Hepatic injury and inflammation alter ethanol metabolism and drinking behavior

Abstract

While liver injury is commonly associated with excessive alcohol consumption, how liver injury affects alcohol metabolism and drinking preference remains unclear. To answer these questions, we measured the expression and activity of alcohol dehydrogenase 1 (ADH1) and acetaldehyde dehydrogenase 2 (ALDH2) enzymes, ethanol and acetaldehyde levels in vivo, and binge-like and preferential drinking behaviors with drinking in the dark and two-bottle choice in animal models with liver injury. Acute and chronic carbon tetrachloride (CCl4), and acute LPS-induced liver injury repressed hepatic ALDH2 activity and expression and consequently, blood and liver acetaldehyde concentrations were increased in these models. In addition, chronic CCl4 and acute LPS treatment inhibited hepatic ADH1 expression and activity, leading to increases in blood and liver ethanol concentrations. Consistent with the increase in acetaldehyde levels, alcohol drinking behaviors were reduced in mice with acute or chronic liver injury. Furthermore, oxidative stress induced by hydrogen peroxide attenuated ADH1 and ALDH2 activity post-transcriptionally, while proinflammatory cytokines led to transcriptional repression of ADH1 and ALDH2 in cultured hepatocytes, which correlated with the repression of transcription factor HNF4α. Collectively, our data suggest that alcohol metabolism is suppressed by inflammation and oxidative stress, which is correlated with decreased drinking behavior.

Introduction

Today, alcohol abuse has become one of the most common causes for morbidity and mortality worldwide, due to addiction and disruptive effects on liver, brain, heart, gut and other organs (1–3). The role of alcohol metabolism in the development of liver disease has been well documented, as polymorphisms in alcohol dehydrogenase (ADH) and acetaldehyde dehydrogenase (ALDH), the major enzymatic pathway of alcohol elimination, have been shown to affect liver disease progression with alcohol consumption (4). Clinical studies have also linked altered expressions and activities of ADH or ALDH to the progression of various diseases, including cancers and cardiovascular diseases (4–9).

While the effect of alcohol on liver injury has been well-documented, how liver injury influences alcohol metabolism and drinking behaviors has been comparatively lacking. Studies have shown that the catalytic activities and expression of ADH and ALDH are affected by environmental conditions (e.g., toxicants, alcohol, drugs, infections, diet, physical hazards, tumor transformation etc.) in addition to genetic factors (e.g., gene polymorphism, mutation, allelic variation, etc.) (7, 10–16). Studies have also documented rapid repression of ADH or ALDH by carbon tetrachloride (CCl4), acrolein, and acetaminophen (APAP) treatment, suggesting that liver injury or inflammation may impede the metabolism of alcohol (17–19). In addition, the influence of acute liver inflammation and injury on drinking behavior is relatively unknown. Although drinking behavior involves complicated neurological mechanisms (20), metabolic factors also contribute to behavior alterations (21–23).

The present study attempted to investigate the influence of liver inflammation and injury on alcohol metabolism and drinking behaviors by utilizing three commonly used mouse models. We evaluated the enzyme activities, gene expression, and protein levels of ADH1 and ALDH2 in the liver and correlated these data with ethanol and acetaldehyde levels in vivo to determine the effect of liver injury on alcohol metabolism. To determine the effect of liver injury on drinking behaviors, we conducted the two-bottle paradigm and the drinking in the dark binge-like model on mice with injured or inflamed livers. Our results revealed that liver injury and inflammation downregulated major alcohol metabolizing enzymes leading to accumulation of alcohol and/or acetaldehyde, suggesting that impairment of alcohol metabolism is an often-overlooked factor that can influence drinking behavior in mice.

2. Materials and methods

2.1. Mouse experiments

Eight- to ten-week-old male C57BL/6J mice (Jackson Laboratory, Maine) were housed in a 12-hour light/dark cycle and had free access to food and water. Mice were injected intraperitoneally with CCl4 (at a dose of 0.5 ml/kg for one time or twice a week for eight weeks) or LPS from Escherichia coli 026: B6 (Sigma, St. Louis, MO, at a dose of 1 mg/kg). Mice were sacrificed and liver samples were collected at different time points after the last treatment. Mice received an oral gavage of 5 g/kg ethanol were kept on a heating pad before euthanasia to prevent hypothermia.

