Skip to main content
International Journal of Clinical and Experimental Pathology logoLink to International Journal of Clinical and Experimental Pathology
. 2019 Apr 1;12(4):1439–1456.

Elevation of miR-191-5p level and its potential signaling pathways in hepatocellular carcinoma: a study validated by microarray and in-house qRT-PCR with 1,291 clinical samples

Hua-Yu Wu 1,2,#, Mei-Wei Li 2,#, Qi-Qi Li 1, Yu-Yan Pang 3, Gang Chen 3, Hui-Ping Lu 3,*, Shang-Ling Pan 1,*
PMCID: PMC6947072  PMID: 31933962

Abstract

Background: The miR-191-5p expression has been reported to increase in hepatocellular carcinoma (HCC), but its clinical value and exact role remain to be further clarified. Thus, a comprehensive analysis was performed in the current study to explore the underlying function of miR-191-5p in HCC. Methods: HCC-related expression data were collected to conduct a thorough analysis to determine the miR-191-5p expression and its clinical significance in HCC, including microarray data from the Gene Expression Omnibus and ArrayExpress database as well as quantitative real-time polymerase chain reaction (qRT-PCR) data of 178 matched clinical samples. The underlying relationship between miR-191-5p and HCC was also explored on the basis of a series of bioinformatics analyses. Results: The overall pooled meta-analysis showed an overexpression of miR-191-5p in the HCC samples (SMD=0.400, 95% CI=0.139-0.663, P=0.003), consistent with the detected result of the clinical HCC samples through the qRT-PCR analysis. Higher miR-191-5p levels were correlated with advanced TNM stages (III and IV), higher pathological grades, and metastasis. Functionally, 64 potential target genes were acquired for further mechanism analysis. Two pathways (p75 neurotrophin receptor and liver kinase B1-mediated signaling pathways), which were likely modulated by miR-191-5p, were regarded to be linked to the deterioration of HCC. Early growth response 1 and UBE2D3 were identified as the most likely targets for miR-191-5p in HCC and were commonly implied in the top enriched pathways and protein-protein network. Conclusions: In summary, miR-191-5p may function as a tumor promoter miRNA of HCC, and the miR-191-5p inhibitor may contribute to the targeted HCC treatment in the future.

Keywords: Hepatocellular carcinoma, MiR-191-5p, signaling pathway, microarray, qRT-PCR

Introduction

Hepatocellular carcinoma (HCC) is one of the top ten cancers around the world, ranking fifth in cancer-related mortality in men, with nearly 21,600 new estimated deaths [1]. HCC is commonly diagnosed in the advanced stages because of its latency, and the currently available therapies for HCC are ineffective, thus leading to unfavorable prognosis [2]. Specifically, less than 20% of HCC patients could survive after five years from the date of diagnosis [3].

MicroRNAs (miRNAs) are endogenous single-stranded, small non-coding RNA molecules containing almost 22 nucleotides, which are implicated in mRNA regulation. Each miRNA may have multiple target genes. Some miRNAs may also regulate the same genes, generally affecting gene expression [4,5]. MiRNAs act as an essential participant in gene expression, reverse transcription, cell differentiation, proliferation and apoptosis, a series of biological activities associated with immune responses, cardiovascular diseases, and the occurrence and progression of cancers [6-8].

MiR-191-5p (miRBase: MI0000465, miRNA ID: hsa-miR-191-5p, Sequence: caacggaaucccaaaagcagcug) is a miRNA that is abnormally expressed in tissues and cell types from various cancers and is closely related to tumor development, cancer diagnosis, and prognosis [9]. Recent studies found that miR-191-5p could be involved in certain biological activities in HCC, including cellular changes, proliferation inhibition, and apoptosis, and it could serve as an oncogene [10]. Moreover, miR-191-5p has been frequently reported to function as an oncogene in cancers such as colon, breast, and gastric [11-13]. Zhang et al. revealed that the suppression of miR-191-5p expression could negatively regulate the proliferation of colorectal cancer cells [11]. Similarly, suppressing the miR-191-5p expression in the gastric cancer cell line HGC-27 reduced cell proliferation and cell cycle progression and then impaired cell migration and invasion [13]. In breast cancer, Nagpal reported that HIF-inducible miR-191-5p could promote the migration of breast cancer by regulating the TGFβ-signaling pathway in a hypoxic microenvironment [12]. Therefore, miR-191-5p has great potential to be a novel diagnostic biomarker and an innovative therapeutic approach for HCC patients. However, current studies are limited by the fact that the specific mechanism between miR-191-5p and HCC has not been clearly clarified. In addition, more evidence remains to be collected for the further application of miR-191-5p in the prediction and early diagnosis of HCC.

Thus, we firstly evaluated the miR-191-5p expression and its potentially clinicopathological and diagnostic significance in HCC by analyzing data from the Gene Expression Omnibus (GEO) and ArrayExpress databases as well as clinical tissue samples. Moreover, we investigated the underlying mechanism of miR-191-5p in HCC through in silico analysis, including potential targets prediction, pathway, gene ontology (GO), and protein-protein interaction (PPI) analyses.

Materials and methods

Data mining of microarray data for the role of miR-191-5p in HCC

We screened and downloaded the miRNA (lastly updated on May 13, 2018) and mRNA (lastly updated on January 7, 2019) microarray profiles of HCC from the GEO and ArrayExpress databases. The keywords used for the search consisted of two parts: (1) hepatocellular OR liver OR hepatic OR HCC and (2) malignan* OR cancer OR tumor OR tumor OR neoplas* OR carcinoma. The microarrays were considered eligible while conforming to the following criteria: (1) the samples were obtained from humans; (2) the profiles should contain two groups, namely, patients diagnosed with HCC as the experimental group and individuals without HCC as the control group; (3) both two groups should include at least three samples; (4) the studies should examine the expression of miR-191-5p or the potential target mRNA in HCC. The profiles were regarded as unqualified if (1) they were not related to human HCC, and (2) the samples were collected from cell lines or other species.

Clinical HCC tissue samples from our institute

In this study, the First Affiliated Hospital of Guangxi Medical University (Nanning, Guangxi, China) provided 89 formalin-fixed, paraffin-embedded (FFPE) HCC tissues and their adjacent non-tumorous liver tissues from 2010 to 2011. The mean age of the included HCC patients was 52 years old. The study design was approved by the Ethical Committee of The First Affiliated Hospital of Guangxi Medical University. Informed consent was collected from all participants. The clinical pathological information of all HCC patients is presented in Table 1. The above samples were examined, diagnosed, and confirmed independently by two pathologists (Yu-yan Pang and Gang Chen).

Table 1.

