Abstract
Recent studies suggest that Elevated O-GlcNAcylation by increased O-GlcNAc transferase (OGT) and/or decreasing O-GlcNAcase (OGA) levels is associated with cancer initiation, progression, invasion, and metastasis. However, the function of OGT in colon cancer tumorigeneses remains unclear. Here, we showed OGT expression is elevated in human colon cancer tissue compared with adjacent normal tissue, and cases with higher OGT expression had shorter survival time. Additionally, OGT mRNA expression was positively correlated with pathologic TNM stage from TCGA public database. Finally, we found knock-down of OGT expression by RNA interference inhibits cell proliferation, migration and invasion in colon cancer cell lines. Taken together, this study imply that elevated OGT expression had an important function in colon cancer formation and progression, and OGT may be a valuable prognostic factor and therapeutic target.
Keywords: Colon cancer, O-GlcNAc transferase, proliferation, metastasis
Introduction
Colorectal cancer is the third most common cancer with 1.36 million new cases in 2012 worldwide [1]. In the United States, despite advances in early detection, about two thirds of patients present with advanced disease and the five year overall survival (OS) rate is poor [2]. Therefore, it is urgent to explore a novel target that can be used in diagnosis, prognosis, and as a therapeutic target.
O-linked β-N-acetylglucosaminylation (O-GlcNAcylation) is a dynamic and reversible posttranslational modification (PTM) which attaches the single beta-D-N-acetylglucosamine sugar to serine and threonine residues of many cytoplasmic and nuclear proteins [3,4]. O-GlcNAc-modified proteins have some important functions in the regulation of cellular growth course such as nutrient sensing transmission, insulin signal pathway activation, cell cycle regulation, transcriptional control of mRNA, protein transport, and interactions among proteins [5,6]. The modulation of O-GlcNAc overexpression is important in the oncogenic signal pathway and cancer phenotypes [7,8]. Abnormal high expression levels of O-GlcNAc have been confirmed in human tumor tissues compared with matched adjacent normal tissue for breast cancer, lung cancer, and colon cancer [7,9,10].
Two distinct O-GlcNAc cycling enzymes O-GlcNAc Transferase (OGT) and O-GlcNAcase (OGA) serve to add and remove N-acetylglucosamine from UDP-GlcNAc to protein substrates [8,11,12]. The two enzymes regulating the O-GlcNAc of proteins discrepantly express O-GlcNAc and respond to multiple stimuli. OGT has a highly conserved catalytic domain. Many proteins which are associated with proliferation and progression and metastasis were proven to have O-GlcNAc modifiers, such as the nucleoprotein c-Myc [13], tumor suppressor protein p53 [14], transcription factors NFATl [15], HIF-1 [7], and NF-kappaβ [16]. OGT plays a keys role as the only transferase that increases O-GlcNAc directly. In the present study, the effects of OGT expression levels on colon cancer and proliferation and metastasis were investigated.
Materials and methods
Tissue microarray analysis
The tissue arrays of colon adenocarcinoma and their matched adjacent normal colon tissue were purchased from Shanghai Outdo Biotech Co., Ltd (No. Hrec-Ade180sur-02). Immunohistochemical staining was carried out as previously described [17]. After deparaffinization and rehydration, Dako Target Retrieval Solution (Dako Cytomation, Carpinteria, CA, USA) was used for antigen retrieval in a pressure cooker. Endogenous peroxidases were blocked using a solution containing avidin, biotin, and 5% (w/v) normal goat serum and incubated with anti-OGT antibody (1:2000, Abcam, ab96718, Cambridge, MA, USA) overnight at 4°C. After incubation, slides were rinsed off with PBST, and the stain was detected by biotin-labeled goat anti-rabbit secondary antibody and visualized by EnVison kit (DAKO, Glostrup, Denmark). Sections were counterstained with hematoxylin and coverslip were mounted onto slides with glycerol gelatin.
The staining intensity of OGT was assessed blindly by three pathologists according to Fourtier system [18] (score 0-3: 0, negative (-); 1, weak (+); 2, moderate (++), 3 strong (+++). The staining scores of OGT expression were dichotomized into two groups, low (score 0 to 1), and high (score 2 to 3).
Bioinformatics analysis of TCGA database
The normalized TCGA mRNA expression of OGT and the corresponding clinical information of the patients with colon cancer were downloaded from LinkedOmics portal (http://linkedomics.org/) [19].
