Abstract
Haematococcus pluvialis is widely distributed in the world and well known as the richest natural source of astaxanthin that is a strong antioxidant with excellent commercial value. The pathway of astaxanthin biosynthesis in H. pluvialis has been documented as an enzymatic reaction. Several enzymes have been reported, but their isoforms or homologs have not been investigated genome-wide. To better understand the astaxanthin biosynthesis pathway in H. pluvialis, eight candidates of the geranylgeranyl pyrophosphate synthase gene (HpGGPPS) predicted from Iso-seq data were isolated in this study. The length of coding region of these candidates varied from 960 bp to 1272 bp, composing of 7–9 exons. The putative amino acids of all candidates composed the signature domain of GGPPS gene. However, the motifs in the domain region are varied, indicating different bio-functions. Phylogenetic analysis revealed eight candidates can be clustered into three groups. Only two candidates in Group1 encode the synthase participating in the astaxanthin formation. The yield of astaxanthin from these two candidates, 7.1 mg/g (DW) and 6.5 mg/g (DW) respectively, is significant higher than that from CrtE (2.4 mg/g DW), a GGPPS gene from Pantoea ananatis. This study provides a potential productive pathway for astaxanthin synthesis.
Keywords: GGPPS, Haematococcus pluvialis, astaxanthin, Iso-Seq
1. Introduction
Astaxanthin (C40H52O4), a keto-carotenoid, has been well known as super vitamin E due to its hydroxyl and ketone functional groups and multiple conjugated double bonds that can reduce the reactive oxidizing molecule. Thus, astaxanthin can be consumed as a dietary supplement or aging related-cosmetics. Meanwhile, astaxanthin also has been used as an aquaculture consumption due to its additive of the blood-red color, contributing to over $500 million a year in the market [1]. Astaxanthin can be produced chemically in the factory or naturally from organisms such as the microalga Haematococcus pluvialis and the yeast fungus Xanthophyllomyces dendrorhous [2]. Compared with chemically synthetic astaxanthin from the Wittig reaction using asta-C15-triarylphosphonium salt and the C10-dialdehyde [3], the naturally isolated astaxanthin has 20-times higher antioxidant activity and is capable for human consumption [4,5].
As the most important source of natural astaxanthin, it is imperative to understand the biological process and the regulation of astaxanthin formation in H. pluvialis aiming to improve the productivity of astaxanthin. The pathway of astaxanthin production in H. pluvialis is complex but still has been described, which is originally started from pyruvate and glyceraldehyde-3-phosphate (GA-3P) followed by a series of enzymatic reactions [6,7]. Briefly, isopentenyl diphosphate (IPP), the precursor of carotenoids, was synthesized through methyl-d-erythritol 4-phosphate (MEP) pathway using pyruvate, GA-3P, and enzymes of DXS and IspC-IspH [8,9]. Subsequently, IPP and dimethylallyl diphosphate (DMAPP, an isomer of IPP that was formed by isopentenyl pyrophosphate isomerase (IPI) or 4-hydroxy-3-methylbut-2-enyl diphosphate reductase (HDR)), were used to form a C20 compound, geranylgeranyl pyrophosphate (GGPP), with the help of geranylgeranyl pyrophosphate synthase (GGPPS) [10,11,12,13]. Carotenoids were then initialized using GGPP, in the main order of phytoene, ζ-carotene, lycopene, β-carotene, cathaxanthin, and astaxanthin, with cooperation of enzymes of phytoenesysthase (PSY), phytoenedesaturase (PDS), ζ-carotenedesaturase (ZDS), lycopene β-cyclase (LCY-b), β-carotene ketolase (BKT), and β-carotene 3,3′-hydroxylase (CrtR-b) [2,7,13]. Thereby, the GGPPS, a key enzyme defining the initial GGPP availability, is crucial for the subsequent flux of carotenoids biosynthesis, theoretically. It has been reported that the mechanism of the enzymatic reaction converting IPP to GGPP is conserved among organisms from bacteria to human [14,15]. However, the number of GGPPS paralogs were varied within species, as high as 12 in Arabidopsis [16] and as low as one in Chlamydomonas reinhardtii [17]. Specifically, three GGPPS genes were found in H. pluvialis based on a RNA-Seq transcriptome analysis (Genbank accessions: KX236181–KX236183). With the advantage of obtaining the full-length of transcripts to identify isoforms, alternative splicing, fusion transcripts, LncRNA, and new homologous genes, the single-molecule real-time (SMRT) long-read isoform sequencing (Iso-Seq) developed by Pacific BioSciences (PaciBio) is more preferred to discover more paralogs over the RNA-Seq technology [18]. As one of successful examples, more than 113,000 novel splice isoforms were discovered in a Iso-Seq data of Sorghum bicolor L. Moench and some of them are functional which confirmed by additional experiments of gene cloning and RT-PCR [19].