Correlations between miR-191-5p expression and clinicopathological features in HCC (Mean ± SD)

Parameter Group N miR-191-5p expression t P
Tissue Adjacent liver 89 0.876±0.692 3.441* 0.001
HCC 89 5.067±8.351
Age (years) <50 46 3.173±3.865 2.204 0.032
≥50 43 7.092±11.045
Gender Female 17 3.471±3.714 0.874 0.384
Male 72 5.443±9.088
Differentiation Low 26 2.509±3.379 - 0.022
Moderate 57 6.336±9.944
TNM High 6 4.090±3.077
I+II 23 1.807±1.049 -3.721 0.000
III+IV 66 6.203±9.433
Metastasis No 44 2.840±5.675 2.580 0.012
Yes 45 7.244±9.910
Cirrhosis No 46 5.644±9.625 -6.673 0.503
Yes 43 4.448±6.791
AFP Negative 38 7.277±11.824 -2.144 0.038
Positive 35 2.988±3.359
Embolus No 65 4.427±7.443 1.192 0.236
Yes 24 6.800±10.411
Capsular No 44 6.856±10.200 -2.021 0.047
Yes 45 3.317±5.611
Nodes Single 53 3.186±3.269 2.251 0.030
Multi 36 7.835±12.093
Size <5 cm 14 6.901±11.193 -0.843 0.402
≥5 cm 73 4.8263±7.839
Survival Live 49 5.801±7.863 1.440 0.197
Death 7 15.689±17.927
Vasoinvasion No 57 3.674±6.294 1.987 0.054
Yes 30 7.996±11.009

SD: standard deviation;

*

Paired samples t-test was utilized.

Quantitative real-time polymerase chain reaction (qRT-PCR) to detect miR-191-5p in the HCC clinical sample in house

The miRNeasy Kit (QIAGEN, KJ Venlo, Netherlands) was used to isolate the total RNA, including miRNA from FFPE tissues. A more detailed RNA extraction and normalization was described in our previous reports [14-16]. Previously, RUN6B and let-7a were combined to work as the most reliable endogenous reference for HCC used in in vitro experiments. Moreover, RUN6B and RUN48 were commonly used in the HCC FFPE examination. In the present research, we applied different internal references and included the primers of miR-191, let-7a, RNU48, and RNU6B in the TaqManH MicroRNA Assays (4427975, Applied Biosystems, Life Technologies Grand Island, NY 14072 USA). The TaqMan® MicroRNA Assays provided the primers for miR-191-5p and the controls. The PCR reactions for the miRNAs were analyzed using PCR7900 (Applied Biosystems) in December 2011. The 2-Δcq method was applied to examine the miR-191-5p expression of both HCC and its adjacent healthy liver tissues.

Exploration for the prognostic significance of miR-191-5p in HCC based on microarray data

The GEO profiles with the prognostic data of miR-191-5p in HCC were collected from the SurvMicro website [17]. The hazard ratios (HRs) and corresponding confidence intervals (CIs) of each profile were extracted to execute the pooled analysis on Stata 12.0. HCC patients with high miR-191-5p levels were more likely to suffer from poorer outcomes when the pooled HR was greater than 1.

Statistical analysis for the clinical implication of miR-191-5p in HCC

The miR-191-5p expression data and clinical characteristics of HCC patients were retrieved from the qualified included profiles and in-house patient samples. The expression values of miR-191-5p were presented as the mean values and standard deviations (SD), and all statistical calculation was dealt with using SPSS 22.0. Student’s paired t-test and independent sample t-test were adopted to calculate the difference of miR-191-5p in the two paired or unpaired groups, respectively. One-way analysis of variance was employed to estimate the values of more than two groups. The correlation analysis was executed by the Spearman’s method. The distinguishing potential of miR-191-5p in HCC from non-HCC tissues was evaluated by the receiver operator characteristic (ROC) curve.

To access the underlying value of miR-191-5p in HCC, we utilized Stata 12.0 to merge the standardized mean differences (SMD) and the 95% CIs of all included profiles and institute qRT-PCR data. The pooled results showed marked heterogenicity with a p value of less than 0.05 and I2 statistics of more than 50%, which pointed to the selection of the random effects model. By contrast, the fixed effects model was employed when the p value was greater than 0.05 and the I2 was less than 50%. The potential publication bias was estimated by Begg’s tests. Sensitivity analysis was adopted to test the effect of each profile on the pooled result. The summary receiver operating characteristic (SROC) curve was drawn using Stata 12.0, and we calculated the concrete value of the area under the curve (AUC) to access the ability of miR-191-5p to distinguish patients with HCC from individuals without HCC. Furthermore, the pooled specificity and sensitivity, as well as the positive and negative likelihood ratios, were calculated. The level of the two-sided p values lower than 0.05 was determined to be statistically significant.

Acquirement of the predicted miR-191-5p targets for and differentially expressed genes in HCC

We applied miRWalk2.0, a platform mainly used for miRNA-targets prediction, to collect the likely targets for miR-191-5p. Twelve databases were involved in the prediction analysis [18]. Only the genes nominated by more than four databases were selected as possible targets for miR-191-5p. The differentially expressed genes (DE-genes) were identified by a GEO microarray (GSE22790), which recorded the values of gene expression in the HCC cell lines after treating with anti-miR-191-5p (the experimental group) and without anti-miR-191-5p (the control group). Then, a part of the DE-genes was recognized as potential miR-191-5p targets when it showed elevated expression levels in this microarray file (|log2 fold changes (FC)|>=1.0, P<0.05).

Signaling pathway analysis for overlapping genes

Finally, the intersection elements of the particularly selected predicted targets of miR-191-5p and the DEGs recognized by GSE22790 were considered the candidate target genes of miR-191-5p. The key genes were adopted to determine the underlying mechanism of miR-191-5p in HCC. Originally, FunRich3.0 was used to perform the GO enrichment and pathway analysis of the target genes [19]. The GO analysis aimed to find the annotations among the biological processes, cellular component, and molecular function in HCC. Pathway enrichment showed the signaling pathways involved in HCC. The detailed files were ultimately downloaded to display the terms involved in the GO and pathway analyses. Moreover, the String database was adopted to construct a visualized and comprehensive PPI network, reflecting the relationship among the total selected genes [20]. The genes commonly involved in the most enriched pathways and the PPI network were considered as miR-191-5p potential targets. As the pooled result of the microarray datasets indicated a high expression trend of miR-191-5p in HCC, its target genes were likely to show down-regulated levels. Thus, we utilized the current microarray data in the GEO and ArrayExpress databases to analyze the expression levels of the candidate targets and the details described above.

