Abstract
Objective: Non-syndromic oral cleft (NSOC) is one of the most common multifactorial birth defects. A previous animal study showed PBX1 gene knockout mice consequently exhibited complete cleft lip/palate (CL/P). However, little is known about the association between PBX1 and NSOC in humans. This study investigated the role of the PBX1 gene in NSOC in the Han Chinese population. Methods: In all, 287 NSOCs were recruited for this study. First, exons in the PBX1 gene were sequenced among 50 non-syndromic cleft lip and palate cases to screen for variations by the Sanger sequencing method. Then, we selected four SNPs to replicate among 237 NSOC trios and analyzed the data by using TDT and parent of origin effect methods. Results: Exon sequencing identified six variants of the PBX1 gene. Among them, four variants were common variants. TDT analysis revealed allele G at rs2275558 and allele T at rs3835581 were over-transmitted in NSCL/P (P=0.039 and 0.038, respectively), which could increase the risk for NSCL/P. Parent of origin effect analysis indicated that allele G at rs2275558 was paternally over-transmitted for NSCL/P (P=0.0091). Conclusion: This is the first report that the PBX1 gene is associated with NSCL/P, which indicates that it is a promising candidate gene for NSCL/P.
Keywords: Non-syndromic oral cleft, Sanger sequencing, single nucleotide polymorphism, PBX1
Introduction
Non-syndromic oral cleft (NSOC) is one of the most common birth defects and exerts a heavy economic burden on families and society [1]. Birth prevalence rates of NSOC are very different across populations and geographic locations. In general, China is considered one of the high incidence countries with a rate of about 1.67 per thousand according to the latest epidemiological survey [2]. NSOCs are generally divided into non-syndromic cleft palate (NSCP), and non-syndromic cleft lip with or without cleft palate (NSCL/P). As a multifactorial disease, a complex etiology including genetic and environmental factors influences the risk of NSOC. With the wide application of high throughput sequencing technology, increasing numbers of susceptibility genes have been discovered by several large genome-wide association studies (GWASs), but these can only explain a small part of the genetic effect. Furthermore, the heterogeneity of phenotypes and uncertain inheritance patterns further complicate the role of genetics in NSOC. Attractive GWAS findings from nine GWASs for CL/P [3-11], two GWASs for CPO [12,13], and two GWAS meta-analyses [14,15] have advanced our understanding of development of NSOC and provided new perspectives for future research. However, among several susceptibility genes found by GWASs that were statistically significant, the true biologic function is unknown. Multiple SNPs in ABCA4 achieved genome-wide significance, but the subsequent whole mount in situ hybridization analysis of ABCA4 and immunodetection of expressed ABCA4 carried out in mice indicated that ABCA4 was not positively expressed in the palate [3]. Before the GWAS era, research on candidate genes based on animal models was the main method to find novel disease-causing genes. Although the process was time-consuming, it did find some true CL/P susceptibility genes that were confirmed in subsequent GWAS studies, such as IRF6 [4,16] and TP63 [15,17]. Therefore, association studies between CL/P susceptibility genes and the population based on animal models are more convincing.
PBX1 (Pre-B cell leukemia transcription homeobox 1), a member of PBX gene family, encodes TALE homeodomain-containing transcription factors (TF) [18]. The current research on PBX1 mainly focused on its role in metabolic abnormalities, cancer, and morphogenesis of the kidney and urinary tract [19-21]. Additionally, it was reported that loss of PBX genes (PBX1, PBX2 and PBX3) in mice may lead to CL/P phenotype [22]. Especially, PBX1 plays a more significant role in the formation of fully penetrant CL/P in comparison to the other two genes (PBX2 and PBX3) [23]. Another functional study indicated that PBX proteins could regulate the expressions of WNT, P63 and IRF6, subsequently control apoptosis, and finally affect the development of the midface [22]. Documented evidence showed that mutations of WNT, P63, and IRF6, downstream targets of PBX1, were associated with CL/P in both humans and mice [15,24,25]. Moreover, the PBX1 gene interacts with the ARHGAP29 gene which is a susceptibility gene for CL/P in Hispanic and non-Hispanic white (NHW) ethnicities [26]. Thus, we considered PBX1 as a promising candidate gene for NSOC.
No population study on the associations between the PBX1 gene and NSOC had been reported. The incidence of NSOC in the Western Han Chinese population is relatively high, and population mobility is quite low, making it is suitable for genetic research on NSOC. Thus, we first explored the association between the variations of PBX1 gene and the occurrence of NSOC in a Han Chinese population in Western China.