Since the whole genome sequence of H. pluvialis is available [20], it is possible to discover more reliable novel GGPPS genes from the Iso-Seq data. The main objectives of this study were to explore more GGPPS paralogs in H. pluvialis using an Iso-Seq data, to determine their evolutionary relationship, and to characterize their performance on astaxanthin biosynthesis. By comparing the productivity of astaxanthin using different GGPPS genes from H. pluvialis, it is expected to arrange a more efficient pathway for astaxanthin biosynthesis.
2. Results
2.1. Cloning and Sequence Characterization of HpGGPPS Genes
Using three reported GGPPS genes of H. pluvialis retrieved from Genbank (accession nos. KX236181, KX236182, and KX236183), eight candidates were carried out from the Iso-Seq data by BlastN analysis with e-value of 0. Using designated gene-specific primers, the full-length coding sequences (CDS) of eight putative HpGGPPS genes (HpGGPPS1-1, HpGGPPS1-2, HpGGPPS2-1, HpGGPPS2-1, HpGGPPS3-1, HpGGPPS3-2, HpGGPPS3-3, and HpGGPPS3-4) were successfully isolated. Sequences were submitted to Genbank with accession numbers MN689792–MN689799.
The nucleotide sequence analysis revealed that eight putative HpGGPPS genes are ranging 1011–1455 bp in length and varied from 960 bp to 1272 bp in CDS region (Supplemental Table S1). Their deduced amino acids are ranging 319–423 aa with putative molecular weight of 36.27–45.75 KDa, respectively (Supplemental Table S1). The alignment of nucleotide sequences of eight HpGGPPS genes suggested 39.9–100% similarity in the CDS region (Supplemental Figure S1). Clearly, three classes were presented according to the similarity. High nucleotide sequence similarity was found within classes, including 98.6% identity between HpGGPPS1-1 and HpGGPPS1-2, 97.4% identity between HpGGPPS2-1 and HpGGPPS2-2, and 99.1–100% identity among HpGGPPS3-1, HpGGPPS3-2, HpGGPPS3-3, and HpGGPPS3-4. It is noted that In-Del variation was found between sequences of HpGGPPS3-1 and HpGGPPS3-2 (sharing 100% similarity with each other), and between sequences of HpGGPPS3-3 and HpGGPPS3-4 (sharing 100% similarity with each other). By contrast, low percentage of nucleotides identity was found among classes, which was lower than 49%.
By the local BlastN against H. pluvialis genome sequences, HpGGPPS1-1, HpGGPPS1-2, HpGGPPS2-1, and HpGGPPS2-2 hit different scaffolds, revealing different genome region. Differently, HpGGPPS3-1 and HpGGPPS3-2 hit the same scaffold, as well as HpGGPPS3-3 and HpGGPPS3-4. By considering their 100% sequence identity, they might be isoforms from alternative splicing. Further sequences alignment of HpGGPPS genes with corresponding genome scaffolds confirmed that HpGGPP3-1 and HpGGPP3-2 were isoforms from modified splicing of intron, while HpGGPPS3-3 and HpGGPPS3-4 were isoforms from exon exclusion (Figure 1). Gene structure analysis suggested that HpGGPPS1-1 and HpGGPPS1-2 were composed from nine exons, as well as HpGGPPS3-1, and HpGGPPS3-2. Diversely, HpGGPPS2-1 and HpGGPPS2-2 were from seven and eight exons, respectively (Figure 1). Due to the missing nucleotide information in the scaffold, the gene structure of HpGGPPS3-3 and HpGGPPS3-4 is not complete.
Figure 1.
