Skip to main content
NCBI home page
Journal of Cell Communication and Signaling logoLink to Journal of Cell Communication and Signaling
. 2019 Jan 19;13(4):473–489. doi: 10.1007/s12079-018-00501-7

Protective role of epigallocatechin-3-gallate in NADPH oxidase-MMP2-Spm-Cer-S1P signalling axis mediated ET-1 induced pulmonary artery smooth muscle cell proliferation

Jaganmay Sarkar 1, Tapati Chakraborti 1, Animesh Chowdhury 1, Rajabrata Bhuyan 1, Sajal Chakraborti 1,✉
PMCID: PMC6946791  PMID: 30661173

Abstract

The signalling pathway involving MMP-2 and sphingosine-1-phosphate (S1P) in endothelin-1 (ET-1) induced pulmonary artery smooth muscle cell (PASMC) proliferation is not clearly known. We, therefore, investigated the role of NADPH oxidase derived O2.--mediated modulation of MMP2-sphingomyeline-ceramide-S1P signalling axis in ET-1 induced increase in proliferation of PASMCs. Additionally, protective role of the tea cathechin, epigallocatechin-3-gallate (EGCG), if any, in this scenario has also been explored. ET-1 markedly increased NADPH oxidase and MMP-2 activities and proliferation of bovine pulmonary artery smooth muscle cells (BPASMCs). ET-1 also caused significant increase in sphingomyelinase (SMase) activity, ERK1/2 and sphingosine kinase (SPHK) phosphorylations, and S1P level in the cells. EGCG inhibited ET-1 induced increase in SMase activity, ERK1/2 and SPHK phosphorylations, S1P level and the SMC proliferation. EGCG also attenuated ET-1 induced activation of MMP-2 by inhibiting NADPH oxidase activity upon inhibiting the association of the NADPH oxidase components, p47phox and p67phox in the cell membrane. Molecular docking study revealed a marked binding affinity of p47phox with the galloyl group of EGCG. Overall, our study suggest that ET-1 induced proliferation of the PASMCs occurs via NADPH oxidase-MMP2- Spm- Cer-S1P signalling axis, and EGCG attenuates ET-1 induced increase in proliferation of the cells by inhibiting NADPH oxidase activity.

Electronic supplementary material

The online version of this article (10.1007/s12079-018-00501-7) contains supplementary material, which is available to authorized users.

Keywords: EGCG, MMP-2, NADPH oxidase, proMMP-2, SMase, SPHK, S1P

Introduction

Pulmonary artery hypertension (PAH) is a devastating life threatening disorder characterized by elevated pulmonary arterial pressure, which results in right ventricular hypertrophy (Chaumais et al. 2015; Stenmark et al. 2009). A considerable number of reports have suggested that ET-1 plays an important role in producing a variety of pulmonary diseases, for example, PAH via membrane bound ET receptors (Chakraborti et al. 2015; Kim et al. 2015). The receptors that mediate biological effects of ET-1 are ETA and ETB and these are found in vascular SMCs (Chakraborti et al. 2015; Khalil 2011; Chen et al. 2009).

MMP-2 is known to regulate remodelling of pulmonary vasculature and its dysregulation promotes development of a variety of lung diseases like PAH (Stenmark and Mecham 1997; Stamenkovic 2003; Chelladurai et al. 2012). MMP-2 has also been suggested to play a crucial role for increase in cell proliferation (He et al. 2007). In some cell types, ET-1 markedly induces MMP-2 activation, which has been suggested to influence remodelling of tissues (He et al. 2007).

Oxidative stress activates several enzymes, which alone and in combination, alters different cellular responses. In vascular cells, the predominant pathway for O2.- generation occurs via NADPH oxidase dependent mechanism (Lambeth 2004; Lassegue and Clempus 2003). Stimulation of NADPH oxidase derived O2.- production in pulmonary artery is known to be an important event in the pathogenesis of a variety of lung diseases, for example, PAH (Wedgwood and Black 2003). O2.- and its derivatives such as peroxy and hydroxyl radicals have been demonstrated to activate proMMP-2 in different systems (Chakraborti et al. 2003; Mandal et al. 2005, 2004).

Sphingosine-ceramide-sphingoisine1phosphate (Spm-Cer-S1P) pathway has been suggested to play an important role in SMC proliferation (Augé et al. 2004; Maupas-Schwalm et al. 2004). In this pathway, neutral sphingomyelinase converts sphingomyelin to ceramide, which then forms S1P by the enzyme sphingosine kinase. A discernible increase in S1P level has been shown to be associated with PAH (Chen et al. 2014). However, no evidence is currently available on the role of MMP-2 and Spm-Cer-S1P pathway in ET-1 induced increase in proliferation of pulmonary artery smooth muscle cells.

Tea contain polyphenols importantly catechins, of which epigallocatechin gallate (EGCG) is known to be the most biologically active compound and received special attention as prospective dietary intervention in vascular diseases (Chowdhury et al. 2016). EGCG has been shown to inversely associate with SMC migration and proliferation (Wang et al. 2014). Due to its role in inhibiting different ROS-mediated signalling pathways, EGCG attenuates progression of cardiac hypertrophy (Peng et al. 2010).

NADPH oxidase found in cells that transfers reducing equivalents from NADPH to oxygen resulting O2.- production. NADPH oxidase consists of membrane associated 91 kDa (gp91phox) and 22kDa (p22phox) subunits, and three cytosloic proteins p47phox, p67phox and a small GTPase Rac. Upon stimulation, the cytosolic components are translocated to the cell membrane for their assembly and to complex with gp91phox and p22phox to an active assembled form (Meyer and Schmitt 2000; Chakraborti et al. 2009). Apocynin, a well known inhibitor of NADPH oxidase, is known to prevent association of the p47phox and p67phox subunit of NADPH oxidase complex in the membrane, and inhibits O2.- production (Meyer and Schmitt 2000).

Herein, we determined the role of NADPH oxidase-MMP2-Spm-Cer-S1P pathway in ET-1 induced increase in proliferation of bovine PASMCs, and the role of the galloyl group containing catechins, EGCG in this scenario. We have also determined the role of EGCG on ET-1 induced increase in the association between p47phox and p67phox in the SMC membrane, and ascertained the binding of p47phox with EGCG by molecular modelling and docking studies. Our study suggests that EGCG by inhibiting NADPH oxidase-MMP2-Spm-Cer-S1P signalling axis attenuates ET-1 induced increase in proliferation of BPASMCs.

Materials and methods

Chemicals

BPASMCs were obtained from Cell Applications (San Diego, CA). Fetal calf serum (FCS), ET-1, GM6001, EGCG, EGC, GW4869 and PD98059 were the products of Sigma-Aldrich (St. Louis, MO, USA). MMP-2 inhibitor-I, monoclonal anti p47phox and monoclonal anti p67phox were obtained from Santa Cruz (Texas, USA). SKI-I was the product from Abcam (Cambridge, MA, USA). Polyclonal anti-MMP-2 antibody was obtained from Chemicon International Inc. (Temecula, CA, USA). Peroxidase (HRP)-conjugated goat anti-rabbit IgG was purchased from Zymed laboratories (San Francisco, CA, USA). Bichinchoninic acid (BCA) protein assay kit was purchased from Pierce (Rockford, IL). ETA, ETB, MMP-2, ERK-1, ERK-2, SMase, SPHK and scrambled siRNA duplexes were obtained from Integrated DNA Technologies (IDT) (San Jose, CA, USA) and also from Invitrogen (Carlsbad, CA, USA). Lipofectamine was the product of Invitrogen (Carlsbad, CA, USA).

Cell culture

BPASMCs were cultured in tissue culture flasks using DMEM supplemented with FCS (10%) and penicillin–streptomycin (2%) in a CO2 (5%) containing humidified chamber maintained at 37°C. All experiments were performed in serum free media and the cells were used between passages 5 and 10.