Material and methods
Subjects
The samples included 237 NSOC cases, and 50 non-syndromic cleft lip and palate (NSCLP) cases (Table 1). All subjects were recruited between 2010 and 2013 from the Cleft Lip and Palate Surgery Department of the West China Hospital of Stomatology, Sichuan University. All patients recruited in this study were diagnosed with NSOC (without any other congenital malformation of the body or a family history of genetic disease) by a physician. All subjects were self-identified as Han Chinese and were asked about the history of oral clefts among their first- and second-degree relatives. Human subject study protocols were reviewed and approved by the institutional review board (IRB) of West China Hospital of Stomatology, Sichuan University in 2015 (WCHSIRB-D-2015-057). Informed consent was obtained from each participant prior to enrollment in the study.
Table 1.
Characteristic of NSOCs patients
| NSCL/P | NSCP | NSOCs | |
|---|---|---|---|
| Severity | |||
| Complete cleft | 137 | 43 | 180 |
| Incomplete cleft | 82 | 25 | 107 |
| Sex | |||
| Male | 145 | 32 | 177 |
| Female | 74 | 36 | 110 |
Note: NSCL/P, Non-syndromic cleft lip with or without palate; NSCP, Non-syndromic cleft palate; NSOCs, Non-syndromic Oral clefts (NSCL/P&NSCP).
DNA extraction and Sanger sequencing of exons in PBX1 gene
Genomic DNA was extracted from venous blood samples drawn from all participants by the phenol-chloroform extraction protocol. The exon sequences were downloaded from the UCSC database (http://genome.ucsc.edu/). The primers were designed to cover all nine exons of PBX1 (Table 2). We performed PCR and sequencing by an ABI PRISM 3730 DNA Sequencer among fifty cases. The data were analyzed by the Sequence Scanner v1.0.
Table 2.
Exon sequencing primers of PBX1 gene
| Exon | Forward (5’ to 3’) | Reverse (5’ to 3’) | PCR Product (bp) |
|---|---|---|---|
| Exon 1 | TGAAGACAAGCTTGAAGGATAAAA | GGCCGCTTTTGGATCAGT | 600 |
| Exon 2 | TGCCACAGAGTTAGGGTTGG | ACAGTTTAGCACCCCCACAC | 597 |
| Exon 3 | TTCTCTCTTTTTCCAGCCTTTC | GAATGCCTAGGTTTTTAACAGTTG | 600 |
| Exon 4 | TTTGCACAAGTCTCTAGAAAAGC | AAGACGCAACTGTAAAAGAGGT | 600 |
| Exon 5 | GCTTTTAGCGTTGGTTTTGG | ACACCTCACCCATTTGAAGC | 596 |
| Exon 6 | TCGCATTTTATGTAGTTGTCCTTT | ATGCAAACCTCCAGACAACC | 569 |
| Exon 7 | GTTCCCTTTCTTGGCTTGAA | ACTGAAAAGCCAGAGCCAAA | 590 |
| Exon 8 | AGGGAAGAAAAATGGGGAGA | TGGCATGACCGATACAGAAA | 585 |
| Exon 9-1 | CACTGGGAGGACCCAAACT | GAGGTTGAAGGGTTTCACGA | 1213 |
| Exon 9-2 | TCACTCGAATCCCTCACTCC | CTGAGTGCTCCAGAGGTGGT | 817 |
| Exon 9-3 | GGTCACTGACACAGAGAAGCA | TCCCCTGACTTCGCATTTAC | 697 |
| Exon 9-4 | TTGGTGCCTCATTTTCTTCA | TCCAAGAGAACCCTTTTGTCTC | 826 |
| Exon 9-5 | AAAGGCACTAGAAAGGTTGTGTC | AGAAATCCTGGGGTGCATCT | 600 |
Genotyping
The four SNPs were genotyped by the ligase detection reaction method among 237 trios. We selected 10% of the samples at random to repeat the experiment. The genotypes were consistent with the previous ones.
Statistical analysis
Hardy-Weinberg equilibrium (HWE) was assessed for all four SNPs among unaffected parents. TDT (transmission disequilibrium test) analysis and Pairwise LD (computed as both D’ and r2) for all SNPs were performed by the Haploview program. Parent-of-origin effect was assessed by PLINK to distinguish the parental preference of transmission.
Results
Exon sequencing of the PBX1 gene identified six variants, including two novel variants (NM_001204961.1:c.997+25T>G and NM_001204961.1:c.*2783G>A) that are not listed in the public database (1000 Genome and ESP et al.), and four SNPs (rs2275558, rs3835581, rs41266618 and rs3185695). NM_001204961.1:c.997+25T>G, located in the intron of PBX1 and NM_001204961.1:c.*2783G>A is in the 3’ UTR of PBX1 gene (Figure 1). This was detected only in two NSCLP cases.
Figure 1.

Sequence results of the two novel variants.