Results

Characteristics of the eligible GEO and ArrayExpress profiles

In total, 13 eligible profiles associated with miR-191-5p and HCC, as well as 40 datasets related to mRNA and HCC, were selected for later analysis. The samples used for the experiments of each profile were obtained from the HCC and non-HCC tissues, except one from the plasma specimens (GSE50013). The main characteristics are presented in Table 2. The scatter point plots of all the qualified profiles are illustrated in Figure 1. Nine records exhibited a potential trend of increased miR-191-5p expression in HCC tissues (GSE21362, GSE36915, GSE50013, GSE57555, GSE64632, GSE6857, GSE74618, GSE98269, and E-MTAB-4170). Specifically, the miR-191-5p expression was markedly higher in the HCC tissues than in the control group in five records, namely, GSE21362 (P=0.000), GSE50013 (P=0.036), GSE64632 (P=0.022), GSE6857 (P=0.000), and GSE74618 (P=0.000). By contrast, the miR-191-5p levels were lower in the tissue samples from HCC patients than in the control samples in E-MTAB-3347 (P=0.021).

Table 2.

Summary characteristics of the 13 eligible microarray datasets and institute qRT-PCR data

Study ID First author Year Country Sample type Cancer N Cancer M Cancer SD Control N Control M Control SD t p
GSE21362 Sato F 2011 Japan Tissue 73 3.3716 0.06477 73 3.3199 0.04448 5.279* 0.000
GSE36915 Shih TC 2013 China Tissue 68 14.2863 0.60812 21 14.1893 0.51409 0.661 0.510
GSE40744 Diaz G 2013 USA Tissue 26 12.4727 0.18589 50 12.5364 0.20617 -1.32 0.191
GSE41874 Morita K 2013 Japan Tissue 3 -0.2813 0.15965 3 -0.1226 0.19319 -0.91* 0.459
GSE50013 Shen J 2013 USA Plasma 20 4.2848 1.9911 20 2.4307 3.05166 2.261* 0.036
GSE54751 Shen J 2014 USA Tissue 10 -1.9798 0.36558 10 -1.8769 0.73523 -0.558* 0.590
GSE57555 Taguchi Y 2015 Japan Tissue 5 -0.0429 0.00605 16 -0.0546 0.01826 1.392 0.180
GSE64632 Peng H 2015 USA Tissue 3 3.3054 0.57741 3 0.6166 0.13044 6.653* 0.022
GSE6857 Budhu A 2008 USA Tissue 180 11.9961 0.94749 241 11.4932 0.80217 5.747 0.000
GSE74618 Villanueva A 2016 Spain Tissue 218 9.9458 0.40948 10 9.754 0.10762 4.368 0.000
GSE98269 Xie Z 2017 China Tissue 3 2.3833 0.01552 3 2.3761 0.02177 0.347* 0.762
E-MTAB-3347 Feng F 2015 China Tissue 3 2.7215 0.05472 3 2.7648 0.06191, -6.846* 0.021
E-MTAB-4170 NR 2017 NR Tissue 24 8.0076 0.78095 24 7.7438 1.2623 1.457* 0.159
In-house qRT-PCR NR NR NR Tissue 89 5.0665 8.3513 89 0.8735 0.69222 4.765* 0.000

N: Number of samples; M: Mean value of miR-191-5p expression; SD: standard deviation;

*

Paired samples t-test was utilized.

Figure 1.

Figure 1

Scatter point plots establishing the miR-191-5p expression in the included records.

MiR-191-5p expression in clinical HCC patients

We obtained 178 clinical tissue samples from 89 HCC patients, including cancer and their paired non-cancerous tissues. A significantly higher miR-191-5p expression was identified in the HCC samples (5.067±8.351) than in the corresponding non-cancerous hepatic samples (0.876±0.692; P=0.001, Table 2; Figure 1). The remarkably elevated miR-191-5p expression was detected in the clinically advanced stages (TNM III and IV, 6.203±9.433) rather than in the early stages (TNM I and II, 1.807±1.049, P=0.000). Similarly, the miR-191-5p levels were up-regulated in the HCC tissues with metastasis (7.244±9.91) but not in the non-metastasis tissues (2.84±5.675, P=0.012). A higher miR-191-5p expression was identified in the groups of higher pathological grade (4.090±3.077, P=0.022), multi-nodes (7.835±12.093, P=0.030), non-encapsulated HCC (6.856±10.2, P=0.047), and elderly individuals (7.092±11.045, P=0.032) than in their corresponding control groups. By contrast, with regard to AFP examination, the miR-191-5p levels were down-regulated in the positive AFP groups (2.988±3.359) in comparison with the negative AFP groups (7.277±11.824, P=0.038). However, no obvious correlation was found between the miR-191-5p expression and the rest of the clinical parameters.

Clinical significance of the miR-191-5p expression in HCC

In total, 1,291 samples were included in a meta-analysis, among which 725 were included in the experimental groups and 566 in the control groups. The pooled results of all included records suggested that the miR-191-5p levels were significantly different among the samples between patients with HCC and the non-cancerous controls (SMD=0.400, 95% CI=0.139-0.663, P=0.003). The random effect model was used because of the obvious heterogeneity (P=0.001, I2=63.8%), as shown in Figure 2. No publication bias was evaluated in this study, as the p value of Begg’s (P=0.443) test was greater than 0.05 (Figure 2). The sensitivity analysis is illustrated in Figure 2.

Figure 2.

Figure 2

Meta-analysis of the miR-191-5p expression in hepatocellular carcinoma (HCC). A. Forest plot of the 14 included records that detected miR-191-5p in HCC applying a random effects model (I2=63.80%, P=0.001). The pooled result (SMD=0.400>0, 95% CI: 0.139-0.661) was indicative of the miR-191-5p up-regulation in the HCC samples. B. Begg’s funnel plot was used to assess the potential publication bias, and no obvious publication bias was found (P=0.443>0.05). C. Sensitivity analysis was used to evaluate the possible source of heterogenicity.

Likely diagnosis ability of miR-191-5p in HCC

The diagnostic value of each eligible record was varied, as identified by the ROC curves (Figure 3). The AUC of the plotted sROC curve was 0.740 (95% CI=0.700-0.780), suggesting that miR-191-5p could function as an effective biomarker to diagnose patients with HCC at an earlier stage (Figure 4). The merged diagnostic sensitivity (0.678, 95% CI: 0.567-0.772) and specificity (0.741, 95% CI: 0.522-0.882) are shown in Figure 4. The pooled results of the diagnostic odds ratio (6.009, 95% CI: 2.975-12.137), positive likelihood ratio (2.614, 95% CI: 1.418-4.819, I2=78.84%), and negative likelihood ratio (0.435, 95% CI: 0.348-0.544, I2=42.40%) were also calculated. These results proved the diagnostic ability of miR-191-5p in HCC. The p value of the publication bias analysis was 0.539, and thus this study could be considered to have no publication bias.

Figure 3.

Figure 3

ROC curves of the included records to show the diagnostic ability of miR-191-5p in HCC tissues.

Figure 4.

Figure 4

Diagnostic meta-analysis. A. SROC curve to discriminate HCC patient tissues from non-HCC controls based on miR-191-5p expression. B. Forest plot of the evaluated sensitivity. C. Forest plot of the evaluated specificity.