Schematic diagram of HpGGPPS gene structure, which was predicted by aligning with corresponding genome sequences. The slash indicates incomplete genome sequences resulting partial gene structure.
2.2. Molecular Evolution of HpGGPPS Genes
To predict the function of isolated HpGGPPS candidates, the domain of their putative amino acids was analyzed. According to SMART online prediction, the deduced amino acids of seven out of eight candidates contained the full domain of Polyprenyl_syn (Pfam accession: PF00348), which is associated with isoprenoid compounds synthesis. The excluded candidate, HpGGPPS3-4, has incomplete Polyprenyl_syn domain, because of the missing exon in comparison with HpGGPPS3-3. By aligning the deduced amino acids of eight HpGGPPS candidates from this study and four from Genbank (KX236181, KX236182, and KX236183 from H. pluvialis; XM001703117 from Chlamydomonas reinhardtii), motifs analysis was performed and results revealed that all 12 genes contained the signature asparate rich motifs, SARM (DDxxxD, which x refers to any amino acids) and FARM (DDxxxxD, which x refers to any amino acids), commonly found in GGPPS gene (Figure 2). Unlike the SARM domain conserved among aligned genes, the variation was found in the FARM motifs. In detailed, HpGGPPS1-1, HpGGPPS2-1, KX236181, and XM_001703117 have the traditional motifs of DDxxxxD, while rest genes have a modified motifs of DDxx--D. Moreover, HpGGPPS1-1, HpGGPPS2-1, KX236181, and XM_001703117 have the additional CxxxC motifs, indicating they might have different bio-functions from the rest of genes. Besides, GGPPS genes from H. pluvialis (HpGGPPS1-1, HpGGPPS2-1, and KX236181) have the modified TxxxC motifs, comparing with the GGPPS gene from C. reinhardtii.
Figure 2.
Alignment of Polyprenyl_syn domain region in the deduced amino acids of GGPPS genes. The motifs for CxxxC, FARM, and SARM are red squared. The sequence of XM_001713117 is from Chlamydomonas reinhardtii, while the rest of 11 sequences are from Haematococcus pluvialis.
To further evaluate the evolutionary pattern of HpGGPPS genes, a phylogenetic tree was constructed using GGPPS genes obtained in this study and retrieved from Genbank which originally from other species including Planta, Bacteria, Archaea, and Fungi (Figure 3). Eight HpGGPPS genes were clustered into three distinguish groups, paralleled with the three classes identified according to sequence similarity. The Group1 genes, composing of HpGGPPS1-1 and HpGGPPS1-2, were clustered with GGPPS genes from Plantae and were more close to Euglena gracillis and Thermosynehococcus elongatus belonging to photosynthetic unicellular species, compared with other high plant species. The Group2 genes, composing of HpGGPPS2-1 and HpGGPPS2-2, were in a distinct cluster apart from the cluster containing HpGGPPS3-1, HpGGPPS3-2, HpGGPPS3-3, and HpGGPPS3-4 (Group3). It is interesting that six putative HpGGPPS genes from Group2 and Group3 were more likely clustered with GGPPS genes from Bacteria, which implied that their function might different from HpGGPPS1-1 and HpGGPPS1-2 that are close to Planta evolutionarily.
Figure 3.
Phylogenetic relationships of the deduced amino acid sequences of GGPPS genes obtained in this study and retried from Genbank. Numbers in parentheses are accession numbers of GGPPS genes. The phylogenetic tree was constructed by MEGA version 7.0 using neighbor-joining method. Bootstrap values from the percentages of 1000 replications are indicated beside each node.