To confirm whether PBX1 gene is associated with NSOC, we selected four SNPs (rs2275558, rs3835581, rs41266618 and rs3185695) based on their minor allele frequency, and validated them among 237 complete trios of NSOC. All SNPs conformed to HWE among the unaffected parents (P>0.05) (Table 3).
Table 3.
P-values of Hardy-Weinberg equilibrium test in NSOC groups
| SNP | Position (Hg19) | NSCL/P | NSCP | Control |
|---|---|---|---|---|
| rs2275558 | 164529120 | 0.36 | 1 | 0.46 |
| rs3835581 | 164790567 | 1 | 0.35 | 0.9 |
| rs41266618 | 164816415 | 1 | 1 | 0.74 |
| rs3185695 | 164816956 | 0.75 | 0.83 | 0.073 |
Note: NSOCs, Non-syndromic oral clefts (NSCL/P&NSCP); SNP, Single Nucleotide Polymorphism; NSCL/P, Non-syndromic cleft lip with or without cleft palate; NSCP, Non-syndromic cleft palate.
Allelic TDT analysis on case-parent trios with heterozygous informative parents showed that allele G at rs2275558 and allele T at rs3835581 were over-transmitted for both of NSCL/P (P=0.039 and 0.038, respectively) and NSOC (P=0.036 and 0.014, respectively) (Table 4).
Table 4.
Allelic TDT Results for SNPs at PBX1 among NSOCs Trios
| SNP | Minor Allele | NSCL/P | NSCP | NSOCs | |||
|---|---|---|---|---|---|---|---|
|
|
|
|
|||||
| T/U | Chisq (P-value) | T/U | Chisq (P-value) | T/U | Chisq (P-value) | ||
| rs2275558 | G | 99/72 | 4.26 (0.039) | 34/29 | 0.4 (0.53) | 133/101 | 4.38 (0.036) |
| rs3835581 | T | 104/77 | 4.03 (0.038) | 42/30 | 1.70 (0.19) | 146/107 | 6.01 (0.014) |
| rs41266618 | T | 6/06 | 0 (1.04) | 2/00 | 2 (0.16) | 8/06 | 0.29 (0.59) |
| rs3185695 | A | 48/45 | 0.097 (0.76) | 18/12 | 1.2 (0.27) | 66/57 | 0.66 (0.42) |
Note: SNP, Single Nucleotide Polymorphism; NSCL/P, Non-syndromic cleft lip with or without cleft palate; NSCP, Non-syndromic cleft palate; NSOCs, Non-syndromic oral clefts (NSCL/P&NSCP); T/U, transmitted/untransmitted; Chisq, Chi-Square; Bold characters indicate the items with p-value less than 0.05.
In view of the parental origin of the alleles, we performed parent-of-origin effect analysis to detect allelic transmission bias among parents. No significant difference was observed for any subgroup of NSOC. Yet, allele G at rs2275558 did show a paternal over-transmission for NSCL/P (P=0.0091) and NSOC (P=0.01) (Table 5). There was no evidence of parental transmission bias in other SNPs.
Table 5.
Parent of origin effect of the SNPs at PBX1 among NSOC trios
| Cleft type | SNP | A1/A2 | Paternal | Maternal | Z | P | ||||
|---|---|---|---|---|---|---|---|---|---|---|
|
|
|
|||||||||
| T/U | CHISQ | P | T/U | CHISQ | P | |||||
| NSCL/P | rs2275558 | G/A | 58.5/33.5 | 6.79 | 0.0091 | 38.5/39.5 | 0.013 | 0.91 | 1.86 | 0.063 |
| rs3835581 | T/C | 51.5/40.5 | 1.32 | 0.25 | 50.5/39.5 | 1.34 | 0.25 | -0.018 | 0.99 | |
| rs41266618 | T/C | 3.5/4.5 | 0.12 | 0.72 | 0.5/3.5 | 2.25 | 0.13 | 1.01 | 0.31 | |
| rs3185695 | A/G | 28/22 | 0.72 | 0.4 | 20/24 | 0.36 | 0.55 | 1.02 | 0.31 | |
| NSCP | rs2275558 | G/A | 15/12 | 0.33 | 0.56 | 19/17 | 0.11 | 0.74 | 0.22 | 0.83 |
| rs3835581 | T/C | 16/16 | 0 | 1 | 24/15 | 2.08 | 0.15 | -0.97 | 0.33 | |
| rs41266618 | T/C | 1/00 | 1 | 0.32 | 1/00 | 1 | 0.32 | NA | NA | |
| rs3185695 | A/G | 9/06 | 0.6 | 0.44 | 9/05 | 1.14 | 0.29 | -0.24 | 0.81 | |
| NSOCs | rs2275558 | G/A | 73.5/45.5 | 6.59 | 0.01 | 57.5/56.5 | 0.009 | 0.93 | 1.74 | 0.082 |
| rs3835581 | T/C | 67.5/56.5 | 0.98 | 0.32 | 74.5/54.5 | 3.10 | 0.08 | -0.53 | 0.60 | |
| rs41266618 | T/C | 4.5/4.5 | 0 | 1 | 1.5/3.5 | 0.8 | 0.37 | 0.72 | 0.47 | |
| rs3185695 | A/G | 37/28 | 1.25 | 0.26 | 29/29 | 0 | 1 | 0.77 | 0.44 | |
Note: SNP, Single Nucleotide Polymorphism; A1, Minor allele; A2, Major allele; NSCL/P, Non-syndromic cleft lip with or without cleft palate; NSCP, Non-syndromic cleft palate; NSOC, Non-syndromic orofacial clefts (NSCL/P&NSCP); T/U, transmitted/untransmitted; CHISQ, Chi-Square; P, p value; Z, vector of the large sample Z statistic; Bold characters indicate the items with p-value less than 0.05.
