression of miR-526b-3p was significantly lower in CRC than in adjacent tissues (Figure 6C; Table S2). Further analysis showed that the miR-526b-3p level was negatively correlated with the mRNA levels of YY1 and E2F1 in CRC tissues, and a positive correlation between YY1 and E2F1 was determined (Figure 6D; Table S2). We also found that both YY1 and E2F1 levels were associated with distant metastasis and TNM stage (Table 1). Kaplan-Meier analysis indicated that patients with strong staining of YY1 or E2F1 had worse overall survival than those with weak staining. It is noteworthy that patients with high miR-526b-3p levels had a better prognosis than those with low levels (Figure 6E). These results suggest that the YY1/miR-526b-3p/E2F1 axis has a close association with CRC development.
Figure 6.

Activation of YY1/miR-526b-3p/E2F1 axis is related with a poor prognosis in CRC patients. A. Representative images of YY1, E2F1, and KI67 staining in CRC and adjacent normal tissues. B. The correlation between the immunostaining scores of YY1 and E2F1 in CRC tissues. Nonparametric spearman test was applied in analyzing the correlation. C. The miR-526b-3p levels in 55 paired CRC and corresponding normal tissues were measured by qPCR, using U6 as an internal control. The expression value (ΔCt (N)-ΔCt (T)) represented the difference in the miR-526b-3p level between normal tissue and tumor. An expression value >0 indicated that miR-526b-3p level was increased in tumors. An expression value <0 indicated that miR-526b-3p level was decreased in tumors. Wilcoxon matched pairs test was applied to compare the difference between the normal and cancer groups. D. The correlation among the levels of Yy1 mRNA, E2f1 mRNA, and miR-526b-3p in 55 CRC tissues. A Pearson test was applied in the correlation analysis. E. The overall survival of CRC patients with low and high expression of Yy1 protein, E2f1 protein, or miR-526b-3p was illustrated.
Table 1.
Association of the expression of E2F1 and YY1 with clinicopathological features in CRC
| Cases | E2F1 expression | YY1 expression | |||||
|---|---|---|---|---|---|---|---|
|
|
|
||||||
| Low cases | High cases | P value | Low cases | High cases | P value | ||
| Tumor location | 0.7549 | 0.3785 | |||||
| Colon | 90 | 44 | 46 | 41 | 49 | ||
| Rectum | 128 | 67 | 61 | 59 | 69 | ||
| Gender | 0.3220 | 0.1898 | |||||
| Male | 116 | 54 | 62 | 48 | 68 | ||
| Female | 102 | 57 | 45 | 52 | 50 | ||
| Age | 0.7756 | 0.1206 | |||||
| ≤65 | 88 | 44 | 44 | 47 | 41 | ||
| >65 | 130 | 67 | 63 | 53 | 77 | ||
| Differentiation status | 0.1521 | 0.9288 | |||||
| Well | 46 | 22 | 24 | 23 | 23 | ||
| Moderate | 147 | 82 | 65 | 68 | 79 | ||
| Poor | 25 | 7 | 18 | 9 | 16 | ||
| Tumor size | 0.3672 | 0.3019 | |||||
| <5 cm | 105 | 55 | 50 | 45 | 60 | ||
| ≥5 cm | 113 | 56 | 57 | 55 | 58 | ||
| LNM | 0.0957 | 0.1565 | |||||
| N0 | 125 | 70 | 55 | 61 | 64 | ||
| N1 | 69 | 33 | 36 | 31 | 38 | ||
| N2 | 24 | 8 | 16 | 8 | 16 | ||
| TNM | 0.0126 | 0.0515 | |||||
| I | 35 | 19 | 16 | 18 | 17 | ||
| II | 83 | 43 | 40 | 38 | 45 | ||
| III | 83 | 45 | 38 | 41 | 42 | ||
| IV | 17 | 4 | 13 | 3 | 14 | ||
| Distant metastasis | 0.0010 | 0.0055 | |||||
| M0 | 201 | 107 | 94 | 97 | 104 | ||
| M1 | 17 | 4 | 13 | 3 | 14 | ||
Discussion
In this study, we found that high expression of YY1 in CRC suppressed the transcription of miR-526b-3p, which decreased the expression of E2F1 by targeting E2f1 mRNA. Consequently, the YY1-induced upregulation of E2F1 accelerated cell cycle progression and promoted CRC cell proliferation (Figure 7). Clinical analyses showed that YY1 was positively correlated with E2F1, and miR-526b-3p was negatively correlated with YY1 or E2F1 in CRC tissues. The CRC patients with high expression of YY1 and E2F1 or low expression of miR-526b-3p had a poor survival rate.