Cell proliferation assay

Colorimetric MTT assay was employed to determine proliferation of the smooth muscle cells. MTT is metabolized by NAD dependent dehydrogenase and forms a coloured product (formazan), which was measured at a wavelength of 562 nm.

Assay of NADPH oxidase derived O2.- formation

NADPH oxidase activity was determined by measuring O2.- generation by SOD inhibitable cytochrome c reduction assay (Chakraborti et al. 2017).

Gelatin Zymography

Gelatinase activities of the samples were analyzed by substrate-gel electrophoresis (zymography) using 0.1% gelatin as previously described (Das et al. 2004).

Western blot

Western blot was performed by following the procedure described by of Towbin (Towbin et al. 1979).

Assay of sphingomyelinase activity

Sphingomyelinase (SMase) activity was assayed using SMase activity assay kit (Echelon, Salt Lake City, USA) according to the manufacturer’s protocol.

Assay of S1P level

S1P level was determined using S1P assay kit (Echelon, Salt Lake City, USA) according to the manufacturer’s protocol.

Transfection of siRNA

ETA and ETB receptors, MMP-2, ERK-1, ERK-2, SMase and SPHK siRNA transfections to the cells were done with lipofectamine reagent as previously described (Sarkar et al. 2016). The siRNA duplexes described in Table 1 (obtained from IDT, San Jose, CA, USA) and Table- ST1 (obtained from Invitrogen, Carlsbad, CA, USA), respectively, were used in the present study.

Table 1.

SiRNA duplexes of ETA, ETB, MMP-2, SMase, SPHK, ERK-1 and ERK-2

ETA siRNA 5΄-UGACUUGUGAGAUGUUAAACCGAAG-3΄ and
5΄-CUUCGGUUUAACAUCUCACAAGUCAUG-3΄
ETB siRNA 5’-AGAAGAGUGGUAGCAAAUUGCCTT-3′ and
5’-AAGGCAAUUUGCAUACCACUCUUCUUU-3′
MMP-2 siRNA 5΄-GAACCAGAUCACAUACAGG-3΄ and
5΄- CUUGGUCUAGUGUAUGUCC-3΄
SMase siRNA 5΄-ACCCACCACCUACGAGAAGCGCCAG-3΄and
5΄-CUGGCGCUUCUCGUAGGUGGUGGGUAU-3΄
SPHK siRNA 5΄-UGGAGAAAGGCAGGCACAUGGAGUG-3΄ and
5΄-CACUCCAUGUGCCUGCCUUUCUCCAUG-3΄
ERK-1 siRNA 5΄-GACAGACCUGUACAAAUUGCUCAAA-3 and
5΄-UUUGAGCAAUUUGUACAGGUCUGUCUC-3΄
ERK-2 siRNA 5΄-GCUACACCAAUCUCUCGUACAUCGG-3΄ and
5΄-CCGAUGUACGAGAGAUUGGUGUAGCGC-3’
Open in a new tab

(obtained from IDT, San Jose, CA, USA)

RNA isolation and semiquantitative RT-PCR analysis

Total RNA was isolated with RNeasy Mini Kit (Qiagen) according to the manufacturer’s protocol. Semiquantitative RT-PCR analyses were performed using the primer pairs for ETA, ETB, MMP-2, ERK-1, ERK-2, SMase and SPHK (in the 5′–3′ direction) (Table 2) by following the procedure previously described (Sarkar et al. 2016).

Table 2.

Primer pairs for cDNA amplifications of ETA, ETB, MMP-2, SMase, SHPK, ERK-1, ERK-2 and β-actin

Forward pimer Reverse primer
ETA receptor ACATTCGCCATTCACCTTCG ACTGATGACACCTCCAACCA
ETB receptor CTGAGGCTGTGGGTTTTGAT AACAATGCAGTGATGGCCAG
MMP-2 TCTTACGACAGTTGCACCAC CACACCACAACTTCCCATCA
SMase TTTGACATCATCTGCGGAGA ACTCTCCAAGACCTTTTGCA
SHPK TGCTGGTGTTGTTAAATCCG ATCTCCGGACATGACCACCA
ERK-1 CCTTTGAGCATCAGACCTAC CAGGATCTGGTACAGGAAGT
ERK-2 AGTACAGGACCTCATGGAAA CTCTGTCAAGAACCCTGTGT
β-actin GAGCGGGAAATCGTCCGTGAC GTGTTGGCGTAAGGTCCTTGC
Open in a new tab

Estimation of protein

Proteins were estimated by BCA protein assay reagent using bovine serum albumin (BSA) as the standard (Smith et al. 1985).

Modelling and docking studies

Primary sequence of human NADPH oxidase p47phox subunit (1–390 amino acids) was downloaded from Uniprot (ID: P14598), and subjected to template-based threading and modelling server I-TASSER for full length structure modelling (Roy et al. 2010). The final structure of p47phox subunit was further refined by Smart Minimizer of Discovery Studio (DS) 2.5 with RMS gradient of 0.1 and its stereochemistry was validated through SAVES server http://services.mbi.ucla.edu/SAVES. Full length p47phox subunit contains mainly the N-terminal PX domain, SH3 domain and the C-terminal p47phox domain. Structures of green tea catechin EGCG (galloyl group containing) and EGC (devoid of galloyl group) were downloaded from Ligand Expo (Feng et al. 2004) and PubChem (Kim et al. 2016) databases. The catechins were prepared at pH 7.4 with salt concentration 0.1 M and their respective tautomers & isomers were generated. Finally, the catechins were allowed to dock at the reported binding site of p47phox near Cys378 (Mora-Pale et al. 2009; Yu et al. 2008; Kawahara and Lambeth 2007). Genetic Optimization for Ligand Docking (GOLD 5.2) software was used for docking with a defined binding cavity of 20 Å around the residue Cys378 (Jones et al. 1997). Ten binding poses for each isomeric/tautomeric ligand conformation were generated for both the catechins and were ranked on the basis of CHEMPLP fitness score (Chakraborti et al. 2018). The selected poses were further minimized in Smart Minimizer of DS 2.5 with RMS gradient of 0.1 followed by the calculation of their binding-free energy (dG) and interaction energies (IEs). The computational methods have been discussed in detail in our previous works (Bhuyan et al. 2015; Beswick et al. 2001; Newby 2006).

Statistical analysis

Data were analyzed by unpaired “t” test and analysis of variance (ANOVA) followed by the test of least significant differences for comparisons within and between the groups, and p<0.05 was considered significant (David 1978).

Results

Role of ET-1 on proliferation of PASMCs

Transfection of the cells with two distinct sets of ETA and ETB siRNAs markedly inhibited mRNA and protein expression of ETA and ETB receptors, respectively (Fig. 1a and b; S1A & B). Treatment of the SMCs with ET-1 increases the cell proliferation in a dose-dependent manner and 10 nM was determined to be the optimum concentration (Fig. 1c). Pretreatment of the cells with bosentan (Table 3) prevented ET-1 induced proliferation of the cells, which indicates that the effect of ET-1 on the cell proliferation was mediated via ET-1 receptor (Fig. 1d). Transfection of the cells with two distinct sets of ETA siRNAs, but not ETB siRNAs, inhibited ET-1 induced increase in the cell proliferation (Fig. 1e; S1C), which suggests that proliferation of the cells occurs through ETA receptor mediated pathway.

Fig. 1.

Fig. 1

Open in a new tab

Effect of ET-1 on proliferation of BPASMCs. a Effect of ETA and ETB siRNA transfection on ETA and ETB mRNA expression in the cells. b Effect of ETA and ETB siRNA transfection on ETA and ETB protein expression in the cells. c Dose-response profile of ET-1 induced proliferation of BPASMCs. d Effect of bosentan (ET-1 receptor antagonist) on ET-1 induced cell proliferation. e Effect of ETA and ETB siRNA transfection on ET-1 induced cell proliferation. ETA and ETB siRNA duplexes (presented in Table 1) were obtained from IDT, San Jose, CA, USA. β-actin was used as the loading control. Densitometric profiles are also shown. Results are mean ± SE (n = 4). ap < 0.05 compared with basal condition; and bp < 0.05 compared with ET-1 treatment

Table 3.