To check whether the two associated SNPs travel together in the same LD block, we conducted pairwise linkage analysis, and the results showed very weak linkage between rs2275228 and rs3835581 (Figure 2), indicating that they were independent of each other.
Figure 2.

Linkage disequilibrium plots of the four SNPs of the PBX1 gene.
Discussion
NSOC is a complex congenital malformation with strong heterogeneity [27]. Recently, genome wide association study (GWAS), the most effective technique, found more than 50 susceptibility loci for NSOC in distinct populations [28]. Although GWAS has made amazing achievements in the research of NSOC, unfortunately, most of the susceptibility loci found by various GWASs contributed minimally to the risk of the disease, explaining only about 10%-20% of the genetic effects [29]. Therefore, we have reason to believe that the current discoveries are just the tip of the iceberg, and that there are still many potential pathogenic genes not discovered.
The mechanism of NSOC is the failure of disappearance of embryonic epithelium from the frontonasal prominence (fnp) and paired maxillary prominence (mxp), ultimately leading to the obstruction of fusion in prominences. It was found that PBX1 mRNA is extremely rich in epithelium, thus PBX1 mutants may disrupt the normal process of epithelial disappearance by two ways. One is through the interference of PBX epithelial apoptosis, and the second is the destruction of PBX-SNAIL1--dependent Epithelial-Mesenchymal-Transition (EMT) [22,23]. The above evidence strongly suggested that PBX1 indeed is involves in the occurrence of NSOC. However, the results of animal research may not directly apply to humans [30]. Human etiology studies are needed to validate the association between the PBX1 gene and NSOC.
In this study, we first screened for variants in all exons adjacent to intronic regions, the 3’ UTR, and the 5’ UTR of PBX1 gene among 50 NSCLP patients. A total of two novel variants and four SNPs were identified. Subsequently, four SNPs were selected for evaluation by conducting a family-based association study.
Considering the influence of population background difference on genetic analysis, we conducted TDT and parent-of-origin effect analysis based on case-parent trios. We did find that allele G at rs2275558 and allele T at rs3835581 were over-transmitted for NSCL/P (P=0.039 and 0.038, respectively) and NSOC (P=0.036 and 0.014, respectively) (Table 4). Similarly, no significant associations were found between all SNPs and NSCP. Parent-of-origin effects can reflect the influence of alleles from mother or father on phenotype [31]. This study showed that allele G at rs2275558 was significantly paternally over-transmitted among NSCL/P (Table 5). Statistical significance of the paternal transmission rather than of maternal transmission may be attributed to non-expression of the maternally derived alleles, which reflects underlying imprinting [32]. In summary, epigenetic effects such as imprinting are gradually being recognized as a significant source of variations in complex traits [33].
Although rs2275558 and rs3835581 were identified as associated loci for NSCL/P, they were independent with each other with lower D’ and r2 (Figure 2). Compared to other SNPs, the missense variant rs2275558 (p.G21S) located in the coding region of PBX1 which would change the structure of a protein, was previously reported to have an association with type 2 diabetes (T2DM) in a study on the Pima Indian population [34], but it was not associated with T2DM in Caucasians [35,36]. The p.G21 residue is highly conserved among mammals including the mouse, rat, and chimpanzee, which indicates that it may play a important role. Although variation is conservative, the frequencies of alleles fluctuated across different populations. Therefore, multiracial populations need to be recruited to validate the association between rs2275558 and NSOC. Also, in vivo functional research of PBX1 variants should be conducted in animal models in a future study.
In addition to this common variant, two novel heterozygous variants were detected in the PBX1 of two sporadic patients with NSCLP, namely, a one-year-old boy and a three-year-old girl. These variants were absent in multiple online human gene variation databases. Although they were not in the coding region, variants in non-coding sequences have been found to affect the level and form of mRNA transcripts. Several studies have also confirmed that the 3’ UTR of a gene has an important role in gene expression by binding with miRNA [37].