Cell lines and cultures
The colon cancer cell lines including SW620, HCT116, HT29, SW480 and RKO were purchased from the American Type Culture Collection (ATCC), and the human embryonic kidney cell line HEK293T cell line was maintained in our institutional cell line bank. All cell lines used were tested routinely and confirmed to free of mycoplasma contamination. All cell lines were grown in DMEM (HyClone, GE Healthcare) supplemented with 10% (v/v) heat-inactivated fetal bovine serum (FBS; Zhejiang Tianhang Biotechnology Co, Ltd.) and 1% Penicillin-Streptomycin Solution (HyClone, GE Healthcare) and were maintained at 37°C in a humidified 5% incubator.
Plasmids and shRNA
OGT silencing by short interfering RNA: The shRNAs for human OGT genes used in this study was constructed into pLKO.1-puro vector from Addgene (Moffal et al., Cell, 2006 Mar; 124: (6): 1283-98). The sequences targeted by OGT-specific shRNA is as follow: shOGT (TRCN0000035067), 5’-GCTGAGCAGTATTCCGAGAAA-3’; A plasmid carrying a non-targeting sequence (shRNA Control, GTGGACTCTTGAAAGTACTAT) was used to create the control cells. For lentivirus production, 2 µg pMD2.G (Addgene #12259), 4 µg psPAX2 (Addgene #12260) and 8 µg shRNA plasmid were transfected into HEK293T cells using Lipofectamine 2000 (Thermo Fisher, #11668019). The media was changed the next day. The media containing lentiviral particles were harvested at 48 hours and 72 hours after transfection and filtered.
For virus infection of target cells, 1.5 × 106 cells were seeded in the 6 cm dish, and virus-containing media with 8 µg/ml polybrene was added the next day and after 48 h infections selected using 2 µg/ml puromycin. Tested for OGT expression by immunoblot.
Protein extraction and western blot analysis
Cells were harvested and lysed on ice by lysis buffer (PH 7.4, 50 mM Na2HPO4, 1 mM Sodium Pyrophosphate, 20 mM NaF, 2 mM EDTA, 2 mM EGTA and 1% Triton X-100) with freshly added protease inhibitor (40 µg ml-1 leupeptin, 1 mM PMSF, 200 µM benzamidine, 1 mM DTT). Cell lysates were centrifuged at 15000 × g for 15 min at 4°C and equalized to protein content determined by bicinchoninic acid (BCA) protein assay (ThermoFisher, Rockford, IL, USA). Cell lysates were separated by 10% SDS-PAGE (w/v) and were transferred to PVDF membranes (Millipore). Membranes were blocked for 1 hour with 5% non-fat dry milk (w/v) in phosphate buffered saline containing 0.05% Tween-20 (v/v) (PBST), then were incubated with primary antibody for anti-OGT (1:2000, Abcam, ab96718, Cambridge, MA, USA), anti-O-GlcNAc (1:1000, Santa Cruz, sc-59624, Dallas, TX, USA) and anti-GAPDH (1:1000, Cell Signaling Technology, CST, #5174, Boston, MA, USA) at 4°C overnight, followed by incubation with goat anti-rabbit (1:1000, CST, #7074) and goat anti-mouse HRP-conjugated secondary antibody (1:1000, CST, #7076) for 1 h at room temperature. Immunoreactive proteins were visualized on X-ray films using ECL Plus Western Blotting Substrate (ThermoFisher Scientific, #32132, Rockford, IL, USA). The protein bands intensities were quantified by Image J software (NIH, Bethesda, MD, USA).
Cell proliferation assay
The equal numbers of cells were seeded into 12-well plates (1 × 104 cells per well). To determine the rate of proliferation, the numbers of cells were counted daily for 4 days using a cell counter. Representative results from 3 independent experiments are shown as mean ± SEM of triplicate wells.
Invasion assay
The invasion assays were performed using Corning Transwell (6.5 mm in diameter with a polycarbonate membrane with pore size of 8 µm; Corning Inc). The upper chamber was first coated with Matrigel (BD Pharmingen), and serum-starved colon cancer cells were seeded onto the upper chamber in serum-free medium. The lower chamber contained medium supplemented with 20 ng/ml IGF as a chemoattractant. Cells were incubated for 24 to 48 hours and that invaded to the lower surface of the transwells were fixed with 20% (v/v) methanol and stained with 0.5% (w/v) crystal violet. The cells that did not cross the filter were then removed by wiping the upper surface of the filter with wet cotton swabs and the remaining cells that were invaded to the lower chamber of the Transwell were counted using an inverted microscope at × 20 magnification.