List of inhibitors with their properties

Inhibitor name Properties References
Bosentan Endothelin receptor inhibitor Chaumais et al. 2015
GW4869 SMase inhibitor Bautista-Pérez et al. 2015
SKI-I SPHK inhibitor Eisinger and Ammer 2009
GM6001 MMP general inhibitor Martin-Martin et al. 2011
MMP-2 inhibitor-I MMP-2 specific inhibitor Garanich et al. 2005
PD98059 ERK1/2 inhibitor Chen et al. 2014
Apocynin NADPH oxidase inhibitor Mora-Pale et al. 2009
Open in a new tab

Role of Spm-Cer-S1P axis in ET-1 induced cell proliferation

Transfection of the cells with two distinct sets of SMase and SPHK siRNAs inhibited SMase and SPHK mRNA and protein expression, respectively (Fig. 2a and b; S2A&B).

Fig. 2.

Fig. 2

Open in a new tab

Role of Spm–Cer–S1P pathway on ET-1-induced cell proliferation. a Effect of SMase and SPHK siRNA transfection to the cells on SMase and SPHK mRNA expression. b Effect of SMase and SPHK siRNA transfection on SMase and SPHK protein expression. c Effect of pretreatment with GW4869 (sphingomyelinase inhibitor) and SKI-I (SPHK inhibitor) on ET-1 induced cell proliferation. d Effect of SMase and SPHK siRNA transfection on ET-1 induced cell proliferation. e Time-response profile of ET-1 induced increase in SMase activity. f Effect of pretreatment with bosentan, GW4869 and SKI-I on ET-1 induced SMase activity in the cell lysate. g Effect of ETA, ETB, SMase and SPHK siRNA transfection to the cells on ET-1 induced SMase activity in the cell lysate. h Time-response profile of ET-1 effect on S1P level in the cell lysate. i Effect of pretreatment with bosentan, GW4869 and SKI-I on ET-1 induced S1P level in the cell lysate. j Effect of ETA, ETB, SMase and SPHK siRNA transfection to the cells on ET-1 induced S1P level in the cell lysate. k Time-response profile on ET-1 induced SPHK phosphorylation. l Effect of pretreatment with bosentan, GW4869 and SKI-I on ET-1 induced SPHK phosphorylation. m Effect of ETA, ETB, SMase and SPHK siRNA transfection on ET-1 induced SPHK phosphorylation. ETA, ETB, SMase and SPHK siRNA duplexes (presented in Table 1) were obtained from IDT, San Jose, CA, USA. β-actin was used as the loading control. Densitometric profiles are also shown. Results are mean ± SE (n = 4). ap < 0.05 compared with basal condition; and bp < 0.05 compared with ET-1 treatment

Pretreatment of the cells with GW4869 and SKI-I (Table 3) inhibited ET-1 induced increase in the smooth muscle cell proliferation (Fig. 2c). Transfection of the cells with two distinct sets of SMase and SPHK siRNA inhibited ET-1 induced increase in the cell proliferation (Fig. 2d; S2C).

ET-1 treatment to the cells resulted in an increase in SMase activity, S1P level and SPHK phosphorylation in a time dependent manner and the optimum time has been determined to be 6 h (Fig. 2e, h and k).

Pretreatment of the cells with bosentan and GW4869, but not SKI-I, inhibited ET-1 induced increase in the SMase activity (Fig. 2f). Transfection of the cells with two distinct sets of ETA and SMase siRNAs, but not two distinct sets of ETB and SPHK siRNAs, inhibited ET-1 induced increase in SMase activity (Fig. 2g; S2D). On the other hand, pretreatment of the cells with GW4869 markedly, while bosentan and SKI-I fully, inhibited ET-1-induced increase in S1P level (Fig. 2i). Transfection of the cells with two distinct sets of ETA, SMase and SPHK siRNAs, but not two distinct sets of ETB siRNAs, inhibited ET-1 induced increase in S1P level (2J; S2E). Pretreatment of the cells with bosentan and SKI-I, but not GW4869, inhibited ET-1 induced increase in SPHK phosphorylation (Fig. 2l). Transfection of the cells with two distinct sets of ETA and SPHK siRNAs, but not two distinct sets of ETB and SMase siRNAs, inhibited ET-1 induced increase in SPHK phosphorylation (Fig. 2m; S2F).

The above results suggest that ET-1 induced cell proliferation occurs via increase in the production of S1P upon ETA receptor mediated activation of SMase and also SPHK phosphorylation. ET-1 treatment to the cells increases S1P level, which markedly, but not fully, returns to basal level upon inhibition of SMase activity; however, ET-1 induced increase in S1P level has been observed to be completely attenuated by inhibition of SPHK phosphorylation.

Role of MMP-2 and ERK1/2 in Spm–Cer–S1P axis mediated ET-1 induced cell proliferation

Transfection of the cells with two distinct sets of MMP-2 and ERK1/2 siRNAs significantly attenuated MMP-2 and ERK1/2 mRNA expression (Fig. 3a; S3A). Pretreatment of the cells with GM6001, MMP-2 inhibitor-I and PD98059 (Table 3) attenuated ET-1 caused cell proliferation (Fig. 3b). Pretreatment of the cells with MMP-2 inhibitor-I, but not PD98059, prevented ET-1 induced increase in SMase activity (Fig. 3d), while pretreatment with MMP-2 inhibitor-I and PD98059 attenuated ET-1 induced increase in S1P production (Fig. 3f). However, pretreatment of the cells with PD98059, but not MMP-2 inhibitor-I, attenuated ET-1 stimulated SPHK phosphorylation (Fig 3h). Transfection of the cells with two distinct sets of MMP-2 and ERK1/2 siRNAs followed by treatment with ET-1 showed similar pattern of results obtained using their chemical inhibitors (Fig. 3c, e, g and i; S3B,C,D & E).

Fig. 3.

Fig. 3

Open in a new tab

Role of MMP-2 and ERK 1/2 in Spm–Cer–S1P signaling pathway on ET-1 induced cell proliferation. a Effect of MMP-2, ERK-1 and ERK-2 siRNA transfection on MMP-2, ERK-1 and ERK-2 mRNA expression. b Effect of pretreatment with GM6001 (MMP general inhibitor), MMP-2 inhibitor-I and PD98059 (ERK1/2 inhibitor) on ET-1 induced cell proliferation. c Effect of MMP-2, ERK-1 and ERK-2 siRNA transfection on ET-1 induced cell proliferation. d Effect of pretreatment with MMP-2 inhibitor-I and PD98059 on ET-1 induced SMase activity in the cell lysate. e Effect of MMP-2, ERK-1 and ERK-2 siRNA transfection on ET-1 induced SMase activity in the cell lysate. f Effect of pretreatment of MMP-2 inhibitor-I and PD98059 on S1P level in the cell lysate. g Effect of MMP-2, ERK-1 and ERK-2 siRNA transfection on ET-1 induced S1P level in the cell lysate. h Effect of MMP-2 inhibitor-I and PD98059 on ET-1 induced SPHK phosphorylation. i Effect of MMP-2, ERK-1 and ERK-2 siRNA transfection on ET-1 induced SPHK phosphorylation. MMP-2, ERK-1, ERK-2 siRNA duplexes (presented in Table 1) were obtained from IDT, San Jose, CA, USA. β-actin was used as the loading control. Densitometric profiles are also shown. Results are mean ± SE (n = 4). ap < 0.05 compared with basal condition; and bp < 0.05 compared with ET-1 treatment alone

The above results suggest that ET-1 induced cell proliferation occurs with the involvement of MMP-2 and ERK1/2. Both MMP-2 and ERK1/2 are involved in S1P production; however, MMP-2 elicits its action via activation of SMase, while ERK1/2 shows its action via phosphorylation of SPHK.