In sum, we confirmed the role of the PBX1 gene in orofacial deformity from Western Han Chinese, which is consistent with a previous animal study. This work provides new evidence for the future study of the etiology of NSCL/P.
Acknowledgements
The authors thank all the participants who donated samples in this study. This project was supported by the National Key R&D Program of China (No. 2016YFC0905200), National Natural Science Foundation of China (81600853) and Key Research, the National Science Funds of China (No. 81600849) and Development Plan of Ningxia Hui Autonomous Region (2016KJHM56).
Disclosure of conflict of interest
None.
References
- 1.Mossey PA, Little J, Munger RG, Dixon MJ, Shaw WC. Cleft lip and palate. Lancet. 2009;374:1773–1785. doi: 10.1016/S0140-6736(09)60695-4. [DOI] [PubMed] [Google Scholar]
- 2.Fan D, Wu S, Liu L, Xia Q, Tian G, Wang W, Ye S, Wang L, Rao J, Yang X, Yu Z, Xin L, Li S, Duan Z, Zhang T, Wu S, Guo X, Liu Z. Prevalence of non-syndromic orofacial clefts: based on 15, 094,978 Chinese perinatal infants. Oncotarget. 2018;9:13981–13990. doi: 10.18632/oncotarget.24238. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Beaty TH, Murray JC, Marazita ML, Munger RG, Ruczinski I, Hetmanski JB, Liang KY, Wu T, Murray T, Fallin MD, Redett RA, Raymond G, Schwender H, Jin SC, Cooper ME, Dunnwald M, Mansilla MA, Leslie E, Bullard S, Lidral AC, Moreno LM, Menezes R, Vieira AR, Petrin A, Wilcox AJ, Lie RT, Jabs EW, Wu-Chou YH, Chen PK, Wang H, Ye X, Huang S, Yeow V, Chong SS, Jee SH, Shi B, Christensen K, Melbye M, Doheny KF, Pugh EW, Ling H, Castilla EE, Czeizel AE, Ma L, Field LL, Brody L, Pangilinan F, Mills JL, Molloy AM, Kirke PN, Scott JM, Arcos-Burgos M, Scott AF. A genome-wide association study of cleft lip with and without cleft palate identifies risk variants near MAFB and ABCA4. Nat Genet. 2010;42:525–9. doi: 10.1038/ng.580. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Birnbaum S, Ludwig KU, Reutter H, Herms S, Steffens M, Rubini M, Baluardo C, Ferrian M, Almeida de Assis N, Alblas MA, Barth S, Freudenberg J, Lauster C, Schmidt G, Scheer M, Braumann B, Bergé SJ, Reich RH, Schiefke F, Hemprich A, Pötzsch S, Steegers-Theunissen RP, Pötzsch B, Moebus S, Horsthemke B, Kramer FJ, Wienker TF, Mossey PA, Propping P, Cichon S, Hoffmann P, Knapp M, Nöthen MM, Mangold E. Key susceptibility locus for non-syndromic cleft lip with or without cleft palate on chromosome 8q24. Nat Genet. 2009;41:473–477. doi: 10.1038/ng.333. [DOI] [PubMed] [Google Scholar]
- 5.Fonseca RF, de Carvalho FM, Poletta FA, Montaner D, Dopazo J, Mereb JC, Moreira MAM, Seuanez HN, Vieira AR, Castilla EE, Orioli IM. Family-based genome-wide association study in Patagonia confirms the association of the DMD locus and cleft lip and palate. Eur J Oral Sci. 2015;123:381–384. doi: 10.1111/eos.12212. [DOI] [PubMed] [Google Scholar]
- 6.Grant SF, Wang K, Zhang H, Glaberson W, Annaiah K, Kim CE, Bradfield JP, Glessner JT, Thomas KA, Garris M, Frackelton EC, Otieno FG, Chiavacci RM, Nah HD, Kirschner RE, Hakonarson H. A genome-wide association study identifies a locus for nonsyndromic cleft lip with or without cleft palate on 8q24. J Pediatr. 2009;155:909–913. doi: 10.1016/j.jpeds.2009.06.020. [DOI] [PubMed] [Google Scholar]