All mice were maintained in accordance with National Institutes of Health guidelines. The study was approved by the National Institute on Alcohol Abuse and Alcoholism’s Animal Care and Use Committee.

2.2. ADH and ALDH2 enzyme activities

Fresh tissue lysates, prepared with a Dounce homogenizer in cold PBS, or fresh cells were used for ADH and ALDH2 enzymatic activity measurements using the Alcohol Dehydrogenase Assay Kit (Abcam Cambridge, MA) and the Mitochondrial Aldehyde Dehydrogenase (ALDH2) Activity Assay Kit (Abcam Cambridge) following manufacturer’s instructions.

2.3. Drinking behavior procedures

Drinking in the dark (DID).

Mice were individually housed for a week before starting the experiment (acclimation period) and given free access to a water-containing bottle during daylight. Three hours after lights were turned off in the animal holding room, the water bottle was replaced by an ethanol-containing bottle (20% vol/vol) for two hours (days 1–3) or for four hours (day 4). Ethanol intake was measured at the end of each period. Bottle replacement was performed while a red-lamp was temporarily turned on to prevent disruption of the mice’ circadian rhythm.

Two-bottle choice paradigm.

Mice were individually housed and given free access to two water bottles. Following one week of habituation, mice were given free choice between two bottles; one of which contained regular drinking water, and the other one contained drinking water with increasing alcohol concentrations (3, 6, 9, 12, 15, 18% vol/vol) for 4 days each. Drinking volumes were measured daily and bottle positions were interchanged to prevent learned preference.

2.4. Ethanol and acetaldehyde measurement by gas chromatography-mass spectrometry (GC-MS)

Mice were deeply anesthetized one-hour after 5 g/kg ethanol gavage by a lethal dose of intraperitoneal pentobarbital injection. Blood was collected by traumatic avulsion of the orbital globe and kept for 10 minutes at room temperature in tubes containing a serum gel with clotting activator (Sarstedt, Newton, NC). Blood samples were then centrifuged at 4,000 g for 10 minutes at 4°C. The measurement method was modified from a published paper (24). In brief, 50 μl of serum or about 50 mg of liver tissue was mixed with 5 μmol of ²H₆-EtOH (internal standard for ethanol) and 0.04 μmol of ²H₄-acetaldehyde (internal standard for acetaldehyde) prior to adding 200 μl of 0.6 N perchloric acid into each sample. Serum samples were centrifuged at 1,780 g × 15 min at 2°C after vortexed for 30 sec. Liver samples were homogenized and then centrifuged at 13,200 g × 15 min at 2°C. The supernatant of each sample was quantitatively transferred into a 20 mL headspace vial and capped immediately. Headspace vials were then loaded onto the 111-vial tray of a Headspace Sampler coupled to GC/MS (Agilent Technologies, Santa Clara, CA). The concentrations of ethanol and acetaldehyde in serum and liver were calculated by comparing the integrated areas of ethanol and acetaldehyde peaks on the gas chromatograms with those of known concentrations of internal standards added in each sample.

2.5. Total RNA isolation and real-time quantitative PCR (RT-qPCR)

Total RNA was purified from liver tissues or cell samples, as previously described (25). One microgram of RNA was reverse-transcribed into cDNA using a High-capacity cDNA Reverse Transcription kit (Invitrogen, Carlsbad, CA). The expression levels of mRNA were measured by RT-qPCR with an ABI7500 real-time PCR detection system (Applied Biosystems, Foster City, CA). The mRNA level of 18s was used as an internal control. Each test was done in triple replication and the 2−ΔΔCt method was used to calculate the expression of mRNA. The following primers are used: Adh1: Forward GAAGGCTCGATAGATGCCCC, Reverse CTCTGTCAGGCAGCTCACAA; Aldh2: Forward ACCTCCCATACACCCCTACC; Reverse GCACGAGGCCCTGTAGTATC.