Prognostic significance of miR-191-5p in HCC

We acquired three GEO profiles, namely, GSE10694 (HR=1.280, 95% CI: 0.880-1.850, P=0.197), GSE31384 (HR=0.694, 95% CI: 0.433-1.11, P=0.131), and GSE6857 (HR=1.204, 95% CI: 0.769-1.887, P=0.413), recording the prognostic data of miR-191-5p for the HCC and non-HCC patients. However, none of the three chips, as well as the pooled result (HR=1.042, 95% CI: 0.721-1.504, P=0.828), had statistical significance. However, there was a tendency in GSE10694, GSE6857, and the pooled result that a higher miR-191-5p level was correlated with poorer outcomes for HCC patients (Figure 5).

Figure 5.

Figure 5

Kaplan-Meier survival curve to show the potential miR-191-5p prognostic significance in HCC. A. Forest plots of the three eligible GEO profiles. B and C. A higher miR-191-5p expression implied likely poorer outcomes in GSE10694 (HR=1.280, 95% CI: 0.880-1.850, P=0.197). D and E. A higher miR-191-5p expression implied likely poorer outcomes in GSE6857 (HR=1.204, 95% CI: 0.769-1.887, P=0.413).

Potential hub genes

In total, 19,034 gene records were predicted by 12 online databases after deleting the repeated genes. To ensure accuracy, the sum of 2,032 genes identified by at least four databases was derived as the most likely target genes. By analyzing the gene expression data of GSE22790, we obtained 491 up-regulated DE-genes to integrate with the selected predicted target genes in HCC. Finally, we collected 64 overlapping genes, which could be considered as the likely miR-191-5p targets in the regulation of HCC. The overlapping outcome is illustrated in a Venn diagram in Figure 6.

Figure 6.

Figure 6

Exploration results for the underlying mechanisms of miR-191-5p in HCC. A. Venn diagram of the crucial genes involved in the bioinformatics analysis. B. The most significant pathways. C. The most significant biological process. D. The most significant cellular component. E. The most significant molecular function.

Underlying mechanism of miR-191-5p in HCC by bioinformatics analysis

The candidate targets were then inputted into FunRich 3.1.3 for the subsequent bioinformatics analysis. The most significant pathways and GO terms (P<0.05) are listed in Table 3. According to the results, the target genes were highly enriched in several pathways, including p75-neurotrophin receptor (p75-NTR)-mediated signaling, liver kinase B1 (LKB1) signaling events, and CXCR4-mediated signaling events; all were closely related to the growth of HCC cells (Figure 6). Additionally, the candidate targets were involved in the biological process of signal transduction and related to activities of certain cellular components, such as the nucleus, DNA ligase IV complex, plasma membrane-enriched fraction, and DNA-dependent protein kinase-DNA ligase 4 complex (Figure 6). Moreover, by targeting the likely targets, miR-191-5p could participate in the regulation of the intracellular transporter activity, receptor regulator activity, ubiquitin-specific protease activity, and other molecular functions (Figure 6).

Table 3.

The most significantly enriched pathways and gene ontology terms of miR-191-5p

Terms Count Percentage (%) P-value
Biological pathway
    p75-NTR-mediated signaling 6 22.222 <0.001
    LKB1 signaling events 14 51.852 <0.001
    CXCR4-mediated signaling events 5 18.519 0.001
    Insulin Pathway 13 48.148 0.001
    Internalization of ERBB1 13 48.148 0.001
    Urokinase-type plasminogen activator (uPA) and uPAR-mediated signaling 13 48.148 0.001
    PDGFR-beta signaling pathway 13 48.148 0.001
    EGF receptor (ERBB1) signaling pathway 13 48.148 0.001
    Class I PI3K signaling events 13 48.148 0.001
    Arf6 signaling events 13 48.148 0.001
Biological process
    Signal transduction 19 32.759 0.034
Cellular component
    Nucleus 35 72.917 <0.001
    DNA ligase IV complex 1 2.083 0.007
    Plasma membrane enriched fraction 1 2.083 0.013
    DNA-dependent protein kinase-DNA ligase 4 complex 1 2.083 0.013
    Vacuole 1 2.083 0.013
    Non-homologous end joining complex 1 2.083 0.020
    Azurophil granule 1 2.083 0.020
    Specific granule 1 2.083 0.026
    MLL5-L complex 1 2.083 0.026
    Kinesin complex 1 2.083 0.029
Molecular function
    Intracellular transporter activity 1 1.724 0.013
    Receptor regulator activity 1 1.724 0.019
    Ubiquitin-specific protease activity 4 6.897 0.032
    Lipid binding 1 1.724 0.035
    Guanyl-nucleotide exchange factor activity 2 3.448 0.050

Figure 7 shows the PPI network. The three genes that were greatly involved in the top two enriched pathways and the PPI network could be the vital target genes of miR-191-5p [early growth response 1 (EGR1), NEDD4L, and UBE2D3], as shown in Figure 7. According to the pooled result of the profiles and qRT-PCR data, miR-191-5p showed a high expression in HCC. Thus, the genes with decreased expression levels in HCC were recognized as the likely targets of miR-191-5p. Particularly, the expression of EGR1 and UBE2D3 showed a lower level trend in HCC (Figure 8). Thus, we hypothesize that EGR1 and UBE2D3 have great potential to be miR-191-5p targets in HCC.

Figure 7.

Figure 7

A. Protein-protein interactions of the 64 included genes. B. The likely target genes of miR-191-5p in HCC; we regarded the genes as the miR-191-5p targets that were involved in the top two significant pathways and that frequently interacted with other genes in the PPI network.

Figure 8.

Figure 8

Forest plot of the two target genes. A. UBE2D3 expression was down-regulated in HCC tissues. B. EGR1 expression was decreased in HCC tissues.

Discussion

In this study, the up-regulation of miR-191-5p was observed in HCC tissues according to the pooled result of our meta-analysis by microarray profiles and qRT-PCR data. The elevated miR-191-5p levels were clearly correlated with the advanced stages, metastasis, and high pathological grade of HCC, suggesting the oncogene role of miR-191-5p. Moreover, miR-191-5p was recognized to be correlated with the modulation of several processes in HCC cellular metabolism. EGR1 and UBE2D3 were identified as the key genes involved in the modulation network of miR-191-5p in HCC.

Previous studies showed that miR-191-5p was used as an endogenous reference gene based on its suitability for the qRT-PCR analysis of different samples from diverse cancer types, including tissues, serum, or plasma samples, obtained from HCC patients [21,22]. However, growing evidence reveals that miR-191-5p is differentially expressed in certain cancers. MiR-191-5p has been reported to be significantly elevated in HCC tissues as a carcinogenic factor, thus leading to poor outcomes for patients [23,24]. He et al. particularly mentioned that the up-regulation of miR-191-5p in HCC patients was potentially correlated with the hypomethylation occurring in the miR-191-5p locus [23]. Similarly, an increased expression of miR-191-5p was previously found in cholangiocarcinoma (CCA). A recent study utilizing qRT-PCR to examine the miRNA levels in CCA confirmed that miR-191-5p was overexpressed and associated with the deterioration of CCA [25]. Another qRT-PCR analysis determined that miR-191-5p was up-regulated in CCA [26]. Consistent with the aforementioned reports, we observed that miR-191-5p showed a high expression in HCC tissues in our analysis of 1,291 clinical samples and that the overexpression of miR-191-5p could lead to an unfavorable outcome for HCC patients.