Role of different inhibitors on ET-1 induced ERK1/2 activation

ET-1 treatment stimulated ERK1/2 phosphorylation in a time-dependent manner, and 4h was determined to be the optimum time for the ET-1 response (Fig. 4a). Pretreatment of the cells with bosentan, apocynin, PD98059 (Table 3) prevented ET-1 induced increase in ERK1/2 phosphorylation (Fig. 4b). However, pretreatment of the cells with MMP-2 inhibitor-I, GW4869 and SKI-I did not show any discernible change in ET-1 response on ERK1/2 phosphorylation (Fig. 4b).

Fig. 4.

Fig. 4

Open in a new tab

Role of ET-1 on ERK1/2 activation in the cells. a Effect of ET-1 on ERK1/2 expression and ERK1/2 phosphorylation in the cell lysate. b Effect of bosentan, apocynin, PD98059, GW4869, SKI-I and MMP-2 inhibitor-I on ET-1 induced ERK1/2 phosphorylation in the cell lysate. β-actin was used as the loading control. Densitometric profiles are also shown. Results are mean ± SE (n = 4). ap < 0.05 compared with basal condition; and bp < 0.05 compared with ET-1 treatment

Role of ET-1 in NADPH oxidase -mediated proMMP-2 expression and activation and the cell proliferation

ET-1 treatment to the cells elicited time dependent increase in proMMP-2 (72 kDa) and MMP-2 (66 kDa) gelatinolytic activity in the cell culture supernatant, and 24 h was determined to be the optimum time for proMMP-2 activation (Fig. 5a). Immunoblot study with the cell culture supernatant revealed that ET-1 time-dependently increased proMMP-2 (72 kDa) and MMP-2 (66 kDa) expression (Fig. 5b). MMP-2 mRNA expression was determined to be up regulated in a time dependent manner during ET-1 stimulation and the optimal expression was determined to be 24 h (Fig. 5c).

Fig. 5.

Fig. 5

Open in a new tab

Role of ET-1 on proMMP-2 expression and activation in the cells. Effect of ET-1 on time response profile of proMMP-2 and MMP-2 (a) activation by gelatin zymography; and (b) protein expression by Western blot in the cell culture supernatant. c Time-response profile of ET-1 induced MMP-2 mRNA expression in the cells. Densitometric profiles are also shown. Results are mean ± SE (n = 4). ap < 0.05; and bp < 0.05 compared with basal condition

Gelatin zymography and western blot study showed that apocynin pretreatment significantly inhibited ET-1 induced increase in MMP-2 expression and activation (Fig. 6a and b). RT-PCR study revealed that apocynin pretreatment markedly inhibited ET-1 induced MMP-2 mRNA expression (Fig. 6c).

Fig. 6.

Fig. 6

Open in a new tab

Role of NADPH oxidase derived O2·–in ET-1 induced proMMP-2 expression and activation and proliferation of the cells. Effect of pretreatment with apocynin on ET-1 induced proMMP-2 and MMP-2 (a) activation; and (b) protein expression in the cell culture supernatant. c Effect of pretreatment with apocynin on ET-1 induced MMP-2 mRNA expression in the cells. β-actin was used as the loading control. Densitometric profiles are also shown. d Effect of pretreatment with apocynin on ET-1 induced cell proliferation. e Time response profile of the effect of ET-1 on NADPH oxidase activity in the cell lysate. f Effect of apocynin and MMP-2 inhibitor-I on ET-1 induced NADPH oxidase activity in the cell lysate. Results are mean ± SE (n = 4). ap < 0.05 compared with basal condition; and bp < 0.05 compared with ET-1 treatment

Apocynin pretreatment to the cells prevented ET-1 induced proliferation of the SMCs (Fig. 6d).

Treatment of the cells with ET-1 stimulated NADPH oxidase derived O2·– production in a time dependent manner and 10 min was determined to be the optimum time for NADPH oxidase activation in the SMCs (Fig. 6e).

Pretreatment with apocynin, but not MMP-2 inhibitor-I, inhibited ET-1 induced increase in NADPH oxidase activity in the cells (Fig. 6f).

The above results suggest that ET-1 mediated increase in the cell proliferation occurs via stimulation of NADPH oxidase derived O2.- production, which subsequently activates MMP-2 in the cells.

Role of ET-1 in NADPH oxidase-mediated stimulation of SMase activity, S1P level and SPHK phosphorylation

Pretreatment of the SMCs with apocynin markedly inhibited the ET-1 induced increase in SMase activity (Fig. 7a), S1P level (Fig. 7b) and SPHK phosphorylation (Fig. 7c).

Fig. 7.

Fig. 7

Open in a new tab

Role of NADPH oxidase derived O2·–in ET-1 induced SMase activity, S1P level and SPHK phosphorylation in the cells. Effect of apocynin on ET-1 induced (a) SMase activity, b S1P level and c SPHK phosphorylation the cell lysate. β-actin was used as the loading control. Densitometric profiles are also shown. Results are mean ± SE (n = 4). ap < 0.05 compared with basal condition; and bp < 0.05 compared with ET-1 treatment

Role of EGCG/EGC on ET-1 induced increase in SMase and SPHK activities, S1P level, ERK1/2 phosphorylation and the cell proliferation

Pretreatment of the cells with EGCG, but not EGC, dose-dependently inhibited ET-1 induced increase in the SMCs proliferation. The optimum concentration of EGCG to inhibit the ET-1 induced cell proliferation was determined to be 50 μM (Fig. 8).

Fig. 8.

Fig. 8

Open in a new tab

Role of EGCG/EGC on ET-1 induced proliferation of the cells. Dose-response profile of the effect of EGCG/EGC on ET-1 induced proliferation of the SMCs. Results are mean ± SE (n = 4). ap < 0.05 compared with basal condition; and bp < 0.05 compared with ET-1 treatment

Pretreatment of the cells with EGCG, but not EGC, markedly inhibited ET-1 induced increase in SMase activity, S1P level, SPHK and ERK1/2 phosphorylations (Fig. 9a–d).

Fig. 9.

Fig. 9

Open in a new tab

Role of EGCG/EGC on ET-1-induced SMase activity, SPHK activation, S1P level and ERK 1/2 phosphorylation in the cells. Effect of EGCG/EGC on ET-1 induced (a) SMase activity. b S1P level. c SPHK phosphorylation; and d ERK1/2 phosphorylation in the cell lysate. β-actin was used as the loading control. Densitometric profiles are also shown. Results are mean ± SE (n = 4). ap < 0.05 compared with basal condition; and bp < 0.05 compared with ET-1 treatment

Role of EGCG/EGC on ET-1- induced increase in proMMP-2 expression and activation and NADPH oxidase activation

Gelatin zymogram and western blot studies showed that EGCG, but not EGC, attenuates ET-1 induced increase in proMMP-2 activation and expression, respectively (Fig. 10a and b). RT-PCR study showed that EGCG, but not EGC, pretreatment markedly inhibited ET-1-induced increase in MMP-2 mRNA expression in the cells (Fig. 10c).

Fig. 10.

Fig. 10

Open in a new tab

Effect of EGCG/EGC on ET-1-induced expression and activation of proMMP-2, NADPH oxidase activity, and association between p47phox and p67phox in the cells. Effect of pretreatment with EGCG/EGC on ET-1 induced activation and expression of proMMP-2 determined by (a) gelatine zymography; and b Western blot; c Effect of pretreatment with EGCG/EGC on ET-1 induced MMP-2 mRNA expression in the cells. d Effect of pretreatment with EGCG/EGC on ET-1 induced NADPH oxidase activity in the cell membrane fraction. e Communoprecipitaion of p47phox with p67phox in the cell membrane fraction isolated upon pretreatment of the cells with EGCG/EGC followed by addition of ET-1. β-actin was used as loading control. Densitometric profiles are also shown. Results are mean ± SE (n = 4). ap < 0.05 compared with basal condition; and bp < 0.05 compared with ET-1 treatment

Pretreatment of the cells with EGCG markedly inhibited ET-1 induced increase in NADPH oxidase activity, whereas EGC did not show any discernible effect (Fig. 10d).