Wound-healing assay
We seeded uniform 1 × 105 cells in 6 well plates. After overnight culture, we used a 200 ul pipette tip (yellow) were used to make a straight scratch, simulating a wound. The cells were washed and further incubated with fresh medium for 24 h to 48 h. Photographs were taken at each indicated time point. The distance between the two opposing edges was measured on each photograph. The distance migrated in micrometers was calculated as the difference of the scratch width at each time point indicated.
Statistical analysis
All statistical analyses were performed by SPSS 21.0 for Windows version (IMB Corporation, Armonk, NY). p value < 0.05 was considered statistically significant by a two-sided test. The χ2 test was used to compare proportions. Continuous variables were expressed as the mean ± standard deviation (SD) and were compared using an unpaired student’s t test. Overall survival (OS) estimates were calculated using the Kaplan-Meier method and compared using the log-rank test. Cox proportional hazard regression model was applied to evaluate the independent predictive factors for OS.
Results
OGT expression is increased in colon cancer patient samples
We examined the expression pattern of OGT in colon cancer specimens and the adjacent normal mucosa using immunohistochemical staining (IHC). Patients’ clinicopathologic characteristics are shown in Table 1 and representative IHC staining of OGT in adjacent normal tissue and colon cancer tissue are shown in Figure 1A. In adjacent normal tissue, the high OGT expression with intense and widespread cytoplasmic/nuclear staining (+ + and + + +) were detected in 35 of 90 (38.9%), while 61.1% show low expression (negative or +). In colon cancer tissues, the rate of high OGT expression was increased (54/90, 60%) compared with adjacent normal tissues (Figure 1B).
Table 1.
Clinical features of different OGT expression in colon cancer
| Low | High | P value | ||
|---|---|---|---|---|
| Sex | Male | 20 | 39 | 0.180 |
| Female | 15 | 16 | ||
| Age | < 67 | 18 | 26 | 0.701 |
| ≥ 67 | 17 | 29 | ||
| T stage* | 1 | 1 | 2 | 0.202 |
| 2 | 9 | 6 | ||
| 3 | 23 | 46 | ||
| 4 | 2 | 1 | ||
| N stage* | 0 | 22 | 31 | 0.410 |
| 1 | 6 | 16 | ||
| 2 | 7 | 8 | ||
| Stage* | I | 10 | 7 | 0.320 |
| II | 12 | 24 | ||
| III | 12 | 22 | ||
| IV | 1 | 1 |
AJCC 7th stage.
Figure 1.

OGT protein was increased in expression and an unfavorable prognostic factor in colon cancer patients. A. The representative images of “-”, “+”, “++” and “+++” staining in colon cancer and adjacent normal tissue are displayed. B. The expression ratio of OGT in adjacent normal tissue and colon cancer tissue are shown. C. The Kaplan-Meier analysis by log-rank test in 90 colon cancer patients according to OGT expression level for overall survival (OS).
High OGT expression predicts poor clinical outcome in human colon cancer
The 3-year OS rate in patients with high OGT expression was lower than that with low expression (60.0% vs 82.9%, χ2 = 7.452, P = 0.006) (Figure 1C). Furthermore, we use a Cox regression univariate and multivariate analysis, we found patients with T3-T4 stage had a lower OS rate/higher risk of death (HR = 3.081, 95% CI 0.941-10.083, P = 0.063) compared with patients with T1-T2 stage, and patients had higher OGT expression showed high risk of death (HR = 3.024, 95% CI 1.309-6.985, P = 0.010) compared with low OGT expression and the OGT expression was the only significant variable on multivariate Cox regression analysis with OS (HR = 2.724, 95% CI 1.172-6.328, P = 0.020) (Table 2).
Table 2.