Figure 7.

Schema indicating the promotive effect of YY1/miR-526b-3p/E2F1 axis on CRC proliferation. In CRC cells, highly expressed YY1 recruits HDAC to silence the transcription of the miR-526b gene, leading to the downregulation of miR-526b-3p, which targets the 3’UTR of E2f1 mRNA. The resulting increased E2F1 level promotes CRC proliferation.
Recently, we found that overexpressed E2F1 transactivated the IQ motif-containing GTPase activating protein 3 (IQGAP3) and promoted the proliferation of hepatocellular carcinoma through IQGAP3-mediated PKC-alpha activation [20]. In colon cancer, the target genes of E2F1, thymidylate synthase (TS) and ribonucleotide reductase subunit M2 (RRM2) were elevated, effectively promoting cell cycle misregulation and oncogenesis [3,21]. Consistently, the present study indicated that knockdown of E2F1 inhibited DNA synthesis and blocked cells from the G0 phase to the S phase, thereby suppressing CRC cell proliferation. Besides, the E2F1 level increased with tumor progression, and highly expressed E2F1 reduced the survival probability of CRC patients. TCGA database analysis showed that the E2f1 mRNA levels were significantly up-regulated in CRC tissues compared with normal intestinal tissues, suggesting that E2F1 overexpression in CRC results from increased E2f1 mRNA. Our previous work reported that the nuclear transcription factor Y subunit β (NFYB) transactivates the E2F1 gene in oxaliplatin-resistant CRC cells, however NFYB was not highly expressed in nonresistant cells-perhaps not enough to explain the high expression of E2F1 in CRC cells [5]. Here, we showed that the loss of miR-526b-3p in CRC increased both E2f1 mRNA and protein levels.
miR-526b-3p has been reported to be abnormally expressed in various tumors and exhibits a tumor-suppressive role in the progression of these diseases. Recent studies showed that miR-526b-3p was generally down-regulated in tumor tissues and can inhibit cell growth. In hepatocellular carcinoma, miR-526b-3p inhibited the growth of hepatocellular carcinoma cells in vitro and in vivo, whereas miR-526b-3p under-expression independently predicted a poor prognosis of hepatocellular carcinoma patients [22]. In addition, overexpression of miR-526b-3p suppressed glioma cell proliferation and down-regulation of miR-526b-3p was significantly associated with advanced WHO grade [23]. Zhang et al. reported that CRC tissues and cell lines showed lower miR-526b-3p expression levels than their normal controls [24]. In this study, we identified miR-526b-3p as a negative regulator of E2F1 via direct interaction with the 3’UTR of E2f1 mRNA. Recovering miR-526b-3p expression inhibited the proliferation and tumorigenicity of CRC cells by decreasing E2F1 expression. A negative correlation between miR-526b-3p and E2F1 was further verified in CRC tissues and lower miR-526b-3p expression indicated a worse prognosis in CRC patients than the higher expression of this miRNA. Notably, we found that YY1 repressed the transcription of the miR-526b gene in CRC cells, suggesting that miR-526b-5p may also be decreased in CRC. It has been reported that miR-526b-5p could inhibit the proliferation of non-small cell lung cancer and gastric cancer [25,26]. Thus, we speculated that the dysregulation of miR-526b-5p also promoted CRC growth.