MiR-191-5p has been applied as a diagnostic biomarker in several cancers. A recent report showed that miR-191-5p was over-expressed in patients diagnosed with pancreatic cancer [27]. Wang et al. found the significant diagnostic capacity of miR-191-5p in osteosarcomas by detecting its expression in the serum of patients [28]. A clinical research also mentioned the early diagnostic value of miR-191-5p in gastric cancer (GC) because it was remarkably up-regulated in the tissues and serum of GC patients in comparison with the normal controls [13]. To date, studies on the diagnostic significance of miR-191-5p for HCC are scarce. Li et al. revealed that miR-191-5p could be used as a specific biomarker combined with other miRNAs, such as miR-221 and miR-let-7a, to diagnose HCC rapidly [29]. Similarly, one of our GEO profiles (GSE50013) showed a higher miR-191-5p level in the HCC plasma samples than in the non-HCC samples. This result implies that miR-191-5p could have a certain diagnostic capacity in HCC through the methods for examining its expression level in the serum or plasma samples of patients and that it is greatly beneficial in the early diagnosis of HCC.

Several studies revealed the underlying mechanism of miR-191-5p in HCC. In 2010, Elyakim et al. initially proposed that the over-expression of miR-191-5p could definitely produce positive effects on HCC growth; by contrast, its suppression induced HCC cell death in an animal experiment, thus implying the potential of miR-191-5p in a new HCC therapy for humans [29]. Afterward, He et al. confirmed the previous results in their report [23]. A new study discovered that an up-regulated miR-191-5p expression was correlated with the induction of epithelial mesenchymal transition, which was possibly related to the tumorigenesis of HCC [30]. Additionally, Huang et al. verified the carcinogenic role of miR-191-5p in HepG2 cells in vitro [31].

In our study, we found that p75-NTR-mediated signaling and LKB1 signaling pathways were greatly enriched through a series of bioinformatics analyses. p75-NTR, a multifunctional receptor that belongs to both the nerve growth factor receptor family and the tumor necrosis factor receptor superfamily, demonstrates several biological activities related to neuronal cells, prominently the meditation of neural cell death [32,33]. p75-NTR was speculated to function as an inhibitor in the growth and proliferation of tumor cells and as an inducer in cancer cell apoptosis [34]. To date, only He et al. mentioned that a significant decrease in p75-NTR expression was found in clinical liver cancer tissues and that increased p75-NTR levels in vitro could drastically attenuate the growth of HCC cells, mainly by inducing a cell cycle arrest [35]. Thus, they hypothesized that p75-NTR could potentially act as a tumor suppressor in HCC.

LKB1, also called serine/threonine kinase 11, prominently induces the activation of AMP-activated protein kinase after phosphorylation, and it is involved in the suppression of the developmental processes of cancer cells as a tumor inhibitor in many cancers [36-38]. A previous study demonstrated that the LKB1 expression decreased in HCC cells in vitro and that the reduction of LKB1 led to the epithelial-mesenchymal transition in HCC, suggesting the protective role of LKB1 in liver cancer [39]. Wang et al. established that chemokine ligand 17 is a promoter in HCC progression by blocking the nucleo-cytoplasmic translocation of LKB1 to reinforce the malignant migration and invasion, thus implying the protective role of LKB1 in HCC [40]. Several studies also identified the similar HCC suppressive function of LKB1 [41-43]. Thus, we assumed that miR-191-5p could be a vital participant in promoting the occurrence and development of liver malignant tumors by governing the above two pathways as an oncogene. However, further experiments are required to confirm this speculation.

We observed that EGR1 and UBE2D3 were both involved in the above-described pathways and frequently interacted with other genes in the PPI network. Moreover, the expression levels of the two genes were down-regulated in HCC tissues based on the data mining of the current microarray information, thus implying that miR-191-5p could be implicated in HCC carcinogenesis by targeting the two genes.

Early growth response 1 (EGR1) encodes a nuclear protein that manifests as a vital regulator involved in transcriptional processes, and it activates its target genes to produce proteins associated with differentiation and mitogenesis [44,45]. Recent studies showed that EGR1 had a suppressive role in certain cancers (e.g., breast cancer and esophageal squamous cell carcinoma) and that miR-191-5p could induce cancer initiation and progression by negatively regulating EGR1 expression [46,47]. However, research showing the relationship between EGR1 and miR-191-5p in HCC is scarce, and previous studies failed to evaluate the exact function of EGR1 in HCC. Hao et al. found that EGR1 showed a slight or even no expression in HCC cell lines and tissues and that it could be considered a type II tumor inhibitor [48]. They and Wang et al. [49] validated the inhibitory effect of EGR1 in an in vitro experiment. By contrast, the tumorigenic role of EGR1 was also reported [50,51]. Magee et al. summarized in a review that EGR1 could be an activator or a repressor in liver cancer [52]. We identified a low expression of EGR1 in HCC tissues based on the GEO and ArrayExpress profiles. This low expression could be inversely regulated by miR-191-5p, thus suggesting its potential HCC suppressive role. Therefore, further experiments remain to be conducted.

UBE2D3 encodes the ubiquitin conjugating enzymes E2D3 and is implicated in ubiquitination pathways to modulate a series of cellular activities, including cell growth, apoptosis, DNA damage repair, and carcinogenesis [53,54]. Accumulating evidence shows that the over-expression of UBE2D3 will decrease cell motility and invasiveness likely by inactivating the human telomerase reverse transcriptase, a risk factor in diverse cancers [55,56]. Additionally, an elevated UBE2D3 expression was proved to increase the radiosensitivity of breast cancer and esophageal carcinoma cells as a promising molecular target [55,57,58]. However, the correlation between UBE2D3 and miR-191-5p in HCC has not been reported yet. Interestingly, we found that miR-191-5p was potentially implied in the regulation of ubiquitin-specific protease activity in our study, thus indicating UBE2D3 to be an inhibitor in HCC through the negative regulation of miR-191-5p. Further studies are required to elucidate our hypothesis.

Conclusion

In sum, our comprehensive analysis of in-house qRT-PCR and microarray data could recognize the over-expressed level of miR-191-5p in HCC. The bioinformatics analysis was suggestive of the oncogenic role of miR-191-5p likely by inversely governing two cancer-related pathways, namely, p75-NTR and LKB1-mediated signaling events, and its underlying target genes, namely, EGR1 and UBE2D3. These findings strengthen our insight into the cancerogenic effects of miR-191-5p on HCC and provide new perspectives for HCC treatment.