Univariate and multivariate analysis of overall survival
| Media survival | Univariate analysis | Multivariate analysis | ||||||
|---|---|---|---|---|---|---|---|---|
|
|
|
|||||||
| HR | 95% CT | p value | HR | 95% CT | p value | |||
| Sex | Male | 45 | 1.000 | |||||
| Female | 49 | 1.002 | 0.496-2.206 | 0.995 | ||||
| Age | < 67 | 47 | 1.000 | |||||
| ≥ 67 | 45 | 1.396 | 0.705-2.764 | 0.338 | ||||
| Histology | 1-2 | 45 | 1.000 | |||||
| 3 | 47 | 1.238 | 0.871-1.761 | 0.234 | ||||
| T Stage | T1-T2 | 49 | 1.000 | |||||
| T3-T4 | 47 | 3.081 | 0.941-10.083 | 0.063 | 2.557 | 0.775-8.434 | 0.123 | |
| Node etastasis | No | 47 | 1.000 | |||||
| Yes | 47 | 1.643 | 0.838-3.221 | 0.149 | ||||
| OGT expression | Low | 51 | 1.000 | |||||
| High | 45 | 3.024 | 1.309-6.985 | 0.010 | 2.724 | 1.172-6.328 | 0.020 | |
To analyze transcript expression, we used LinkedOmics portal Data. A positive correlation tendency between OGT mRNA expression and T stage was observed, but did not reach a significant difference (P = 0.4941, Figure 2A). We also observed a significant positive correlation between OGT mRNA expression and nodal stage, metastasis stage, and total stage (Figure 2B-D). These findings imply that OGT may be involved in colon cancer invasion and metastasis.
Figure 2.

The mRNA expression of OGT and its clinical significance from TCGA Database. OGT mRNA expression is positively correlated with pathologic T stage (A), N stage (B), M stage (C) and total stage (D) from the public TCGA database.
Knockdown of OGT expression inhibits proliferation in human colon cancer cells
To study whether OGT expression level is correlated with cell proliferation in colon cancer, we detected OGT expression level in five colon cancer cell lines (SW620, HCT116, HT29, SW480, and RKO) by western blot analysis. In line with previous studies, OGT expression was positive correlated with global O-GlcNAcylation in colon cancer cell lines (Figure 3A). In addition, OGT expression was positively correlated with cell proliferation (Figure 3B, 3C). We further found that cell proliferation was markedly inhibited by OGT knockdown in HCT 116 in which OGT was highly expressed (Figure 3D-F). These results suggest that OGT expression promotes colon cancer cell line proliferation.
Figure 3.

Stable knockdown of OGT expression inhibits proliferation in vitro. (A) The OGT and global O-GlcNAc expression of the five colon cell lines were detected by western blot. (B) Graphs showing quantified data for three independent experiments as shown in (A) Relative OGT expression was normalized to SW620 cell line. Data show mean ± s.e.m. (C) Five colon cell line viability assays. (D) Stable knockdown of the OGT expression. HCT116 cells were transfected with OGT knockdown expression, determined by western blot. (E) The relative knockdown levels of OGT expression were normalized to parental cells. (F) Cell viability assays for HCT116 parental, HCT116 shControl and shOGT cells.
OGT positively regulates cell motility and migration in colon cancer cells
To test whether OGT regulates cell motility and invasion in colon cancer cells, stable control, and OGT knockdown colon cancer cells HCT116 were generated using lentivirus-mediated RNAi, which express very high levels of endogenous OGT. The shControl and OGT knockdown HCT116 cells were subjected to transwell invasion and cell wound-healing assay to monitor cell invasion and migration. We found that downregulation of OGT markedly inhibited cell invasion (Figure 4A, 4B).
Figure 4.
Stable knockdown of OGT expression suppresses cell migration and invasion of colon cancer cell lines. A. Representative images of cells that migrated through the filter and were stained with crystal violet. B. The results are means ± s.d. n = 3 experiments. C. Representative photographs of scratched gap distance of the confluent monolayer of HCT116 cells transfected with shOGT or shControl at 0 h and 24 h after wounding with a pipet tip. D. The relative migration distance is means ± sd. n = 3 experiments.
The wound recovery velocity at 24 hours after the scratching in OGT knockdown cells was slower compared to the shControl cells (Figure 4C, 4D). Taken together, these data indicatea role of OGT in promoting cell motility and invasion in colon cancer cells.
Discussion
In the past decade, many studies have shown altered O-GlcNAcylation caused by increased OGT expression has been linked to tumorigeneses, such as lung cancer, pancreatic cancer, myeloid malignancies, prostate cancer, and colorectal cancer [7,10,13,20-22]. Especially in colon cancer, OGT, termed O-linked N-acetylglucosamine transferase, can transfer N-acetylglucosamine from UDP-GlcNAc to protein substrates, to increase O-GlcNAc expression which has critical functions in the regulation of cellular processes [23]. Metastatic breast cancer cell lines have high expression levels of OGT.