Role of EGCG/EGC on ET-1 induced association between p47phox and p67phox

Immunoblot study revealed that treatment of the cells with ET-1 showed association between p47phox and p67phox in the cell membrane. Pretreatment of the cells with EGCG, but not EGC, inhibited ET-1 induced association of p47phox with p67phox in the cell membrane (Fig. 10e).

Binding of p47phox subunit of NADPH oxidase with EGCG/ EGC

To explore the binding mode of NADPH oxidase inhibition, computational docking was performed by taking phosphoinositide binding of p47phox subunit of NADPH oxidase with the tea catechins, EGC & EGCG. Among EGCG and EGC, the galloyl group containing EGCG inhibits the p47phox at its PX domain more significantly than the EGC. The PX domain of p47phox subunit usually resides in cytosolic part and preferentially binds phosphatidylinositol-3,4-bisphosphate, resulting in increase in membrane affinity. The interaction of catechins with p47phox subunit was characterized by number of hydrogen bonds (H-bond), π-interaction, interaction energies (IE) in terms of electrostatic (elec) and van der Waals (vdW) interactions (Table 4). The binding free energy (dG), which is a key parameter to study the affinity of compounds, was calculated to be -33.53 kcal/mol for EGCG; whereas for EGC, it was witnessed only -20.95 kcal/mol (Fig. 11a). Similarly, a considerable difference in interaction energy between p47phox subunit-EGCG/EGC was also observed, where the electrostatic interaction prevailed than the hydrophobic/van der Waals interactions (Fig. 11b). The residues that participate with the interaction with catechins form seven H-bonds, two π-π, and 388 neighbouring contacts with galloyl group containing EGCG. Among them, Tyr24, Tyr26, Asp82, Gly83, Gln84, Arg90 are important in contributing various interactions with EGCG (Fig. 11c). On the other hand, EGC procured only 260 atomic contacts, four H-bonds and one π- π interaction (Fig. 11d). The 3D representation of p47phox subunit-EGCG/EGC interaction is represented in Fig. 11e and f.

Table 4.

Key residues of p47phox interacting with EGCG/EGC

p47phox-EGCG p47phox-EGC
PHE14 PHE14
SER21
GLN22 GLN22
HIS23 HIS23
TYR24 TYR24
VAL25 VAL25
TYR26 TYR26
ARG43 ARG43
PHE44 PHE44
THR45 THR45
TRP80
PHE81 PHE81
ASP82 ASP82
GLY83 GLY83
GLN84 GLN84
ARG85 ARG85
ALA86 ALA86
ALA87 ALA87
GLU88 GLU88
ARG90 ARG90
ASP151
ILE152
Open in a new tab

Residues that form hydrogen bonds are underlined; that take participate in π-π interaction are mentioned as italics; that contribute interaction energy < −4 kcal/mol are marked as bold

Fig. 11.

Fig. 11

Open in a new tab

Interaction of EGCG/EGC with NADPH oxidase p47phox subunit. a Comparison of interaction energies (Total IE), van der Walls energies (vdW), electrostatic energies (elec) and binding free energies (dG) by EGCG and EGC. b Residues that contributed interaction energy < − 4 kcal/mol. c 2D representation of p47phox-EGCG (red) interaction. d 2D representation of p47phox-EGC (green) interaction. e 3D ribbon representation of p47phox-EGCG (red) complex. f 3D ribbon representation of p47phox-EGC (green) complex

Discussion

The present study suggests that ET-1 stimulates proliferation of BPASMCs by inducing MMP2-mediated Spm-Cer-S1P signalling pathway, and that has been observed to be inhibited upon pretreatment with EGCG. We also observed that EGCG attenuates ET-1 induced increase in proMMP-2 expression and activation by inhibiting NADPH oxidase activity.

An important aspect in pulmonary vascular diseases is the dysregulation in proMMP-2 activation. O2.- has been shown to play a crucial role in proMMP-2 expression and activation (Mandal et al. 2005, 2004). The present study suggests that ET-1 augments O2.- production via ET(R)-NADPH oxidase dependent mechanism. This is evident from the observation that pretreatment of the cells with bosentan (ET receptor antagonist) and apocynin (NADPH oxidase inhibitor) attenuate the response produced by ET-1. ET-1 upon binding to its receptor elicits a plethora of cellular responses by stimulating various intracellular pathways. Our present study suggests that ET-1 markedly increases the SMC proliferation upon activation of ETA receptor, which is evident from the observation that pretreatment with ETA siRNA attenuates ET-1 induced increase in the SMC proliferation.

ROS-mediated dysregulation of cell signalling processes have been suggested to play important roles in different types of cardiovascular diseases (Chelladurai et al. 2012). Vascular SMC proliferation has been shown to occur upon stimulation of NADPH oxidase activity (Djordjevic et al. 2005). ET-1 induced NADPH oxidase derived O2.- has been shown to phosphorylate ERK1/2 and that subsequently augments vascular SMC proliferation (Kyaw et al. 2002). A previous report indicated involvement of MMP-2 in vascular smooth muscle cell proliferation (Newby 2006). However, the role of MMP-2 in ET-1 mediated pulmonary artery smooth muscle cell proliferation and the underlying mechanism(s) is currently unknown. In a recent study, we observed that ET-1 induced increase in proMMP-2 expression and activation occurs via stimulation of NADPH oxidase activity (Sarkar et al. 2016). A pertinent question that may arise at this stage is whether proliferation of BPASMCs induced by ET-1 is linked with NADPH oxidase. The following pieces of evidence strongly support the involvement of NADPH oxidase derived O2.- in MMP-2 mediated ET-1 induced PASMC proliferation. These are: (i) pretreatment of the cells with NADPH oxidase inhibitor, apocynin inhibited ET-1 induced increase in proliferation of the cells; (ii) pretreatment of the cells with apocynin inhibited ET-1 induced proMMP-2 expression and activation; and (iii) pretreatment of the cells with the MMP-2 specific inhibitor, MMP-2 inhibitor-1, attenuates ET-1 induced increase in the SMC proliferation.

Sphingomyelin (Spm) can be converted to ceramide (Cer) by neutral sphingomyelinase, which in turn forms sphingosine, and then produces sphingosine-1-phosphate (S1P) by the action of sphingosine kinase (SPHK). Sphingosine-Ceramide pathway has been shown to play a pivotal role in oxLDL induced SMC proliferation (Augé et al. 2004). S1P generated by SPHK is known to play an important role in pulmonary hypertension and subsequently promotes PASMC proliferation (Chen et al. 2014). Importantly, MMP-2 was shown to contribute to oxLDL induced activation of Spm-Cer signalling axis and that in turn produces the SMC proliferation (Augé et al. 2004). A previous research indicated that Spm-Cer-S1P pathway contributes to tissue plasminogen activator (tPA) induced mitogenic signalling pathways (Maupas-Schwalm et al. 2004).

In the present study we observed an increase in SMase activity and S1P level and proliferation of BPASMCs upon treatment with ET-1. The ET-1 induced responses were observed to be inhibited upon pretreatment of the cells with pharmacological and genetic inhibitors of SMase and SPHK. Taken together, these observations suggest that ET-1 induced proliferation of the SMCs occur via Spm-Cer-S1P signalling axis. Our present study also demonstrate that pretreatment of the SMCs with both pharmacological and genetic inhibitors of MMP-2 significantly attenuate ET-1 induced stimulation of SMase activity and S1P level and subsequently the smooth muscle cell proliferation. Thus, MMP-2 plays a crucial role in inducing the SMCs proliferation by activating the Spm-Cer-S1P signalling axis during ET-1 stimulation.