2.6. Western blot

Liver tissues or cell lysates were homogenized in RIPA lysis buffer at 4°C and centrifuged at 10,000 g for 10 minutes. After homogenization, the supernatants were mixed with loading buffer and subjected to SDS-PAGE and the lysates were subjected to 4–12% Tri-glycine gradient gels (Criterion XT, BioRad). Then, proteins were transferred onto nitrocellulose membranes. Membranes were blocked in 5% milk, incubated with primary antibodies at 1:1000 in PBST. Protein bands were visualized by SuperSignal West Femto Maximum Sensitivity Substrate (Thermo Fisher Scientific). Comparative amounts were normalized with β-actin. Densitometric quantification for all bands were done using Image J.

2.8. Statistical analysis

Data are expressed as the means ± SEM for each group and were analyzed using GraphPad Prism software (v. 8.0.1; GraphPad Software, La Jolla, CA). To compare values obtained from two groups, the Student t test was performed. For three or more groups, one‐way analysis of variance followed by a Tukey’s multiple comparison test was used. P values of <0.05 were considered significant.

3. Results

3.1. Acute and chronic injury caused by CCl4 impairs alcohol metabolism

To investigate the impact of CCl4-induced acute and chronic liver injury and inflammation on ethanol metabolism, we acutely injected one dose of CCl4 or chronically twice per week over 8 weeks (olive oil for control groups). Acute liver injury and inflammation induced by CCl4 initially involve the production of free radicals and damage of cell organelles, and therefore, we investigated hepatic expression of several genes related to oxidative stress to ensure the validity of our model and found that hepatic expression of some of these genes was markedly upregulated after acute or chronic CCl4 (Supp. Fig. 1). Furthermore, we found that acute CCl4 injection repressed hepatic ALDH2 activity, mRNA expression, and protein expression. Interestingly, acute CCl4 reduced ADH protein expression without affecting ADH activity and mRNA expression (Fig. 1A–C). Chronic CCl4 suppressed the activities and protein expressions of ADH1 and ALDH2, without major changes in their mRNA expressions (Fig. 1A–C). To determine what effect the CCl4-mediated repression of ADH and ALDH have on alcohol metabolism in vivo, we gave mice a 5 g/kg ethanol gavage 12h after the last CCl4 injection and obtained samples 1h post-gavage for ethanol and acetaldehyde measurements. As shown in Table 1, serum and liver ethanol or acetaldehyde levels were much higher in acute or chronic CCl4-treated mice than in control mice.

Figure 1. Acute and chronic injury caused by CCl4 impair alcohol metabolism.

C57BL/6J mice received one single CCl4 injection or twice a week CCl4 injections for 8 weeks, and liver tissues were collected 12 hours after the last injection. Hepatic ADH/ALDH2 activities (A), ADH1/ALDH2 protein levels (B), and Adh1/Aldh2 gene expressions (C) were measured. n=8–10. *P<0.05; **P<0.01; ***P<0.001.

Table 1. Ethanol and acetaldehyde levels in mice with injury and inflammation.

C57BL/6J mice were intraperitoneally injected with one dose of CCl4, one dose of LPS, or CCl4 twice a week for 8 weeks (control mice receive PBS or olive oil injections). All injured mice and controls received one ethanol gavage (5g/Kg body weight). One hour after the gavage, blood and liver samples were collected to measure metabolite levels using GC-MS. Values represent means ± SD. n=8–10. *P< 0.05, **P< 0.01. ACT: acetaldehyde.