In the present study, first, we found that the expression of OGT by TMA IHC staining in tumor tissues was significantly higher than in adjacent normal tissues in patients with colon cancer. The 3 year OS rate in the OGT high expression group was significantly worse than with OGT low expression. Second, we further confirmed OGT expression at the mRNA level was correlated with colon cancer pathologic TNM stage from the TCGA Database. Finally, down-regulation of O-GlcNAcylation by knockdown OGT expression leads to reduced tumor cell growth and invasion in vitro. For OGT expression we chose five human colon cancer lines to determine OGT expression. It was found that high OGT expression in colon cancer cells was significantly correlated with rapid growth by cell proliferation assay. In order to better illustrate the role of OGT, we silenced OGT expression in a HCT116 cell line. We confirmed improvement of OGT function regarding proliferation and metastasis by a cell proliferation assay and transwell and wound-healing experiment in colon cancer cells. Thus, our study confirmed that OGT promotes proliferation and metastasis in colon cancer.
A series of studies has reported that many oncogenic proteins are O-GlcNAcylated, caused by elevated OGT expression in several types of cancer. For example, OGT and global O-GlcNAcylation were elevated in breast cancer cells, and OGT silencing through RNA interference in breast cancer cell lines reduced tumor growth and invasion by regulating the stability of the oncogenic transcription factor FoxM1 and its targets both in vivo and in vitro [24]. Knockdown of OGT causes reduced tumor cell proliferation and invasion in two lung and colon cancer cell lines. Another study showed that MAPK/ERK signaling may regulate OGT expression in various tumor cells, which improves the impact of ERK signaling in cancer cell proliferation [25]. Moreover, OGT increased O-GlcNAcylation to adjust cancer cell metabolic and survival stress signaling by means of regulation of HIF-1α, and more enhanced glucose uptake promotes oncogenesis by O-GlcNAc pathway [7]. In a recent study by Guo et al. OGT knockdown significantly reduced colon cancer cell proliferation and stem cell population in vitro by increasing transcription of MYBL1 [22]. It highlighted the importance of cancer stem cells. In addition, it was found that Polycomb repressive complexes 2 (PRC2) was necessary to maintain normal levels of OGT and for the correct cellular distribution of O-GlcNAc-modified proteins in ESC. Other studies revealed that OGT was drawn into the regulation of TET1 [26], a family member of the dioxygenases that stimulates the hydroxylation of 5-methylcytosine and represses gene expression. OGT can positively adjust protein levels of TET1 with gene enhanced in close proximity to CpG-rich transcription start sites [26]. Also, GlcN can induce OGT activation mediated glucose production through separate Notch1 and FoxO1, which contributes to the regulation of maintenance of self-renewal in mESCs [27,28]. All results suggest that OGT may be a novel target for proliferation and tumor progression in the sugar metabolic realm.
Conclusions
In summary, we demonstrate system reliability that the OGT can promote proliferation and metastasis in colon cancer by altered O-GlcNAcylation. Our findings provide a new target inhibitor with therapeutic utility for colon cancer once again. At the same time, as a function of glucose, there are different with classic glycosylation. In future, it is worth discovering how OGT improves tumor proliferation and metastasis in glucose metabolism.
Acknowledgements
This work was supported by Zhejiang Provincial Medicine and Health Foundation [grant numbers 2011KYB146], China.
Disclosure of conflict of interest
None.