In the present study, we found that YY1 exerted an oncogenic function by inactivating the transcription of the miR-526b gene in CRC. The YY1 knockdown suppressed the proliferation and tumorigenicity of CRC cells in a miR-526b-3p-dependent manner. As a crucial epimodulator, YY1 recruits various epi-modifiers to regulate target gene expression, in which histone deacetylases (HDACs) are responsible for transcription silence. Here, we found that YY1 directly bound to the miR-526b promoter but failed to block the transcription of miR-526b-3p when the HDAC inhibitor trichostatin A was added, suggesting that YY1 may silence the transcription of the miR-526b gene by recruiting HDACs. Several class I and II HDACs have been reported to act as co-repressors of YY1 [18,19,27,28]. So, it is worthwhile to determine further which HDAC supports the YY1/HDAC co-repressor complex for the miR-526b gene silencing in CRC.
In conclusion, our study highlights the YY1/miR-526b-3p/E2F1 axis as a novel pathway for abnormal E2F1 expression in CRC. Our findings may provide a novel prognostic marker and a potential therapeutic target for CRC patients.
Acknowledgements
This work was supported by The National Natural Science Foundation of China (81702401), the Zhejiang Medical and Health Science and Technology Plan (2018KY920 and 2018KY184), Taizhou Science and Technology Plan (1902KY191 and 1902KY192), and the Science and Technology Program of Sanmen County Public Technology Social Development Project (16302, 16303, 16304 and 18304).
Disclosure of conflict of interest
None.
Supporting Information
References
- 1.Araghi M, Soerjomataram I, Jenkins M, Brierley J, Morris E, Bray F, Arnold M. Global trends in colorectal cancer mortality: projections to the year 2035. Int J Cancer. 2019;144:2992–3000. doi: 10.1002/ijc.32055. [DOI] [PubMed] [Google Scholar]
- 2.Poppy Roworth A, Ghari F, La Thangue NB. To live or let die - complexity within the E2F1 pathway. Mol Cell Oncol. 2015;2:e970480. doi: 10.4161/23723548.2014.970480. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Fang Z, Gong C, Liu H, Zhang X, Mei L, Song M, Qiu L, Luo S, Zhu Z, Zhang R, Gu H, Chen X. E2F1 promote the aggressiveness of human colorectal cancer by activating the ribonucleotide reductase small subunit M2. Biochem Biophys Res Commun. 2015;464:407–415. doi: 10.1016/j.bbrc.2015.06.103. [DOI] [PubMed] [Google Scholar]
- 4.Chen J, Gong C, Mao H, Li Z, Fang Z, Chen Q, Lin M, Jiang X, Hu Y, Wang W, Zhang X, Chen X, Li H. E2F1/SP3/STAT6 axis is required for IL-4-induced epithelial-mesenchymal transition of colorectal cancer cells. Int J Oncol. 2018;53:567–578. doi: 10.3892/ijo.2018.4429. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Fang Z, Gong C, Yu S, Zhou W, Hassan W, Li H, Wang X, Hu Y, Gu K, Chen X, Hong B, Bao Y, Chen X, Zhang X, Liu H. NFYB-induced high expression of E2F1 contributes to oxaliplatin resistance in colorectal cancer via the enhancement of CHK1 signaling. Cancer Lett. 2018;415:58–72. doi: 10.1016/j.canlet.2017.11.040. [DOI] [PubMed] [Google Scholar]
- 6.Emmrich S, Putzer BM. Checks and balances: E2F-microRNA crosstalk in cancer control. Cell Cycle. 2010;9:2555–2567. doi: 10.4161/cc.9.13.12061. [DOI] [PubMed] [Google Scholar]