	Acute CCl4		Chronic CCl4		Acute LPS
	Control	Treatment	Control	Treatment	Control	Treatment
Serum Ethanol (mM)	96.2 ± 19.5	114.2 ± 28.8	114.9 ± 15.2	138.8 ± 30.4*	95.3 ± 25	125.4 ± 30.7*
Liver Ethanol (mM/g)	62.6 ± 9.4	73.9 ± 10.2	65.7 ± 9.8	82.2 ± 13.9*	66.7 ± 8.9	85.4 ± 17.5*
Serum ACT (μM)	11.2 ± 1.9	16.6 ± 6.7*	11.7 ± 3.7	26.1 ± 11.4**	12.5 ± 4.3	20.9 ± 8.8*
Liver ACT (μM/g)	141.2 ± 24.7	185.9 ± 37.3*	145.1 ± 37.3	239.2 ± 64.6*	110.3 ± 16.6	163.1 ± 52.7*

3.2. Acute liver injury and inflammation induced by LPS rapidly repress ethanol metabolism

The intraperitoneal application of LPS is widely used to induce systemic and hepatic inflammation in rodents. Compared with CCl4-induced liver injury, LPS interacts with Toll-like receptors and activate well characterized intracellular cascades to initiate inflammatory responses (15). Hence, we chose the LPS liver injury model to emphasize on inflammation itself and determine its effect on ethanol metabolism. We collected liver tissues from LPS-treated mice at different time points to determine the time-dependent effect of liver inflammation. After LPS treatment, the activity of ADH1 was decreased after 6h and remained decreased for 24h, while ALDH2 activity was decreased more rapidly and remained decreased for 24h (Fig. 2A) Hepatic Adh1 mRNA decreased rapidly but returned to baseline levels after 24h while Aldh2 mRNA was decreased at 6h and remained low at 24h (Fig. 2C). The protein expression of ADH1 and ALDH2 exhibited a similar alteration pattern as their mRNA expression, with ADH1 returning to baseline levels at 24h while ALDH2 expression was still repressed at 24h (Fig. 2B). In addition, HNF1α and HNF4α, which are important transcriptional regulators of ADH1 and ALDH2, were probed to determine whether the downregulation of Adh1 and Adh2 genes was due to alternations of these two transcription factors. While HNF1α decreased slightly at 3h, there was a much more drastic decrease in HNF4α expression 3h and 6h post LPS injection (Fig. 2B). In agreement with the decreased ADH1 and ALDH2, ethanol and acetaldehyde levels in blood and liver were much higher in LPS-treated mice compared to those in control mice (Table 1).

Figure 2. Acute liver injury and inflammation induced by LPS rapidly repress ethanol metabolism.

C57BL/6J mice received one single injection of LPS and liver samples were collected at different time points after LPS administration. Hepatic ADH/ALDH2 enzyme activities (A), Adh1/Aldh2 mRNA (B), and ADH1/ALDH2 protein levels, as well as HNF1α and HNF4α protein levels (C), were measured. n=8–10. *P<0.05; **P<0.01.

3.3. Liver injury and inflammation reduce alcohol drinking behavior in mice

Since we observed decreased expression and activity of ALDH2 and corresponding increases in acetaldehyde concentrations in mice with liver injury, we probed drinking behavior by conducting drinking-in-the-dark (DID) binge-like procedure to evaluate whether liver injury-mediated accumulation of acetaldehyde discourages mice from consuming alcohol. Mice began the DID procedure 12h after receiving a final injection of CCl4 in either acute or chronic model, or the LPS model. Acute or chronic CCl4-treated mice drunk significantly less than control mice for three out of the four treatment days during these DID experiments (Fig. 3A, B). The total amount of alcohol consumed during the four-day testing experiments was much lower in acute or chronic CCl4-treated mice than in control mice (Fig. 3A–B). Next, we also examined DID binge-like drinking model in acute LPS-treated mice. Mice received one dose of LPS or PBS 12 hours before the start of the DID procedure. The LPS group exhibited a trend of reduced drinking over the first three days and significantly decreased drinking on day 4, which translated to a significantly reduced total alcohol consumption in the LPS-treated mice over the course of the experiment (Fig 3C).

Figure 3. Liver injury and inflammation reduce alcohol drinking in mice.