References
- 1.Miller KD, Siegel RL, Lin CC, Mariotto AB, Kramer JL, Rowland JH, Stein KD, Alteri R, Jemal A. Cancer treatment and survivorship statistics, 2016. CA Cancer J Clin. 2016;66:271–89. doi: 10.3322/caac.21349. [DOI] [PubMed] [Google Scholar]
- 2.Siegel RL, Miller KD, Jemal A. Cancer statistics, 2018. CA Cancer J Clin. 2018;68:7–30. doi: 10.3322/caac.21442. [DOI] [PubMed] [Google Scholar]
- 3.Torres CR, Hart GW. Topography and polypeptide distribution of terminal N-acetylglucosamine residues on the surfaces of intact lymphocytes. Evidence for O-linked GlcNAc. J Biol Chem. 1984;259:3308–17. [PubMed] [Google Scholar]
- 4.Holt GD, Hart GW. The subcellular distribution of terminal N-acetylglucosamine moieties. Localization of a novel protein-saccharide linkage, O-linked GlcNAc. J Biol Chem. 1986;261:8049–57. [PubMed] [Google Scholar]
- 5.Hart GW, Slawson C, Ramirez-Correa G, Lagerlof O. Cross talk between O-GlcNAcylation and phosphorylation: roles in signaling, transcription, and chronic disease. Annu Rev Biochem. 2011;80:825–858. doi: 10.1146/annurev-biochem-060608-102511. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Bond MR, Hanover JA. A little sugar goes a long way: the cell biology of O-GlcNAc. J Cell Biol. 2015;208:869–880. doi: 10.1083/jcb.201501101. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Ferrer CM, Lynch TP, Sodi VL, Falcone JN, Schwab LP, Peacock DL, Vocadlo DJ, Seagroves TN, Reginato MJ. O-GlcNAcylation regulates cancer metabolism and survival stress signaling via regulation of the HIF-1 pathway. Mol Cell. 2014;54:820–831. doi: 10.1016/j.molcel.2014.04.026. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Ma Z, Vosseller K. Cancer metabolism and elevated O-GlcNAc in oncogenic signaling. J Biol Chem. 2014;289:34457–34465. doi: 10.1074/jbc.R114.577718. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Krzeslak A, Pomorski L, Lipinska A. Elevation of nucleocytoplasmic beta-N-acetylglucosaminidase (O-GlcNAcase) activity in thyroid cancers. Int J Mol Med. 2010;25:643–648. doi: 10.3892/ijmm_00000387. [DOI] [PubMed] [Google Scholar]
- 10.Mi W, Gu Y, Han C, Liu H, Fan Q, Zhang X, Cong Q, Yu W. O-GlcNAcylation is a novel regulator of lung and colon cancer malignancy. Biochim Biophys Acta. 2011;1812:514–9. doi: 10.1016/j.bbadis.2011.01.009. [DOI] [PubMed] [Google Scholar]
- 11.Hart GW, Housley MP, Slawson C. Cycling of O-linked beta-N-acetylglucosamine on nucleocytoplasmic proteins. Nature. 2007;446:1017–1022. doi: 10.1038/nature05815. [DOI] [PubMed] [Google Scholar]
- 12.Haltiwanger RS, Holt GD, Hart GW. Enzymatic addition of O-GlcNAc to nuclear and cytoplasmic proteins. Identification of a uridine diphospho-N-acetylglucosamine: peptide beta-N-acetylglucosaminyltransferase. J Biol Chem. 1990;265:2563–2568. [PubMed] [Google Scholar]
- 13.Itkonen HM, Minner S, Guldvik IJ, Sandmann MJ, Tsourlakis MC, Berge V, Svindland A, Schlomm T, Mills IG. O-GlcNAc transferase integrates metabolic pathways to regulate the stability of c-MYC in human prostate cancer cells. Cancer Res. 2013;73:5277–5287. doi: 10.1158/0008-5472.CAN-13-0549. [DOI] [PubMed] [Google Scholar]
- 14.Yang WH, Kim JE, Nam HW, Ju JW, Kim HS, Kim YS, Cho JW. Modification of p53 with O-linked N-acetylglucosamine regulates p53 activity and stability. Nat Cell Biol. 2006;8:1074–1083. doi: 10.1038/ncb1470. [DOI] [PubMed] [Google Scholar]