- 7.Yan H, Chen X, Li Y, Fan L, Tai Y, Zhou Y, Chen Y, Qi X, Huang R, Ren J. MiR-1205 functions as a tumor suppressor by disconnecting the synergy between KRAS and MDM4/E2F1 in non-small cell lung cancer. Am J Cancer Res. 2019;9:312–329. [PMC free article] [PubMed] [Google Scholar]
- 8.Huang Y, Chi C. Glioma cell proliferation is inhibited by miR-342-3p, miR-377/E2F1 signaling pathway. Neoplasma. 2019;66:524–531. doi: 10.4149/neo_2018_180805N574. [DOI] [PubMed] [Google Scholar]
- 9.Christensen LL, Tobiasen H, Holm A, Schepeler T, Ostenfeld MS, Thorsen K, Rasmussen MH, Birkenkamp-Demtroeder K, Sieber OM, Gibbs P, Lubinski J, Lamy P COLOFOL steering group. Laurberg S, Oster B, Hansen KQ, Hagemann-Madsen R, Byskov K, Ørntoft TF, Andersen CL. MiRNA-362-3p induces cell cycle arrest through targeting of E2F1, USF2 and PTPN1 and is associated with recurrence of colorectal cancer. Int J Cancer. 2013;133:67–78. doi: 10.1002/ijc.28010. [DOI] [PubMed] [Google Scholar]
- 10.Zhang Q, Stovall DB, Inoue K, Sui G. The oncogenic role of Yin Yang 1. Crit Rev Oncog. 2011;16:163–197. doi: 10.1615/critrevoncog.v16.i3-4.30. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Tsang DP, Wu WK, Kang W, Lee YY, Wu F, Yu Z, Xiong L, Chan AW, Tong JH, Yang W, Li MS, Lau SS, Li X, Lee SD, Yang Y, Lai PB, Yu DY, Xu G, Lo KW, Chan MT, Wang H, Lee TL, Yu J, Wong N, Yip KY, To KF, Cheng AS. Yin Yang 1-mediated epigenetic silencing of tumour-suppressive microRNAs activates nuclear factor-kappaB in hepatocellular carcinoma. J Pathol. 2016;238:651–664. doi: 10.1002/path.4688. [DOI] [PubMed] [Google Scholar]
- 12.Yuan P, He XH, Rong YF, Cao J, Li Y, Hu YP, Liu Y, Li D, Lou W, Liu MF. KRAS/NF-kappaB/YY1/miR-489 signaling axis controls pancreatic cancer metastasis. Cancer Res. 2017;77:100–111. doi: 10.1158/0008-5472.CAN-16-1898. [DOI] [PubMed] [Google Scholar]
- 13.Huang Y, Tao T, Liu C, Guan H, Zhang G, Ling Z, Zhang L, Lu K, Chen S, Xu B, Chen M. Upregulation of miR-146a by YY1 depletion correlates with delayed progression of prostate cancer. Int J Oncol. 2017;50:421–431. doi: 10.3892/ijo.2017.3840. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Chinnappan D, Xiao D, Ratnasari A, Andry C, King TC, Weber HC. Transcription factor YY1 expression in human gastrointestinal cancer cells. Int J Oncol. 2009;34:1417–1423. [PubMed] [Google Scholar]
- 15.Zhang N, Li X, Wu CW, Dong Y, Cai M, Mok MT, Wang H, Chen J, Ng SS, Chen M, Sung JJ, Yu J. microRNA-7 is a novel inhibitor of YY1 contributing to colorectal tumorigenesis. Oncogene. 2013;32:5078–5088. doi: 10.1038/onc.2012.526. [DOI] [PubMed] [Google Scholar]
- 16.Yokoyama NN, Pate KT, Sprowl S, Waterman ML. A role for YY1 in repression of dominant negative LEF-1 expression in colon cancer. Nucleic Acids Res. 2010;38:6375–6388. doi: 10.1093/nar/gkq492. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Kaufhold S, Garbán H, Bonavida B. Yin Yang 1 is associated with cancer stem cell transcription factors (SOX2, OCT4, BMI1) and clinical implication. J Exp Clin Cancer Res. 2016;35:84. doi: 10.1186/s13046-016-0359-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Ren G, Zhang G, Dong Z, Liu Z, Li L, Feng Y, Su D, Zhang Y, Huang B, Lu J. Recruitment of HDAC4 by transcription factor YY1 represses HOXB13 to affect cell growth in AR-negative prostate cancers. Int J Biochem Cell Biol. 2009;41:1094–1101. doi: 10.1016/j.biocel.2008.10.015. [DOI] [PubMed] [Google Scholar]