(A, B) Mice received one dose of CCl4 injection (A) or 8-week repeated CCl4 injections (B). Twelve hours after the last injection, the mice were subjected to the drinking-in-the-dark binge-like procedure and ethanol consumptions were measured. (C) Mice received one dose of LPS injection 12 hours before the start of the drinking-in-the-dark procedure and ethanol consumptions were measured. (D) After 8-week CCl4 treatment, the two-bottle choice paradigm was conducted to measure ethanol drinking preference. Drinking volume and preference were recorded daily. n=10. *P<0.05; **P<0.01; ***P<0.001.

To test whether chronic liver injury caused by 8w-CCl4 injection and subsequent changes in the ADH or ALDH enzyme influences drinking behaviors, mice were subjected to the two-bottle choice paradigm. Control mice exhibited a progressively increased alcohol preference at low alcohol concentrations (3%, 6% and 9% vol/vol) and this preference decreased as the alcohol concentration increased further. In contrast, mice treated with CCl4 for 8 weeks displayed a lower preference for alcohol than control mice at concentrations between 6–15%, while there were no differences when alcohol concentration reached to 18% (Fig. 3D). This lower preference translated to lower total ethanol consumption in CCl4-treated mice versus control mice at concentrations between 12–18% (Fig. 3D).

3.4. Inflammatory mediators and oxidative stress regulate ADH1 and ALDH2 expression and activity

Guided by in vivo findings, we wanted to investigate the respective roles of oxidative stress and liver inflammation in the repression of alcohol metabolism. As the CCl4 models are known to involve oxidative stress in their pathogenesis, we cultured AML12 cells with hydrogen peroxide to induce oxidative stress for different periods of time. Hydrogen peroxide treatment potently decreased ADH1 and ALDH2 protein expressions and activities (Fig. 4A, B). Surprisingly, the expressions of Adh1 and Aldh2 mRNA were not downregulated rather than upregulated after hydrogen peroxide treatment (Fig. 4C).

Figure 4. Inflammatory mediators and oxidative stress regulate ADH1 and ALDH2 expression and activity.

(A–C) AML12 cells were cultured with hydrogen peroxide (100μM) for different periods of time. Cellular ADH/ALDH2 enzyme activities (A), Adh1/Aldh2 mRNA expression (B), and ADH1/ALDH2 protein levels (C) were measured. (D) Primary mouse hepatocytes and (E) AML12 cells were cultured with proinflammatory cytokines TNF-α (2 ng/mL) and IL-6 (100 ng/mL) for 12 hours and then harvested for protein analyses. (F) AML12 cells were also cultured with TNF-α, IL-6, IL-1β (20ng/mL) and IL-22 (100ng/mL) for 3 or 6 hours to test Adh1/Aldh2 mRNA levels. (G) AML12 cells were cultured with TNF-α or IL-22 for different periods of time and then harvested for western blot analyses. (Quantification for western blots are shown in Supp. Fig. 2). n=3–10. *P<0.05; **P<0.01.

To determine how inflammation alters alcohol metabolism, we utilized both primary hepatocytes isolated from C57BL/6J mice and the AML12 cell line to test the influence of inflammation on ADH1 and ALDH2. Primary mouse hepatocytes and AML12 cells were stimulated with proinflammatory cytokines TNF-α and IL-6 for 12 hours and then harvested for protein analyses. For primary mouse hepatocytes, both inflammatory mediators suppressed the protein levels and enzymatic activities of ADH1 and ALDH2 (Fig. 4D). In the AML12 cell line, TNF-α decreased protein levels and enzymatic activities of ADH1 and ALDH2, while IL-6 decreased ALDH2 activity without affecting ALDH2 protein expression (Fig. 4E). Next, we further examined the Adh1 and Aldh2 mRNA expression in AML12 cells. As illustrated in Fig. 4F, treatment with TNF-α, IL-1β, and IL-22 but not IL-6 suppressed Adh1 mRNA expression, and all these four proinflammatory cytokines were able to decrease Aldh2 mRNA levels (Fig. 4F).