Acknowledgements

The authors are thankful for the use of the GEO and ArrayExpress databases and the software employed in the study. The study was supported by the Promoting Project of Basic Capacity for Young and Middle-aged University Teachers in Guangxi (2017KY0111, 2018KY0123), Innovation Project of Guangxi Graduate Education (YCBZ2017045), the National Natural Science Foundation of China (31760319).

Disclosure of conflict of interest

None.

References

  • 1.Siegel RL, Miller KD, Jemal A. Cancer statistics, 2019. CA Cancer J Clin. 2019;69:7–34. doi: 10.3322/caac.21551. [DOI] [PubMed] [Google Scholar]
  • 2.Daher S, Massarwa M, Benson AA, Khoury T. Current and future treatment of hepatocellular carcinoma: an updated comprehensive review. J Clin Transl Hepatol. 2018;6:69–78. doi: 10.14218/JCTH.2017.00031. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Erstad DJ, Fuchs BC, Tanabe KK. Molecular signatures in hepatocellular carcinoma: a step toward rationally designed cancer therapy. Cancer. 2018;124:3084–3104. doi: 10.1002/cncr.31257. [DOI] [PubMed] [Google Scholar]
  • 4.Zhao H, Kuang L, Wang L, Ping P, Xuan Z, Pei T, Wu Z. Prediction of microRNA-disease associations based on distance correlation set. BMC Bioinformatics. 2018;19:141. doi: 10.1186/s12859-018-2146-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Alfonsi R, Grassi L, Signore M, Bonci D. The double face of exosome-carried microRNAs in cancer immunomodulation. Int J Mol Sci. 2018;19 doi: 10.3390/ijms19041183. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Meng X, Dai W, Zhang K, Dong H, Zhang X. Imaging multiple microRNAs in living cells using ATP self-powered strand-displacement cascade amplification. Chem Sci. 2018;9:1184–1190. doi: 10.1039/c7sc04725h. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Testa U, Pelosi E, Castelli G, Labbaye C. miR-146 and miR-155: two key modulators of immune response and tumor development. Noncoding RNA. 2017;3 doi: 10.3390/ncrna3030022. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Pordzik J, Pisarz K, De Rosa S, Jones AD, Eyileten C, Indolfi C, Malek L, Postula M. The potential role of platelet-related microRNAs in the development of cardiovascular events in high-risk populations, including diabetic patients: a review. Front Endocrinol (Lausanne) 2018;9:74. doi: 10.3389/fendo.2018.00074. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Varendi K, Kumar A, Harma MA, Andressoo JO. miR-1, miR-10b, miR-155, and miR-191 are novel regulators of BDNF. Cell Mol Life Sci. 2014;71:4443–4456. doi: 10.1007/s00018-014-1628-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Elyakim E, Sitbon E, Faerman A, Tabak S, Montia E, Belanis L, Dov A, Marcusson EG, Bennett CF, Chajut A, Cohen D, Yerushalmi N. hsa-miR-191 is a candidate oncogene target for hepatocellular carcinoma therapy. Cancer Res. 2010;70:8077–8087. doi: 10.1158/0008-5472.CAN-10-1313. [DOI] [PubMed] [Google Scholar]
  • 11.Zhang XF, Li KK, Gao L, Li SZ, Chen K, Zhang JB, Wang D, Tu RF, Zhang JX, Tao KX, Wang G, Zhang XD. miR-191 promotes tumorigenesis of human colorectal cancer through targeting C/EBPbeta. Oncotarget. 2015;6:4144–4158. doi: 10.18632/oncotarget.2864. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Nagpal N, Ahmad HM, Chameettachal S, Sundar D, Ghosh S, Kulshreshtha R. HIF-inducible miR-191 promotes migration in breast cancer through complex regulation of TGFbeta-signaling in hypoxic microenvironment. Sci Rep. 2015;5:9650. doi: 10.1038/srep09650. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Peng WZ, Ma R, Wang F, Yu J, Liu ZB. Role of miR-191/425 cluster in tumorigenesis and diagnosis of gastric cancer. Int J Mol Sci. 2014;15:4031–4048. doi: 10.3390/ijms15034031. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Rong M, Chen G, Dang Y. Increased miR-221 expression in hepatocellular carcinoma tissues and its role in enhancing cell growth and inhibiting apoptosis in vitro. BMC Cancer. 2013;13:21. doi: 10.1186/1471-2407-13-21. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Dang Y, Luo D, Rong M, Chen G. Underexpression of miR-34a in hepatocellular carcinoma and its contribution towards enhancement of proliferating inhibitory effects of agents targeting c-MET. PLoS One. 2013;8:e61054. doi: 10.1371/journal.pone.0061054. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Chen WJ, Gan TQ, Qin H, Huang SN, Yang LH, Fang YY, Li ZY, Pan LJ, Chen G. Implication of downregulation and prospective pathway signaling of microRNA-375 in lung squamous cell carcinoma. Pathol Res Pract. 2017;213:364–372. doi: 10.1016/j.prp.2017.01.007. [DOI] [PubMed] [Google Scholar]
  • 17.Aguirre-Gamboa R, Trevino V. SurvMicro: assessment of miRNA-based prognostic signatures for cancer clinical outcomes by multivariate survival analysis. Bioinformatics. 2014;30:1630–1632. doi: 10.1093/bioinformatics/btu087. [DOI] [PubMed] [Google Scholar]
  • 18.Dweep H, Gretz N. miRWalk2.0: a comprehensive atlas of microRNA-target interactions. Nat Methods. 2015;12:697. doi: 10.1038/nmeth.3485. [DOI] [PubMed] [Google Scholar]
  • 19.Pathan M, Keerthikumar S, Chisanga D, Alessandro R, Ang CS, Askenase P, Batagov AO, Benito-Martin A, Camussi G, Clayton A, Collino F, Di Vizio D, Falcon-Perez JM, Fonseca P, Fonseka P, Fontana S, Gho YS, Hendrix A, Hoen EN, Iraci N, Kastaniegaard K, Kislinger T, Kowal J, Kurochkin IV, Leonardi T, Liang Y, Llorente A, Lunavat TR, Maji S, Monteleone F, Øverbye A, Panaretakis T, Patel T, Peinado H, Pluchino S, Principe S, Ronquist G, Royo F, Sahoo S, Spinelli C, Stensballe A, Théry C, van Herwijnen MJC, Wauben M, Welton JL, Zhao K, Mathivanan S. A novel community driven software for functional enrichment analysis of extracellular vesicles data. J Extracell Vesicles. 2017;6:1321455. doi: 10.1080/20013078.2017.1321455. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Szklarczyk D, Morris JH, Cook H, Kuhn M, Wyder S, Simonovic M, Santos A, Doncheva NT, Roth A, Bork P, Jensen LJ, von Mering C. The STRING database in 2017: quality-controlled protein-protein association networks, made broadly accessible. Nucleic Acids Res. 2017;45:D362–D368. doi: 10.1093/nar/gkw937. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Li Y, Xiang GM, Liu LL, Liu C, Liu F, Jiang DN, Pu XY. Assessment of endogenous reference gene suitability for serum exosomal microRNA expression analysis in liver carcinoma resection studies. Mol Med Rep. 2015;12:4683–4691. doi: 10.3892/mmr.2015.3919. [DOI] [PubMed] [Google Scholar]