ET-1 treatment to the cells increases S1P level, which markedly, but not fully, returns to basal condition upon pretreatment with the pharmacological and genetic inhibitors of SMase. However, ET-1 induced increase in S1P level has been observed to be completely inhibited by both the pharmacological and genetic inhibitors of SPHK. This suggests that S1P production by ET-1 in the cells occurs via involvement of Spm-Cer-S1P signalling pathway. Notably, chemical and genetic inhibitors of SMase are unable to inhibit ET-1 induced SPHK phosphorylation in the cells. However, these inhibitors significantly, but not fully, attenuate S1P production. This suggests that other component(s) also play important roles in the increase in S1P production during SPHK activation by ET-1 in the cells. Our present study also suggests that SPHK activation occurs via ERK1/2, which is evident by the following observations: (i) ET-1 treatment to the cells augments ERK1/2 phosphorylation; and (ii) the ERK1/2 inhibitor, PD98059 attenuates ET-1 induced increase in SPHK phosphorylation.

EGCG is known to ameliorate pulmonary hypertension (Zhu et al. 2017). EGCG has been shown to attenuate PDGF and FGF induced increase in vascular smooth muscle cell proliferation (Hwang et al. 2002; Sachinidis et al. 2002; Weber et al. 2004). In CL1-5 lung cancer cells, EGCG has been observed to attenuate SMC proliferation by suppressing MMP-2 expression and activation (Deng and Lin 2011).

Our study suggest that EGCG markedly attenuate ET-1 induced increase in MMP-2 activity, SMase activity, S1P level, SPHK and ERK1/2 phosphorylation and the SMC proliferation. The inhibitory effect of EGCG on ET-1 induced increase in the above parameters that leads to increase in SMCs proliferation appears to be due to the inhibition of NADPH oxidase activity. Our present study also suggests that EGCG inhibits ET-1 induced association of p47 phox with p67phox in the cell membrane. Inhibition of the association of p47phox with p67phox by EGCG is also in keeping with our computational study. Our docking studies clearly indicate that galloyl group of EGCG is responsible for producing more than 30% higher binding free energy in occluding the PX domain of p47phox. The PX domain of p47phox is very much important as it has a role in translocation and protein-protein interaction. Presence of many charged residues at the binding site was clearly justified, producing more electrostatic interaction than the van der Walls or hydrophobic. Interestingly, due to lack of galloyl group, EGC is unable to show any distinct inhibitory effect towards p47phox, which is evident from minimum numbers of atomic contacts, H-bonds and π-π interactions. Thus, p47phox appears to be the target of EGCG, which by inhibiting association between p47phox and p67phox in the cell membrane leads to inhibition of ET-1 induced increase in NADPH oxidase derived O2.- production. EGCG appears to inhibit NADPH oxidase activity in a similar way to that of apocynin. This is based on a previous report that apocynin selectively hinder assembly of p47 with p67phox, components of NADPH oxidase complex, thereby inhibiting activation of NADPH oxidase (Beswick et al. 2001).

Thus, EGCG caused attenuation of ET-1 induced proliferation of BPASMCs appears to occur via inhibition of NADPH oxidase-MMP2-Spm-Cer-S1P signalling pathway. Figure 12 schematically represents the underlying mechanism of ET-1 induced proliferation of BPASMCs, and the role of EGCG in this scenario.

Fig. 12.

Fig. 12

Open in a new tab

Schematic representation of the role of EGCG in the ET-1 induced proliferation of the BPASMCs. Red marked portion of the structure of EGCG indicates the galloyl group

Conclusion

The present study suggests that the Spm-Cer-S1P pathway mediates ET-1 induced increase in proliferation of BPASMCs, which occurs via involvement of NADPH oxidase derived O2.- -mediated stimulation of MMP-2 activity. EGCG inhibits NADPH oxidase activity by preventing association between p47phox and p67phox (components of NADPH oxidase complex) in the cell membrane, thereby inhibiting MMP2-Spm-Cer-S1P signaling axis leading to inhibition of the SMCs proliferation. The molecular docking study suggests that p47phox is a potential target of the galloyl group of EGCG.

Electronic supplementary material

ESM 1 (18.9KB, docx)

(DOCX 18 kb)

Fig. S1 (70.5KB, png)

(PNG 70 kb)

High Resolution (TIF 70 kb) (70.1KB, tif)
Fig. S2 (148.5KB, png)

(PNG 148 kb)

High Resolution (TIF 130 kb) (130.1KB, tif)
Fig. S3 (109.5KB, png)

(PNG 109 kb)

High Resolution (TIF 104 kb) (104.1KB, tif)
ESM 2 (12.7KB, docx)

(DOCX 12 kb)

Acknowledgements

We greatly acknowledge University Grants Commission, New Delhi for providing Rajiv Gandhi National Fellowship (RGNF) to Jaganmay Sarkar. We are also thankful to the Bioinformatics Infrastructure Facility (BIF), University of Kalyani, West Bengal, India for the computational study.

Compliance with ethical standards

Conflict of interest

Authors declare that there is no conflict of interest.

Footnotes

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Contributor Information

Jaganmay Sarkar, Email: sarkarjaganmay@gmail.com.

Tapati Chakraborti, Email: tcbiochem@gmail.com.

Animesh Chowdhury, Email: animeshchowdhury9@gmail.com.

Rajabrata Bhuyan, Email: rajabrata001@gmail.com.

Sajal Chakraborti, Email: sajal_chakraborti@yahoo.com.