Among these proinflammatory cytokines, TNF-α and IL-22 are two most potent cytokines that repressed Adh1 and Aldh2 gene expression. In addition, IL-22 is currently being examined on clinical trials for the treatment of alcoholic hepatitis (26) and may have therapeutic potential for other types of liver diseases (27). Thus, we further examined whether TNF-α and IL-22 attenuated transcription factors upstream of ADH1 and ALDH2. As illustrated in Fig. 4G, both cytokines decreased ADH1 and ALDH2 protein expression the most at the 12h time point, which was consistent with marked downregulation of HNF4α expression. The expression of HNF1α was only slightly decreased post TNF-α or IL-22 treatment (Fig. 4G).

4. Discussion

Co-existence of liver injury and excessive alcohol consumption is commonly found in the clinic, but what effects liver injury and inflammation have on alcohol metabolism and subsequent drinking behaviors are not clear. Previous studies have shown that disruption of alcohol metabolism in the liver can have wide-ranging deleterious effects across the body, and thus, it is important to understand how acute and chronic liver injury affect alcohol elimination (10, 28). There have been reports that liver injury influences the expression of multiple enzymes involved in alcohol metabolism at the protein or RNA levels, but none have shown direct evidence of the consequences of these alterations on alcohol and acetaldehyde levels in vivo and subsequent changes in alcohol consumption behaviors (17, 29, 30). In the present study, we found that liver injury and inflammation from three different mouse models all attenuated the expression and activity of ALDH2, while chronic CCl4 and LPS treatments also decreased the expression of activity of ADH1. To validate that these alterations of expression and activity lead to reductions in alcohol metabolism in vivo, we used GC-MS to measure ethanol and acetaldehyde concentrations in the blood and the liver. Indeed, in the models where ADH1 and ALDH2 activities were inhibited, there were corresponding increases in both systemic and liver ethanol and acetaldehyde levels, while the acute CCl4 model only led to increases in blood and liver acetaldehyde levels but not ethanol levels. Clearly, liver inflammation can damage alcohol metabolism which has the potential to cause a feedback loop that worsens liver injury after ethanol intake, since people or mice with ALDH2 deficiency had more extensive liver injury and inflammation after ethanol consumption (31, 32).

It is well-known that accumulation of acetaldehyde after ingestion of ethanol, produces “sickness” reactions including flushing, headaches, nausea, and vomiting (33, 34). Many people of Asian descent carry ALDH2 variants that are inactive, and consequently, experience elevations in system acetaldehyde upon ethanol consumption that lead to sickness reactions (33). Studies have shown that people and animals with ALDH2 deficiency exhibit an aversion to alcohol drinking compared with those who express normal ALDH2 (33, 35). In fact, inhibition of ALDH2 has been used clinically as a treatment strategy to discourage alcohol consumption in alcoholics by inducing this sickness reaction (34, 36). Therefore, our data showing that all three types of liver inflammation were able to suppress the activity of ALDH2 and increase both liver and systemic acetaldehyde levels in mice led us to investigate the inflammation-mediated alterations in drinking behavior in mice. Although the ethanol and acetaldehyde levels in inflamed mice were not as high as what have been observed in ADH1 and ALDH2 deficient mice (37–40), mice treated with all three inflammatory mediators exhibited less binge-like drinking behavior in the DID model and lower total ethanol consumption. In addition, mice treated with chronic CCl4 exhibited a reduced preference for ethanol in the two-bottle choice model. Although inflammation is well known to affect aversion to ethanol drinking behavior by targeting brain, inhibition of alcohol metabolism in the liver is an understudied aspect of inflammation-mediated alteration of drinking behaviors. Previous studies probing the effect of systemic inflammation, and more specifically, neuroinflammation on alcohol consumption have typically used a recovery period of ~1 week after LPS injection to allow for “sickness-like” behaviors such as reductions in food and water intake to return to baseline and have found conflicting results (15, 41–43). One study showed that LPS pretreatment (1mg/kg) increased drinking behaviors in mice (42) while another found no change at the 1mg/kg dosage and even found a decrease in ethanol consumption at the 1.5mg/kg LPS dosage (43). LPS exerts various effects by binding to Toll-like receptor 4 (TLR4) in both the liver and the central nervous system to activate immune signaling pathways and induce inflammation (15). A recent study found that LPS-treated (1 mg/kg) rats trained to self-administer ethanol exhibit decreased ethanol self-administration on days 1–4 while TLR4-knockout rats are resistant to the “sickness” reaction of LPS treatment and exhibited similar ethanol self-administration behavior regardless of LPS injection (15). Interestingly, LPS can induce liver inflammation regardless of TLR4 expression and CCl4 induces liver inflammation and fibrosis similar in WT and TLR4-knockout mice (44). In addition, oxidative stress in the brain may also affect drinking choice, as a single dose of CCl4 (1mL/kg) has been shown to cause oxidative stress-related neurotoxicity (45). While our studies characterize a more generalized response to liver injury and inflammation, future studies should assess whether CCl4- and LPS-altered drinking behaviors require TLR4 to be present in the liver to better assess the contribution of central nervous system and liver inflammation to the alcohol avoidance phenotype demonstrated in the current study.