- 7.Leslie EJ, Carlson JC, Shaffer JR, Feingold E, Wehby G, Laurie CA, Jain D, Laurie CC, Doheny KF, McHenry T, Resick J, Sanchez C, Jacobs J, Emanuele B, Vieira AR, Neiswanger K, Lidral AC, Valencia-Ramirez LC, Lopez-Palacio AM, Valencia DR, Arcos-Burgos M, Czeizel AE, Field LL, Padilla CD, Cutiongco-de la Paz EM, Deleyiannis F, Christensen K, Munger RG, Lie RT, Wilcox A, Romitti PA, Castilla EE, Mereb JC, Poletta FA, Orioli IM, Carvalho FM, Hecht JT, Blanton SH, Buxó CJ, Butali A, Mossey PA, Adeyemo WL, James O, Braimah RO, Aregbesola BS, Eshete MA, Abate F, Koruyucu M, Seymen F, Ma L, de Salamanca JE, Weinberg SM, Moreno L, Murray JC, Marazita ML. A multi-ethnic genome-wide association study identifies novel loci for non-syndromic cleft lip with or without cleft palate on 2p24.2, 17q23 and 19q13. Hum Mol Genet. 2016;25:2862–2872. doi: 10.1093/hmg/ddw104. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Mangold E, Ludwig KU, Birnbaum S, Baluardo C, Ferrian M, Herms S, Reutter H, Almeida de Assis N, Chawa TA, Mattheisen M, Steffens M, Barth S, Kluck N, Paul A, Becker J, Lauster C, Schmidt G, Braumann B, Scheer M, Reich RF, Hemprich A, Pötzsch S, Blaumeiser B, Moebus S, Krawczak M, Schreiber S, Meitinger M, Wichmann HE, Steegers-Theunissen RP, Kramer FJ, Cichon S, Propping P, Wienker TF, Knapp M, Rubini M, Mossey PA, Hoffmann P, Nöthen MM. Genome-wide association study identifies two susceptibility loci for non-syndromic cleft lip with or without cleft palate. Nat Genet. 2010;42:24–26. doi: 10.1038/ng.506. [DOI] [PubMed] [Google Scholar]
- 9.Sun Y, Huang Y, Yin A, Pan Y, Wang Y, Wang C, Du Y, Wang M, Lan F, Hu Z, Wang G, Jiang M, Ma J, Zhang X, Ma H, Ma J, Zhang W, Huang Q, Zhou Z, Ma L, Li Y, Jiang H, Xie L, Jiang Y, Shi B, Cheng J, Shen H, Wang L, Yang Y. Genome-wide association study identifies a new susceptibility locus for cleft lip with or without a cleft palate. Nat Common. 2015;6:6414. doi: 10.1038/ncomms7414. [DOI] [PubMed] [Google Scholar]
- 10.Wolf ZT, Brand HA, Shaffer JR, Leslie EJ, Arzi B, Willet CE, Cox TC, Mchenry T, Narayan N, Feingold E, Wang X, Sliskovic S, Karmi N, Safra N, Sanchez C, Deleyiannis FW, Murray JC, Wade CM, Marazita ML, Bannasch DL. Genome-wide association studies in dogs and humans identify ADAMTS20 as a risk variant for cleft lip and palate. PLoS Genet. 2015;11:e1005059. doi: 10.1371/journal.pgen.1005059. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Yu Y, Zuo X, He M, Gao J, Fu Y, Qin C, Meng L, Wang W, Song Y, Cheng Y, Zhou F, Chen G, Zheng X, Wang X, Liang B, Zhu Z, Fu X, Sheng Y, Hao J, Liu Z, Yan H, Mangold E, Ruczinski I, Liu J, Marazita ML, Ludwig KU, Beaty TH, Zhang X, Sun L, Bian Z. Genome-wide analyses of non-syndromic cleft lip with palate identify 14 novel loci and genetic heterogeneity. Nat Commun. 2017;8:14364. doi: 10.1038/ncomms14364. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Beaty TH, Ruczinski I, Murray JC, Marazita ML, Munger RG, Hetmanski JB, Murray T, Redett RJ, Fallin MD, Liang KY, Wu T, Patel PJ, Jin SC, Zhang TX, Schwender H, Wu-Chou YH, Chen PK, Chong SS, Cheah F, Yeow V, Ye X, Wang H, Huang H, Jabs EW, Shi B, Wilcox AJ, Lie RT, Jee SH, Chirstensen K, Doheny KF, Pugh EW, Ling H, Scott AF. Evidence for gene-environment interaction in a genome wide study of nonsyndromic cleft palate. Genet Epidemiol. 2011;35:469–478. doi: 10.1002/gepi.20595. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Leslie EJ, Liu H, Carlson JC, Shaffer JR, Feingold E, Wehby G, Laurie CA, Jain D, Laurie CC, Doheny KF, McHenry T, Resick J, Sanchez C, Jacobs J, Emanuele B, Vieira AR, Neiswanger K, Standley J, Czeizel AE, Deleyiannis F, Christensen K, Munger RG, Lie RT, Wilcox A, Romitti PA, Field LL, Padilla CD, Cutiongco-de la Paz EM, Lidral AC, Valencia-Ramirez LC, Lopez-Palacio AM, Valencia DR, Arcos-Burgos M, Castilla EE, Mereb JC, Poletta FA, Orioli IM, Carvalho FM, Hecht JT, Blanton SH, Buxó CJ, Butali A, Mossey PA, Adeyemo WL, James O, Braimah RO, Aregbesola BS, Eshete MA, Deribew M, Koruyucu M, Seymen F, Ma L, de Salamanca JE, Weinberg SM, Moreno L, Cornell RA, Murray JC, Marazita ML. A genome-wide association study of nonsyndromic cleft palate identifies an etiologic missense variant in GRHL3 . Am J Hum Genet. 2016;98:744–754. doi: 10.1016/j.ajhg.2016.02.014. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Ludwig KU, Mangold E, Herms S, Nowak S, Reutter H, Paul A, Becker J, Herberz R, AlChawa T, Nasser E, Böhmer AC, Mattheisen M, Alblas MA, Barth S, Kluck N, Lauster C, Braumann B, Reich RH, Hemprich A, Pötzsch S, Blaumeiser B, Daratsianos N, Kreusch T, Murray JC, Marazita ML, Ruczinski I, Scott AF, Beaty TH, Kramer FJ, Wienker TF, Steegers-Theunissen RP, Rubini M, Mossey PA, Hoffmann P, Lange C, Cichon S, Propping P, Knapp M, Nöthen MM. Genome-wide meta-analyses of non-syndromic cleft lip with or without cleft palate identify six new risk loci. Nat Genet. 2012;44:968–971. doi: 10.1038/ng.2360. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Leslie EJ, Carlson JC, Shaffer JR, Butali A, Buxó CJ, Castilla EE, Christensen K, Deleyiannis FW, Leigh Field L, Hecht JT, Moreno L, Orioli IM, Padilla C, Vieira AR, Wehby GL, Feingold E, Weinberg SM, Murray JC, Beaty TH, Marazita ML. Genome-wide meta-analyses of nonsyndromic orofacial clefts identify novel associations between FOXE1 and all orofacial clefts, and TP63 and cleft lip with or without cleft palate. Hum Genet. 2017;136:275–286. doi: 10.1007/s00439-016-1754-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Ingraham CR, Kinoshita A, Kondo S, Yang B, Sajan S, Trout KJ, Malik MI, Dunnwald M, Goudy SL, Lovett M, Murray JC, Schutte BC. Abnormal skin, limb and craniofacial morphogenesis in mice deficient for interferon regulatory factor 6 (Irf6) Nat Genet. 2006;38:1335–1340. doi: 10.1083/ng1903. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Yang A, Schweitzer R, Sun D, Kaghad M, Walker N, Bronson RT, Tabin C, Sharpe A, Caput D, Crum C, McKeon F. p63 is essential for regenerative proliferation in limb, craniofacial and epithelial development. Nature. 1999;398:714–718. doi: 10.1038/19539. [DOI] [PubMed] [Google Scholar]
- 18.Moens CB, Selleri L. Hox cofactors in vertebrate development. Dev Biol. 2006;291:193–206. doi: 10.1016/j.ydbio.2005.10.032. [DOI] [PubMed] [Google Scholar]
- 19.Alsadeq A, Schewe DM. Acute lymphoblastic leukemia of the central nervous system: on the role of PBX1 . Haematologica. 2017;102:611–613. doi: 10.3324/haematol.2017.165142. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Blasi F, Bruckmann C, Penkov D, Dardaei L. A tale of TALE, PREP1, PBX1, and MEIS1: interconnections and competition in cancer. Bioessays. 2017;39 doi: 10.1002/bies.201600245. [DOI] [PubMed] [Google Scholar]
- 21.Slavotinek A, Risolino M, Losa M, Cho MT, Monaghan KG, Schneidman-Duhovny D, Parisotto S, Herkert JC, Stegmann APA, Miller K, Shur N, Chui J, Muller E, DeBrosse S, Szot JO, Chapman G, Pachter NS, Winlaw DS, Mendelsohn BA, Dalton J, Sarafoglou K, Karachunski PI, Lewis JM, Pedro H, Dunwoodie SL, Selleri L, Shieh J. De novo, deleterious sequence variants that alter the transcriptional activity of the homeoprotein PBX1 are associated with intellectual disability and pleiotropic developmental defects. Hum Mol Genet. 2017;26:4849–4860. doi: 10.1093/hmg/ddx363. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Ferretti E, Li B, Zewdu R, Wells V, Hebert JM, Karner C, Anderson MJ, Williams T, Dixon MJ, Depew MJ, Selleri L. A conserved Pbx-Wnt-p63-Irf6 regulatory module controls face morphogenesis by promoting epithelial apoptosis. Dev Cell. 2011;21:627–641. doi: 10.1016/j.devcel.2011.08.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Losa M, Risolino M, Li B, Hart J, Quintana L, Grishina I, Yang H, Choi IF, Lewicki P, Khan S, Aho R, Feenstra J, Vincent CT, Brown AMC, Ferretti E, Williams T, Selleri L. Face morphogenesis is promoted by Pbx-dependent EMT via regulation of Snail1 during frontonasal prominence fusion. Development. 2018;145 doi: 10.1242/dev.157628. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Li EB, Truong D, Hallett SA, Mukherjee K, Schutte BC, Liao EC. Rapid functional analysis of computationally complex rare human IRF6 gene variants using a novel zebrafish model. PLoS Genet. 2017;13:e1007009. doi: 10.1371/journal.pgen.1007009. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Li Q, Kim Y, Suktitipat B, Hetmanski JB, Marazita ML, Duggal P, Beaty TH, Bailey-Wilson JE. Gene-gene interaction among WNT genes for oral cleft in trios. Genet Epidemiol. 2015;39:385–394. doi: 10.1002/gepi.21888. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Letra A, Maili L, Mulliken JB, Buchanan E, Blanton SH, Hecht JT. Further evidence suggesting a role for variation in ARHGAP29 variants in nonsyndromic cleft lip/palate. Birth Defects Res Part A Clin Mol Teratol. 2014;100:679–685. doi: 10.1002/bdra.23286. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Grosen D, Chevrier C, Skytthe A, Bille C, Mølsted K, Sivertsen A, Murray JC, Christensen K. A cohort study of recurrence patterns among more than 54,000 relatives of oral cleft cases in Denmark: support for the multifactorial threshold model of inheritance. J Med Genet. 2010;47:162–168. doi: 10.1136/jmg.2009.069385. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Zhang BH, Huang N, Shi JY, Shi B, Jia ZL. Homozygote C/C at rs12543318 was risk factor for non-syndromic cleft lip only from Western Han Chinese population. J Oral Pathol Med. 2018;47:620–626. doi: 10.1111/jop.12719. [DOI] [PubMed] [Google Scholar]
- 29.Manolio TA, Collins FS, Cox NJ, Goldstein DB, Hindorff LA, Hunter DJ, McCarthy MI, Ramos EM, Cardon LR, Chakravarti A, Cho JH, Guttmacher AE, Kong A, Kruglyak L, Mardis E, Rotimi CN, Slatkin M, Valle D, Whittemore AS, Boehnke M, Clark AG, Eichler EE, Gibson G, Haines JL, Mackay TF, McCarroll SA, Visscher PM. Finding the missing heritability of complex diseases. Nature. 2009;461:747–753. doi: 10.1038/nature08494. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Shanks N, Greek R, Greek J. Are animal models predictive for humans? Philos Ethics Humanit Med. 2009;4:2. doi: 10.1186/1747-5341-4-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Lawson HA, Cheverud JM, Wolf JB. Genomic imprinting and parent-of-origin effects on complex traits. Nat Rev Genet. 2013;14:609–617. doi: 10.1038/nrg3543. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Weinberg CR. Methods for detection of parent-of-origin effects in genetic studies of case-parents triads. Am J Hum Genet. 1999;65:229–235. doi: 10.1086/302466. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Hager R, Cheverud JM, Wolf JB. Maternal effects as the cause of parent-of-origin effects that mimic genomic imprinting. Genetics. 2008;178:1755–1762. doi: 10.1534/genetics.107.080697. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Thameem F, Wolford JK, Bogardus C, Prochazka M. Analysis of PBX1 as a candidate gene for type 2 diabetes mellitus in Pima Indians. Biochim Biophys Acta. 2001;1518:215–220. doi: 10.1016/s0167-4781(01)00189-0. [DOI] [PubMed] [Google Scholar]
- 35.Duesing K, Charpentier G, Marre M, Tichet J, Hercberg S, Balkau B, Froguel P, Gibson F. Evaluating the association of common PBX1 variants with type 2 diabetes. BMC Med Genet. 2008;9:14. doi: 10.1186/1471-2350-9-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Wang H, Chu W, Wang X, Zhang Z, Elbein SC. Evaluation of sequence variants in the pre-B cell leukemia transcription factor 1 gene: a positional and functional candidate for type 2 diabetes and impaired insulin secretion. Mol Genet Metab. 2005;86:384–391. doi: 10.1016/j.ymgme.2005.07.008. [DOI] [PubMed] [Google Scholar]
- 37.Bejerano G, Pheasant M, Makunin I, Stephen S, Kent WJ, Mattick JS, Haussler D. Ultraconserved elements in the human genome. Science. 2004;304:1321–1325. doi: 10.1126/science.1098119. [DOI] [PubMed] [Google Scholar]