  • 22.Wang Y, Shi J, Wu Y, Xu W, Wang Q, Zhang J, Jiang M, Gu G. Use of Luminex xMAP bead-based suspension array for detecting microRNA in NSCLC tissues and its clinical application. Tumori. 2012;98:792–799. doi: 10.1177/030089161209800618. [DOI] [PubMed] [Google Scholar]
  • 23.He Y, Cui Y, Wang W, Gu J, Guo S, Ma K, Luo X. Hypomethylation of the hsa-miR-191 locus causes high expression of hsa-mir-191 and promotes the epithelial-to-mesenchymal transition in hepatocellular carcinoma. Neoplasia. 2011;13:841–853. doi: 10.1593/neo.11698. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Chen YJ, Thang MW, Chan YT, Huang YF, Ma N, Yu AL, Wu CY, Hu ML, Chiu KP. Global assessment of Antrodia cinnamomea-induced microRNA alterations in hepatocarcinoma cells. PLoS One. 2013;8:e82751. doi: 10.1371/journal.pone.0082751. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Li H, Zhou ZQ, Yang ZR, Tong DN, Guan J, Shi BJ, Nie J, Ding XT, Li B, Zhou GW, Zhang ZY. MicroRNA-191 acts as a tumor promoter by modulating the TET1-p53 pathway in intrahepatic cholangiocarcinoma. Hepatology. 2017;66:136–151. doi: 10.1002/hep.29116. [DOI] [PubMed] [Google Scholar]
  • 26.Kang PC, Leng KM, Liu YP, Liu Y, Xu Y, Qin W, Gao JJ, Wang ZD, Tai S, Zhong XY, Cui YF. miR-191 inhibition induces apoptosis through reactivating secreted frizzled-related protein-1 in cholangiocarcinoma. Cell Physiol Biochem. 2018;49:1933–1942. doi: 10.1159/000493654. [DOI] [PubMed] [Google Scholar]
  • 27.Goto T, Fujiya M, Konishi H, Sasajima J, Fujibayashi S, Hayashi A, Utsumi T, Sato H, Iwama T, Ijiri M, Sakatani A, Tanaka K, Nomura Y, Ueno N, Kashima S, Moriichi K, Mizukami Y, Kohgo Y, Okumura T. An elevated expression of serum exosomal microRNA-191, -21, -451a of pancreatic neoplasm is considered to be efficient diagnostic marker. BMC Cancer. 2018;18:116. doi: 10.1186/s12885-018-4006-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Wang T, Ji F, Dai Z, Xie Y, Yuan D. Increased expression of microRNA-191 as a potential serum biomarker for diagnosis and prognosis in human osteosarcoma. Cancer Biomark. 2015;15:543–550. doi: 10.3233/CBM-150493. [DOI] [PubMed] [Google Scholar]
  • 29.Li Y, Zhang L, Liu F, Xiang G, Jiang D, Pu X. Identification of endogenous controls for analyzing serum exosomal miRNA in patients with hepatitis B or hepatocellular carcinoma. Dis Markers. 2015;2015:893594. doi: 10.1155/2015/893594. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Chen C, Yang Q, Wang D, Luo F, Liu X, Xue J, Yang P, Xu H, Lu J, Zhang A, Liu Q. MicroRNA-191, regulated by HIF-2alpha, is involved in EMT and acquisition of a stem cell-like phenotype in arsenite-transformed human liver epithelial cells. Toxicol In Vitro. 2018;48:128–136. doi: 10.1016/j.tiv.2017.12.016. [DOI] [PubMed] [Google Scholar]
  • 31.Huang D, Bi C, Zhao Q, Ding X, Bian C, Wang H, Wang T, Liu H. Knockdown long non-coding RNA ANRIL inhibits proliferation, migration and invasion of HepG2 cells by down-regulation of miR-191. BMC Cancer. 2018;18:919. doi: 10.1186/s12885-018-4831-6. [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
  • 32.Meeker R, Williams K. Dynamic nature of the p75 neurotrophin receptor in response to injury and disease. J Neuroimmune Pharmacol. 2014;9:615–628. doi: 10.1007/s11481-014-9566-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Nadezhdin KD, Garcia-Carpio I, Goncharuk SA, Mineev KS, Arseniev AS, Vilar M. Structural basis of p75 transmembrane domain dimerization. J Biol Chem. 2016;291:12346–12357. doi: 10.1074/jbc.M116.723585. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Wang W, Chen J, Guo X. The role of nerve growth factor and its receptors in tumorigenesis and cancer pain. Biosci Trends. 2014;8:68–74. doi: 10.5582/bst.8.68. [DOI] [PubMed] [Google Scholar]
  • 35.Yuanlong H, Haifeng J, Xiaoyin Z, Jialin S, Jie L, Li Y, Huahong X, Jiugang S, Yanglin P, Kaichun W, Jie D, Daiming F. The inhibitory effect of p75 neurotrophin receptor on growth of human hepatocellular carcinoma cells. Cancer Lett. 2008;268:110–119. doi: 10.1016/j.canlet.2008.03.038. [DOI] [PubMed] [Google Scholar]
  • 36.Faubert B, Vincent EE, Griss T, Samborska B, Izreig S, Svensson RU, Mamer OA, Avizonis D, Shackelford DB, Shaw RJ, Jones RG. Loss of the tumor suppressor LKB1 promotes metabolic reprogramming of cancer cells via HIF-1alpha. Proc Natl Acad Sci U S A. 2014;111:2554–2559. doi: 10.1073/pnas.1312570111. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Gan RY, Li HB. Recent progress on liver kinase B1 (LKB1): expression, regulation, downstream signaling and cancer suppressive function. Int J Mol Sci. 2014;15:16698–16718. doi: 10.3390/ijms150916698. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Kottakis F, Nicolay BN, Roumane A, Karnik R, Gu H, Nagle JM, Boukhali M, Hayward MC, Li YY, Chen T, Liesa M, Hammerman PS, Wong KK, Hayes DN, Shirihai OS, Dyson NJ, Haas W, Meissner A, Bardeesy N. LKB1 loss links serine metabolism to DNA methylation and tumorigenesis. Nature. 2016;539:390–395. doi: 10.1038/nature20132. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Qiu B, Wei W, Zhu J, Fu G, Lu D. EMT induced by loss of LKB1 promotes migration and invasion of liver cancer cells through ZEB1-induced YAP signaling. Oncol Lett. 2018;16:6465–6471. doi: 10.3892/ol.2018.9445. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Wang L, Li H, Zhen Z, Ma X, Yu W, Zeng H, Li L. CXCL17 promotes cell metastasis and inhibits autophagy via the LKB1-AMPK pathway in hepatocellular carcinoma. Gene. 2018;690:129–136. doi: 10.1016/j.gene.2018.12.043. [DOI] [PubMed] [Google Scholar]