- 15.Facundo HT, Brainard RE, Watson LJ, Ngoh GA, Hamid T, Prabhu SD, Jones SP. O-GlcNAc signaling is essential for NFAT-mediated transcriptional reprogramming during cardiomyocyte hypertrophy. Am J Physiol Heart Circ Physiol. 2012;302:H2122–2130. doi: 10.1152/ajpheart.00775.2011. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Facundo HT, Brainard RE, Watson LJ, Ngoh GA, Hamid T, Prabhu SD, Jones SP. Elevated O-GlcNAcylation promotes colonic inflammation and tumorigenesis by modulating NF-kappaB signaling. Oncotarget. 2015;6:12529–12542. doi: 10.18632/oncotarget.3725. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Lv D, Yang H, Wang W, Xie Y, Hu W, Ye M, Chen X. High PHLPP expression is associated with better prognosis in patients with resected lung adenocarcinoma. BMC Cancer. 2015;15:687. doi: 10.1186/s12885-015-1711-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Reiner A, Neumeister B, Spona J, Reiner G, Schemper M, Jakesz R. Immunocytochemical localization of estrogen and progesterone receptor and prognosis in human primary breast cancer. Cancer Res. 1990;50:7057–7061. [PubMed] [Google Scholar]
- 19.Vasaikar SV, Straub P, Wang J, Zhang B. LinkedOmics: analyzing multi-omics data within and across 32 cancer types. Nucleic Acids Res. 2018;46:D956–D963. doi: 10.1093/nar/gkx1090. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Pathak S, Dorfmueller HC, Borodkin VS, van Aalten DM. Chemical dissection of the link between streptozotocin, O-GlcNAc, and pancreatic cell death. Chem Biol. 2008;15:799–807. doi: 10.1016/j.chembiol.2008.06.010. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Inoue D, Fujino T, Sheridan P, Zhang YZ, Nagase R, Horikawa S, Li Z, Matsui H, Kanai A, Saika M, Yamaguchi R, Kozuka-Hata H, Kawabata KC, Yokoyama A, Goyama S, Inaba T, Imoto S, Miyano S, Xu M, Yang FC, Oyama M, Kitamura T. A novel ASXL1-OGT axis plays roles in H3K4 methylation and tumor suppression in myeloid malignancies. Leukemia. 2018;32:1327–1337. doi: 10.1038/s41375-018-0083-3. [DOI] [PubMed] [Google Scholar]
- 22.Guo H, Zhang B, Nairn AV, Nagy T, Moremen KW, Buckhaults P, Pierce M. O-Linked N-Acetylglucosamine (O-GlcNAc) expression levels epigenetically regulate colon cancer tumorigenesis by affecting the cancer stem cell compartment via modulating expression of transcriptional factor MYBL1. J Biol Chem. 2017;292:4123–4137. doi: 10.1074/jbc.M116.763201. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Very N, Steenackers A, Dubuquoy C, Vermuse J, Dubuquoy L, Lefebvre T, El Yazidi-Belkoura I. Cross regulation between mTOR signaling and O-GlcNAcylation. J Bioenerg Biomembr. 2018;50:213–222. doi: 10.1007/s10863-018-9747-y. [DOI] [PubMed] [Google Scholar]
- 24.Caldwell SA, Jackson SR, Shahriari KS, Lynch TP, Sethi G, Walker S, Vosseller K, Reginato MJ. Nutrient sensor O-GlcNAc transferase regulates breast cancer tumorigenesis through targeting of the oncogenic transcription factor FoxM1. Oncogene. 2010;29:2831–42. doi: 10.1038/onc.2010.41. [DOI] [PubMed] [Google Scholar]
- 25.Zhang X, Ma L, Qi J, Shan H, Yu W, Gu Y. MAPK/ERK signaling pathway-induced hyper-O-GlcNAcylation enhances cancer malignancy. Mol Cell Biochem. 2015;410:101–10. doi: 10.1007/s11010-015-2542-8. [DOI] [PubMed] [Google Scholar]
- 26.Vella P, Scelfo A, Jammula S, Chiacchiera F, Williams K, Cuomo A, Roberto A, Christensen J, Bonaldi T, Helin K, Pasini D. Tet proteins connect the O-linked N-acetylglucosamine transferase Ogt to chromatin in embryonic stem cells. Mol Cell. 2013;49:645–56. doi: 10.1016/j.molcel.2012.12.019. [DOI] [PubMed] [Google Scholar]
- 27.Ogawa M, Senoo Y, Ikeda K, Takeuchi H, Okajima T. Structural divergence in O-GlcNAc glycans displayed on epidermal growth factor-like repeats of mammalian notch1. Molecules. 2018:23. doi: 10.3390/molecules23071745. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Shin H, Cha HJ, Na K, Lee MJ, Cho JY, Kim CY, Kim EK, Kang CM, Kim H, Paik YK. O-GlcNAcylation of the tumor suppressor FOXO3 triggers aberrant cancer cell growth. Cancer Res. 2018;78:1214–1224. doi: 10.1158/0008-5472.CAN-17-3512. [DOI] [PubMed] [Google Scholar]