- 19.Karki P, Webb A, Smith K, Johnson J Jr, Lee K, Son DS, Aschner M, Lee E. Yin Yang 1 is a repressor of glutamate transporter EAAT2, and it mediates manganese-induced decrease of EAAT2 expression in astrocytes. Mol Cell Biol. 2014;34:1280–1289. doi: 10.1128/MCB.01176-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Lin M, Liu Y, Ding X, Ke Q, Shi J, Ma Z, Gu H, Wang H, Zhang C, Yang C, Fang Z, Zhou L, Ye M. E2F1 transactivates IQGAP3 and promotes proliferation of hepatocellular carcinoma cells through IQGAP3-mediated PKC-alpha activation. Am J Cancer Res. 2019;9:285–299. [PMC free article] [PubMed] [Google Scholar]
- 21.Kasahara M, Takahashi Y, Nagata T, Asai S, Eguchi T, Ishii Y, Fujii M, Ishikawa K. Thymidylate synthase expression correlates closely with E2F1 expression in colon cancer. Clin Cancer Res. 2000;6:2707–2711. [PubMed] [Google Scholar]
- 22.Liu X, Yang L, Tu J, Cai W, Zhang M, Shou Z, Yao Y, Xu Q. microRNA-526b servers as a prognostic factor and exhibits tumor suppressive property by targeting Sirtuin 7 in hepatocellular carcinoma. Oncotarget. 2017;8:87737–87749. doi: 10.18632/oncotarget.21209. [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
- 23.Wu M, Li X, Liu Q, Xie Y, Yuan J, Wanggou S. miR-526b-3p serves as a prognostic factor and regulates the proliferation, invasion, and migration of glioma through targeting WEE1. Cancer Manag Res. 2019;11:3099–3110. doi: 10.2147/CMAR.S192361. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Zhang R, Zhao J, Xu J, Wang J, Jia J. miR-526b-3p functions as a tumor suppressor in colon cancer by regulating HIF-1α. Am J Transl Res. 2016;8:2783–9. [PMC free article] [PubMed] [Google Scholar]
- 25.Zhang ZY, Fu SL, Xu SQ, Zhou X, Liu XS, Xu YJ, Zhao JP, Wei S. By downregulating Ku80, hsa-miR-526b suppresses non-small cell lung cancer. Oncotarget. 2015;6:1462–1477. doi: 10.18632/oncotarget.2808. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Chen LH, Wang LP, Ma XQ. Circ_SPECC1 enhances the inhibition of miR-526b on downstream KDM4A/YAP1 pathway to regulate the growth and invasion of gastric cancer cells. Biochem Biophys Res Commun. 2019;517:253–259. doi: 10.1016/j.bbrc.2019.07.065. [DOI] [PubMed] [Google Scholar]
- 27.Lu P, Hankel IL, Hostager BS, Swartzendruber JA, Friedman AD, Brenton JL, Rothman PB, Colgan JD. The developmental regulator protein Gon4l associates with protein YY1, co-repressor Sin3a, and histone deacetylase 1 and mediates transcriptional repression. J Biol Chem. 2011;286:18311–18319. doi: 10.1074/jbc.M110.133603. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Camacho-Moctezuma B, Quevedo-Castillo M, Melendez-Zajgla J, Aquino-Jarquin G, Martinez-Ruiz GU. YY1 negatively regulates the XAF1 gene expression in prostate cancer. Biochem Biophys Res Commun. 2019;508:973–979. doi: 10.1016/j.bbrc.2018.12.056. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.