  • 41.Wu CC, Wu DW, Lin YY, Lin PL, Lee H. Hepatitis B virus X protein represses LKB1 expression to promote tumor progression and poor postoperative outcome in hepatocellular carcinoma. Surgery. 2018;163:1040–1046. doi: 10.1016/j.surg.2017.11.030. [DOI] [PubMed] [Google Scholar]
  • 42.Wang YS, Du L, Liang X, Meng P, Bi L, Wang YL, Wang C, Tang B. SIRT4 depletion promotes HCC tumorigenesis through regulating AMPKalpha/mTOR axis. Hepatology. 2019;69:1614–1631. doi: 10.1002/hep.30421. [DOI] [PubMed] [Google Scholar]
  • 43.Chen H, Zhang T, Sheng Y, Zhang C, Peng Y, Wang X, Zhang C. Methylation profiling of multiple tumor suppressor genes in hepatocellular carcinoma and the epigenetic mechanism of 3OST2 regulation. J Cancer. 2015;6:740–749. doi: 10.7150/jca.11691. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Riffo-Campos AL, Castillo J, Tur G, Gonzalez-Figueroa P, Georgieva EI, Rodriguez JL, Lopez-Rodas G, Rodrigo MI, Franco L. Nucleosome-specific, time-dependent changes in histone modifications during activation of the early growth response 1 (Egr1) gene. J Biol Chem. 2015;290:197–208. doi: 10.1074/jbc.M114.579292. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Sekiya T, Kato K, Kawaguchi A, Nagata K. Involvement of CTCF in transcription regulation of EGR1 at early G1 phase as an architecture factor. Sci Rep. 2019;9:329. doi: 10.1038/s41598-018-36753-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Di Leva G, Piovan C, Gasparini P, Ngankeu A, Taccioli C, Briskin D, Cheung DG, Bolon B, Anderlucci L, Alder H, Nuovo G, Li M, Iorio MV, Galasso M, Santhanam R, Marcucci G, Perrotti D, Powell KA, Bratasz A, Garofalo M, Nephew KP, Croce CM. Estrogen mediated-activation of miR-191/425 cluster modulates tumorigenicity of breast cancer cells depending on estrogen receptor status. PLoS Genet. 2013;9:e1003311. doi: 10.1371/journal.pgen.1003311. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Gao X, Xie Z, Wang Z, Cheng K, Liang K, Song Z. Overexpression of miR-191 predicts poor prognosis and promotes proliferation and invasion in esophageal squamous cell carcinoma. Yonsei Med J. 2017;58:1101–1110. doi: 10.3349/ymj.2017.58.6.1101. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Hao MW, Liang YR, Liu YF, Liu L, Wu MY, Yang HX. Transcription factor EGR-1 inhibits growth of hepatocellular carcinoma and esophageal carcinoma cell lines. World J Gastroenterol. 2002;8:203–207. doi: 10.3748/wjg.v8.i2.203. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Wang L, Sun H, Wang X, Hou N, Zhao L, Tong D, He K, Yang Y, Song T, Yang J, Huang C. EGR1 mediates miR-203a suppress the hepatocellular carcinoma cells progression by targeting HOXD3 through EGFR signaling pathway. Oncotarget. 2016;7:45302–45316. doi: 10.18632/oncotarget.9605. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Li H, Li J, Jia S, Wu M, An J, Zheng Q, Zhang W, Lu D. miR675 upregulates long noncoding RNA H19 through activating EGR1 in human liver cancer. Oncotarget. 2015;6:31958–31984. doi: 10.18632/oncotarget.5579. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Peng WX, Xiong EM, Ge L, Wan YY, Zhang CL, Du FY, Xu M, Bhat RA, Jin J, Gong AH. Egr-1 promotes hypoxia-induced autophagy to enhance chemo-resistance of hepatocellular carcinoma cells. Exp Cell Res. 2016;340:62–70. doi: 10.1016/j.yexcr.2015.12.006. [DOI] [PubMed] [Google Scholar]
  • 52.Magee N, Zhang Y. Role of early growth response 1 in liver metabolism and liver cancer. Hepatoma Res. 2017;3:268–277. doi: 10.20517/2394-5079.2017.36. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Stewart MD, Ritterhoff T, Klevit RE, Brzovic PS. E2 enzymes: more than just middle men. Cell Res. 2016;26:423–440. doi: 10.1038/cr.2016.35. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Middleton AJ, Wright JD, Day CL. Regulation of E2s: a role for additional ubiquitin binding sites? J Mol Biol. 2017;429:3430–3440. doi: 10.1016/j.jmb.2017.06.008. [DOI] [PubMed] [Google Scholar]
  • 55.Wang W, Yang L, Hu L, Li F, Ren L, Yu H, Liu Y, Xia L, Lei H, Liao Z, Zhou F, Xie C, Zhou Y. Inhibition of UBE2D3 expression attenuates radiosensitivity of MCF-7 human breast cancer cells by increasing hTERT expression and activity. PLoS One. 2013;8:e64660. doi: 10.1371/journal.pone.0064660. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Guan GG, Wang WB, Lei BX, Wang QL, Wu L, Fu ZM, Zhou FX, Zhou YF. UBE2D3 is a positive prognostic factor and is negatively correlated with hTERT expression in esophageal cancer. Oncol Lett. 2015;9:1567–1574. doi: 10.3892/ol.2015.2926. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Gao X, Wang W, Yang H, Wu L, He Z, Zhou S, Zhao H, Fu Z, Zhou F, Zhou Y. UBE2D3 gene overexpression increases radiosensitivity of EC109 esophageal cancer cells in vitro and in vivo. Oncotarget. 2016;7:32543–32553. doi: 10.18632/oncotarget.8869. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Yang H, Wu L, Ke S, Wang W, Yang L, Gao X, Fang H, Yu H, Zhong Y, Xie C, Zhou F, Zhou Y. Downregulation of ubiquitin-conjugating enzyme UBE2D3 promotes telomere maintenance and radioresistance of Eca-109 human esophageal carcinoma cells. J Cancer. 2016;7:1152–1162. doi: 10.7150/jca.14745. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from International Journal of Clinical and Experimental Pathology are provided here courtesy of e-Century Publishing Corporation

RESOURCES