To delineate the mechanisms behind the decrease of hepatic alcohol metabolism, we probed the effect of oxidative stress and inflammatory cytokines on ADH1 and ALDH2 expression and activity in hepatocytes. Interestingly, oxidative stress induced by hydrogen peroxide was able to efficiently decrease the protein expression and activity of ADH1 and ALDH2 but induced their mRNA expression, indicating that oxidative stress-mediated repression of alcohol metabolizing enzymes is predominantly via post-translational modification. This aligns with previous studies showing that oxidative stress can modify ALDH2, leading to inhibition of its activity (46–49). In contrast, the mechanism behind inflammation-mediated repression of ADH1 and ALDH2 seemed to be transcriptional, as the enzyme mRNA expression was repressed along with the protein expression and activity. A wide range of proinflammatory cytokines were able to downregulate the mRNA expression of Adh1 and Aldh2, so the most potent repressors, TNF-α and IL-22, were chosen to determine whether HNF1α and HNF4α, two transcription factors known to control the expression of ADH1 and ALDH2, played a role in this process (50, 51). Both cytokines were able to efficiently inhibit HNF4α but had a minor effect on HNF1α, which was in agreement with studies demonstrating downregulation of HNF4α in LPS-treated mice, indicating that mechanism behind inflammation-mediated repression of alcohol metabolism may be due to downregulation of HNF4α. Therefore, the combination of posttranslational modifications induced by oxidative stress and repression of ADH1 and ALDH2 transcription by inflammatory cytokines likely play key roles in impairing ethanol metabolism during liver injury and inflammation.

In the current study, we show that acute and chronic liver injury and inflammation lead to the suppression of alcohol metabolizing enzymes in the liver and the impairment of alcohol metabolism. The resulting accumulation of acetaldehyde may play a role in promoting alcohol aversion induced by inflammation displayed by our mouse models. In addition, oxidative stress and inflammation regulate ADH1 and ALDH2 expression and activity, and likely cooperate to repress alcohol metabolism upon liver injury. Finally, a recent study has demonstrated that the liver is responsible for only approximately 50% acetaldehyde metabolism, suggesting that other organs also contribute to alcohol metabolism (52). Thus, it will be interesting to determine whether liver injury and inflammation also affect ADH and ALDH2 expression and activities in other organs in the future.

Highlights.

• Liver injury and inflammation impair the expression and activity of ethanol and acetaldehyde metabolizing enzyme

• Measurements of ethanol and acetaldehyde levels using GC-MS reveal the attenuated ethanol metabolizing ability in injured and inflamed livers

• Liver injury and inflammation decrease binge-like drinking behavior in mice

• Chronic liver injury reduces ethanol drinking preference in mice

Abbreviations:

ADH

alcohol dehydrogenase

ALDH

acetaldehyde dehydrogenase

CCl4

carbon tetrachloride

DID

drinking-in-the-dark

GC-MS

gas chromatography-mass spectrometry

HNF

hepatic nuclear factor

IL-6

interleukin 6

IL-1β

interleukin 1 beta

IL-22

interleukin 22

LPS

lipopolysaccharide

TLR

toll-like receptor

TNFα

tumor necrosis factor alpha