References

  1. Augé N, Maupas-Schwalm F, Elbaz M, Thiers JC, Waysbort A, Itohara S, Krell HW, Salvayre R, Nègre-Salvayre A. Role for matrix metalloproteinase-2 in oxidized low-density lipoprotein-induced activation of the sphingomyelin/ceramide pathway and smooth muscle cell proliferation. Circulation. 2004;110:571–578. doi: 10.1161/01.CIR.0000136995.83451.1D. [DOI] [PubMed] [Google Scholar]
  2. Bautista-Pérez R, del Valle-Mondragón L, Cano-Martínez A, Pérez-Méndez O, Escalante B, Franco M. Involvement of neutral sphingomyelinase in the angiotensin II signaling pathway. Am J Physiol Renal Physiol. 2015;308:F1178–F1187. doi: 10.1152/ajprenal.00079.2014. [DOI] [PubMed] [Google Scholar]
  3. Beswick RA, Dorrance AM, Leite R, Webb RC. NADH/ NADPH oxidase and enhanced superoxide production in the mineralocorticoid hypertensive rat. Hypertension. 2001;38:1107–1111. doi: 10.1161/hy1101.093423. [DOI] [PubMed] [Google Scholar]
  4. Bhuyan R, Nandy SK, Seal A. An in silico structural insights into Plasmodium LytB protein and its inhibition. J Biomol Struct Dyn. 2015;33:1198–1210. doi: 10.1080/07391102.2014.938248. [DOI] [PubMed] [Google Scholar]
  5. Chakraborti S, Mandal M, Das S, Mandal A, Chakraborti T. Regulation of matrix metalloproteinases. Mol Cell Biochem. 2003;253:269–285. doi: 10.1023/a:1026028303196. [DOI] [PubMed] [Google Scholar]
  6. Chakraborti S, Chowdhury A, Kar P, Das P, Shaikh S, Roy S, Chakraborti T. Role of protein kinase C in NADPH oxidase derived O2*(−)-mediated regulation of KV-LVOCC axis under U46619 induced increase in [Ca2+]i in pulmonary smooth muscle cells. Arch Biochem Biophys. 2009;487:123–130. doi: 10.1016/j.abb.2009.05.015. [DOI] [PubMed] [Google Scholar]
  7. Chakraborti S, Chowdhury A, Chakraborti T. Cross-talk between p38MAPK and Giα in regulating cPLA2 activity by ET-1 in pulmonary smooth muscle cells. Mol Cell Biochem. 2015;400:107–123. doi: 10.1007/s11010-014-2267-0. [DOI] [PubMed] [Google Scholar]
  8. Chakraborti S, Sarkar J, Chowdhury A, Chakraborti T. Role of ADP ribosylation factor6- Cytohesin1-PhospholipaseD signaling axis in U46619 induced activation of NADPH oxidase in pulmonary artery smooth muscle cell membrane. Arch Biochem Biophys. 2017;633:1–14. doi: 10.1016/j.abb.2017.08.012. [DOI] [PubMed] [Google Scholar]
  9. Chakraborti S, Sarkar J, Bhuyan R, Chakraborti T. Role of curcumin in PLD activation by Arf6-cytohesin1 signaling axis in U46619-stimulated pulmonary artery smooth muscle cells. Mol Cell Biochem. 2018;438:1–13. doi: 10.1007/s11010-017-3117-7. [DOI] [PubMed] [Google Scholar]
  10. Chaumais MC, Guignabert C, Savale L, Jaïs X, Boucly A, Montani D, Simonneau G, Humbert M, Sitbon O. Clinical pharmacology of endothelin receptor antagonists used in the treatment of pulmonary arterial hypertension. Am J Cardiovasc Drugs. 2015;15:13–26. doi: 10.1007/s40256-014-0095-y. [DOI] [PubMed] [Google Scholar]
  11. Chelladurai P, Seeger W, Pullamsetti SS. Matrix metalloproteinases and their inhibitors in pulmonary hypertension. Eur Respir J. 2012;40:766–782. doi: 10.1183/09031936.00209911. [DOI] [PubMed] [Google Scholar]
  12. Chen QW, Edvinsson L, Xu CB. Role of ERK/MAPK in endothelin receptor signaling in human aortic smooth muscle cells. BMC Cell Biol. 2009;3:10–52. doi: 10.1186/1471-2121-10-52. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Chen J, Tang H, Sysol JR, Moreno-Vinasco L, Shioura KM, Chen T, Gorshkova I, Wang L, Huang LS, Usatyuk PV, Sammani S, Zhou G, Raj JU, Garcia JG, Berdyshev E, Yuan JX, Natarajan V, Machado RF. The sphingosine kinase 1/sphingosine-1-phosphate pathway in pulmonary arterial hypertension. Am J Respir Crit Care Med. 2014;190:1032–1043. doi: 10.1164/rccm.201401-0121OC. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Chowdhury A, Sarkar J, Chakraborti T, Pramanik PK, Chakraborti S. Protective role of epigallocatechin-3-gallate in health and disease: a perspective. Biomed Pharmacother. 2016;78:50–59. doi: 10.1016/j.biopha.2015.12.013. [DOI] [PubMed] [Google Scholar]
  15. Das S, Mandal M, Chakraborti T, Mandal A, Chakraborti S. Isolation of MMP-2 from MMP-2/TIMP-2 complex: characterization of the complex and the free enzyme in pulmonary vascular smooth muscle plasma membrane. Biochim Biophys Acta. 2004;1674:158–174. doi: 10.1016/j.bbagen.2004.06.013. [DOI] [PubMed] [Google Scholar]
  16. David WW. In biostatistics: A foundation for analysis in health sciences. New York: Wiley; 1978. p. 219. [Google Scholar]
  17. Deng YT, Lin JK. EGCG inhibits the invasion of highly invasive CL1-5 lung cancer cells through suppressing MMP-2 expression via JNK signaling and induces G2/M arrest. J Agric Food Chem. 2011;59:13318–13327. doi: 10.1021/jf204149c. [DOI] [PubMed] [Google Scholar]
  18. Djordjevic T, BelAiba RS, Bonello S, Pfeilschifter J, Hess J, Görlach A. Human urotensin II is a novel activator of NADPH oxidase in human pulmonary artery smooth muscle cells. Arterioscler Thromb Vasc Biol. 2005;25:519–525. doi: 10.1161/01.ATV.0000154279.98244.eb. [DOI] [PubMed] [Google Scholar]
  19. Eisinger DA, Ammer H. Down-regulation of c-CbI by morphine accounts for persistent ERK1/2 signaling in delta-opioid receptor-expressing HEK293 cells. J Biol Chem. 2009;284:34819–34828. doi: 10.1074/jbc.M109.042937. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Feng Z, Chen L, Maddula H, Akcan O, Oughtred R, Berman HM, Westbrook J. Ligand depot: a data warehouse for ligands bound to macromolecules. Bioinformatics. 2004;20:2153–2155. doi: 10.1093/bioinformatics/bth214. [DOI] [PubMed] [Google Scholar]
  21. Garanich JS, Pahakis M, Tarbell JM. Shear stress inhibits smooth muscle cell migration via nitric oxide-mediated downregulation of matrix metalloproteinase-2 activity. Am J Physiol Heart Circ Physiol. 2005;288:H2244–H2252. doi: 10.1152/ajpheart.00428.2003. [DOI] [PubMed] [Google Scholar]
  22. He S, Prasanna G, Yorio T. Endothelin-1-mediated signaling in the expression of matrix metalloproteinases and tissue inhibitors of metalloproteinases in astrocytes. Invest Ophthalmol Vis Sci. 2007;48:3737–3745. doi: 10.1167/iovs.06-1138. [DOI] [PubMed] [Google Scholar]
  23. Hwang KC, Lee KH, Jang Y, Yun YP, Chung KH. Epigallocatechin-3-gallate inhibits basic fibroblast growth factor-induced intracellular signaling transduction pathway in rat aortic smooth muscle cells. J Cardiovasc Pharmacol. 2002;39:271–277. doi: 10.1097/00005344-200202000-00014. [DOI] [PubMed] [Google Scholar]
  24. Jones G, Willett P, Glen RC, Leach AR, Taylor R. Development and validation of a genetic algorithm for flexible docking. J Mol Biol. 1997;267:727–748. doi: 10.1006/jmbi.1996.0897. [DOI] [PubMed] [Google Scholar]
  25. Kawahara T, Lambeth JD. Molecular evolution of Phox-related regulatory subunits for NADPH oxidase enzymes. BMC Evol Biol. 2007;7:178. doi: 10.1186/1471-2148-7-178. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Khalil RA. Modulators of the vascular endothelin receptor in blood pressure regulation and hypertension. Curr Mol Pharmacol. 2011;4:176–186. doi: 10.2174/1874467211104030176. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Kim FY, Barnes EA, Ying L, Chen C, Lee L, Alvira CM, Cornfield DN. Pulmonary artery smooth muscle cell endothelin-1 expression modulates the pulmonary vascular response to chronic hypoxia. Am J Physiol Lung Cell Mol Physiol. 2015;308:L368–L377. doi: 10.1152/ajplung.00253.2014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Kim S, Thiessen PA, Bolton EE, Chen J, Fu G, Gindulyte A, Han L, He J, He S, Shoemaker BA, Wang J, Yu B, Zhang J, Bryant SH. PubChem substance and compound databases. Nucleic Acids Res. 2016;44:D1202–D1213. doi: 10.1093/nar/gkv951. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Kyaw M, Yoshizumi M, Tsuchiya K, Kirima K, Suzaki Y, Abe S, Hasegawa T, Tamaki T. Antioxidants inhibit endothelin-1 (1-31)-induced proliferation of vascular smooth muscle cells via the inhibition of mitogen-activated protein (MAP) kinase and activator protein-1 (AP-1) Biochem Pharmacol. 2002;64:1521–1531. doi: 10.1016/s0006-2952(02)01349-7. [DOI] [PubMed] [Google Scholar]
  30. Lambeth JD. NOX enzymes and the biology of reactive oxygen. Nat Rev Immunol. 2004;4:181–189. doi: 10.1038/nri1312. [DOI] [PubMed] [Google Scholar]
  31. Lassegue B, Clempus RE. Vascular NAD(P)H oxidases: specific features, expression, and regulation. Am J Physiol Regul Integr Comp Physiol. 2003;285:R277–R297. doi: 10.1152/ajpregu.00758.2002. [DOI] [PubMed] [Google Scholar]
  32. Mandal A, Chakraborti T, Das S, Ghosh B, Ghosh A, Chakraborti S. Matrix metalloproteinase-2-mediated inhibition of Na+-dependent Ca+ uptake by superoxide radicals (O2.-) in microsomes of pulmonary smooth muscle. IUBMB Life. 2004;56:267–276. doi: 10.1080/1521654041000171335. [DOI] [PubMed] [Google Scholar]
  33. Mandal A, Chakraborti T, Choudhury R, Ghosh B, Ghosh AN, Das S, Chakraborti S. Role of MMP-2 in inhibiting Na+ dependent Ca2+ uptake by H2O2 in microsomes isolated from pulmonary smooth muscle. Mol Cell Biochem. 2005;270:79–87. doi: 10.1007/s11010-005-5260-9. [DOI] [PubMed] [Google Scholar]
  34. Martin-Martin B, Tovell V, Dahlmann-Noor AH, Khaw PT, Bailly M. The effect of MMP inhibitor GM6001 on early fibroblast-mediated collagen matrix contraction is correlated to a decrease in cell protrusive activity. Eur J Cell Biol. 2011;90:26–36. doi: 10.1016/j.ejcb.2010.09.008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Maupas-Schwalm F, Augé N, Robinet C, Cambus JP, Parsons SJ, Salvayre R, Nègre-Salvayre A. The sphingomyelin/ceramide pathway is involved in ERK1/2 phosphorylation, cell proliferation, and uPAR overexpression induced by tissue-type plasminogen activator. FASEB J. 2004;18:1398–1400. doi: 10.1096/fj.03-1123fje. [DOI] [PubMed] [Google Scholar]
  36. Meyer JW, Schmitt ME. A central role for the endothelial NADPH oxidase in atherosclerosis. FEBS Lett. 2000;472:1–4. doi: 10.1016/s0014-5793(00)01397-1. [DOI] [PubMed] [Google Scholar]
  37. Mora-Pale M, Weïwer M, Yu J, Linhardt RJ, Dordick JS. Inhibition of human vascular NADPH oxidase by apocynin derived oligophenols. Bioorg Med Chem. 2009;17:5146–5152. doi: 10.1016/j.bmc.2009.05.061. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Newby AC. Matrix metalloproteinases regulate migration, proliferation, and death of vascular smooth muscle cells by degrading matrix and non-matrix substrates. Cardiovasc Res. 2006;69:614–624. doi: 10.1016/j.cardiores.2005.08.002. [DOI] [PubMed] [Google Scholar]
  39. Peng N, Liu JT, Guo F, Li R. Epigallocatechin-3-gallate inhibits interleukin-6- and angiotensin II-induced production of C-reactive protein in vascular smooth muscle cells. Life Sci. 2010;86:410–415. doi: 10.1016/j.lfs.2010.01.010. [DOI] [PubMed] [Google Scholar]
  40. Roy A, Kucukural A, Zhang Y. I-TASSER: a unified platform for automated protein structure and function prediction. Nat Protoc. 2010;5:725–738. doi: 10.1038/nprot.2010.5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Sachinidis A, Skach RA, Seul C, Ko Y, Hescheler J, Ahn HY, Fingerle J. Inhibition of the PDGF beta-receptor tyrosine phosphorylation and its downstream intracellular signal transduction pathway in rat and human vascular smooth muscle cells by different catechins. FASEB J. 2002;16:893–895. doi: 10.1096/fj.01-0799fje. [DOI] [PubMed] [Google Scholar]
  42. Sarkar J, Chowdhury A, Chakraborti T, Chakraborti S. Cross talk between NADPH oxidase-PKCα-p38MAPK and NF-κB-MT1MMP in activating proMMP-2 by ET-1 in pulmonary artery smooth muscle cells. Mol Cell Biochem. 2016;415:13–28. doi: 10.1007/s11010-016-2673-6. [DOI] [PubMed] [Google Scholar]
  43. Smith PK, Krohn RI, Hermanson GT, Mallia AK, Gartner FH, Provenzano MD, Fujimoto EK, Goeke NM, Olson BJ, Klenk DC. Measurement of protein using bicinchoninic acid. Anal Biochem. 1985;150:76–85. doi: 10.1016/0003-2697(85)90442-7. [DOI] [PubMed] [Google Scholar]
  44. Stamenkovic I. Extracellular matrix remodelling: the role of matrix metalloproteinases. J Pathol. 2003;200:448–464. doi: 10.1002/path.1400. [DOI] [PubMed] [Google Scholar]
  45. Stenmark KR, Mecham RP. Cellular and molecular mechanisms of pulmonary vascular remodeling. Annu Rev Physiol. 1997;59:89–144. doi: 10.1146/annurev.physiol.59.1.89. [DOI] [PubMed] [Google Scholar]
  46. Stenmark KR, Meyrick B, Galie N, Mooi WJ, McMurtry IF. Animal models of pulmonary arterial hypertension: the hope for etiological discovery and pharmacological cure. Am J Physiol Lung Cell Mol Physiol. 2009;297:L1013–L1032. doi: 10.1152/ajplung.00217.2009. [DOI] [PubMed] [Google Scholar]
  47. Towbin H, Staehelin T, Gordon J. Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications. Proc Natl Acad Sci U S A. 1979;76:4350–4354. doi: 10.1073/pnas.76.9.4350. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Wang F, Chang Z, Fan Q, Wang L. Epigallocatechin-3-gallate inhibits the proliferation and migration of human ovarian carcinoma cells by modulating p38 kinase and matrix metalloproteinase-2. Mol Med Rep. 2014;9:1085–1089. doi: 10.3892/mmr.2014.1909. [DOI] [PubMed] [Google Scholar]
  49. Weber AA, Neuhaus T, Skach RA, Hescheler J, Ahn HY, Schrör K, Ko Y, Sachinidis A. Mechanisms of the inhibitory effects of epigallocatechin-3 gallate on platelet-derived growth factor-BB-induced cell signaling and mitogenesis. FASEB J. 2004;18:128–130. doi: 10.1096/fj.03-0007fje. [DOI] [PubMed] [Google Scholar]
  50. Wedgwood S, Black SM. Role of reactive oxygen species in vascular remodeling associated with pulmonary hypertension. Antioxid Redox Signal. 2003;5:759–769. doi: 10.1089/152308603770380061. [DOI] [PubMed] [Google Scholar]
  51. Yu J, Weïwer M, Linhardt RJ, Dordick JS. The role of the methoxyphenol apocynin, a vascular NADPH oxidase inhibitor, as a chemopreventative agent in the potential treatment of cardiovascular diseases. Curr Vasc Pharmacol. 2008;6:204–217. doi: 10.2174/157016108784911984. [DOI] [PubMed] [Google Scholar]
  52. Zhu TT, Zhang WF, Luo P, He F, Ge XY, Zhang Z, Hu CP. Epigallocatechin-3-gallate ameliorates hypoxia-induced pulmonary vascular remodeling by promoting mitofusin-2-mediated mitochondrial fusion. Eur J Pharmacol. 2017;809:42–51. doi: 10.1016/j.ejphar.2017.05.003. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

ESM 1 (18.9KB, docx)

(DOCX 18 kb)

Fig. S1 (70.5KB, png)

(PNG 70 kb)

High Resolution (TIF 70 kb) (70.1KB, tif)
Fig. S2 (148.5KB, png)

(PNG 148 kb)

High Resolution (TIF 130 kb) (130.1KB, tif)
Fig. S3 (109.5KB, png)

(PNG 109 kb)

High Resolution (TIF 104 kb) (104.1KB, tif)
ESM 2 (12.7KB, docx)

(DOCX 12 kb)

Articles from Journal of Cell Communication and Signaling are provided here courtesy of The International CCN Society

RESOURCES