2.3. Functional Identification of HpGGPPS Genes in Escherichia coli
The function of isolated HpGGPPS genes was analyzed by hetero-expression studies in E. coli targeting the astaxanthin formation. The transformed E. coli cells with pFZ153ΔE/CrtE, a plasmid containing astaxanthin biosynthetic gene cluster originally from Bacteria as the positive control, displayed orange-red color in the cell pellet as a result of pigmentation of astaxanthin (Figure 4). Served as the negative control, E. coli cells harboring pFZ153ΔE (NCK), a plasmid without GGPPS gene but with all rest genes (CrtI, CrtB, IPI, CrtY, CrtZ, CrtW) for astaxanthin production, displayed slight yellow color in the cell pellet. Similar as the positive control, the E. coli transformants harboring pFZ153ΔE/GGPPS1-1 (1-1) and pFZ153ΔE/GGPPS1-2 (1-2) also displayed orange-red color, but relatively darker, which might be explained by more pigmentation. By contrast, the pigmentation was not observed in E. coli pellets harboring pFZ153ΔE/GGPPS2-1 (2-1), pFZ153ΔE/GGPPS2-2 (2-2), pFZ153ΔE/GGPPS3-1 (3-1), pFZ153ΔE/GGPPS3-2 (3-2), pFZ153ΔE/GGPPS3-3 (3-3), or pFZ153ΔE/GGPPS3-4 (3-4) (Figure 4), indicating that they might not encode proteins associated with pigment production. Therefore, only proteins encoded by HpGGPPS1-1 and HpGGPPS1-2 have GGPP synthase activity to participate pigment formation.
Figure 4.
Hetero-expression experiments of pFZ153ΔE/GGPPS in E. coli targeting astaxanthin synthesis. E. coli strain BL21 (DE3) was used as the host. CrtE refers to the GGPPS gene from Pantoea ananatis, served as the positive control producing astaxanthin; 1-1, 1-2, 2-1, 2-2, 3-1, 3-2, 3-3, and 3-4 refers to corresponding HpGGPPS genes isolated in this study; NCK refers to the negative control, which is the BL21 (DE3) containing pFZ153ΔE without GGPPS gene for production of no astaxanthin. Colors of E. coli pellet are representative of at least five transformants with similar results.
To further confirm and quantify the astaxanthin production in E. coli cells, a HPLC analysis was successfully conducted. The chromatographic profile of astaxanthin was generated using commercial standards (Supplemental Figure S2a). As expected, an absorption peak of astaxanthin was detected in the positive control and but not detected in the negative control. Similarly, the pigment in E. coli cells harboring pFZ153ΔE/GGPPS1-1 and pFZ153ΔE/GGPPS1-2 have a peak at the same retention time as astaxanthin standard, indicating the existence of astaxanthin (Supplemental Figure S2b). Consisting with the color evaluation in cell pellets, astaxanthin was not detected in E. coli cells harboring pFZ153ΔE/GGPPS2-1, pFZ153ΔE/GGPPS2-2, pFZ153ΔE/GGPPS3-1, pFZ153ΔE/GGPPS3-2, pFZ153ΔE/GGPPS3-3, and pFZ153ΔE/GGPPS3-4. Besides, no other absorption peaks were observed in their chromatographic profile. Meanwhile, the quantity of astaxanthin was measured using a standard curve constructed from a set of astaxanthin standards. Results showed that E. coli cells harboring pFZ153ΔE/GGPPS1-1 produced as high as 7.1 mg astaxanthin per gram of dried cells in average from three independent pigment extraction, which is slight more (but not significant at the level of 0.05) than E. coli cells harboring pFZ153ΔE/GGPPS1-2 (6.5 mg/g DW in average). Notably, the positive control has significant less yield of astaxanthin (2.4 mg/g DW in average), compared with E. coli cells with HpGGPPS genes (Figure 5).
Figure 5.
Astaxanthin content in E. coli (BL21 DE3) transformants with plasmids harboring astaxanthin synthetic gene cluster, according to HPLC analysis. Specifically, HpGGPPS1-1-opt and HpGGPPS1-2-opt refers to the bacteria codon optimized HpGGPPS1-1 and HpGGPPS1-2 gene, respectively. Data were the mean from at least three replicates and the standard error was presented as the bar. *** indicates the significant differences at the level of 0.001. NS indicates no significant differences at the level of 0.05.
3. Discussion
Astaxanthin is one of the strongest antioxidants and its natural format is being demanded by increasing market looking for natural products [1]. Thereby, the topic of improving astaxanthin production from natural sources is attractive for the industry. Lots of effort has been made by scientists trying to design an efficient protocol for astaxanthin production using natural source [7]. As a major natural source of astaxanthin, Haematococcus pluvialis accumulated as high as 5% dry weight of astaxanthin [21] and its dairy supplements can be used human-friendly [22]. It was found that two specific enzymes, β-carotene hydroxylase (CrtR-b) and ketolase (BKT), are crucial for astaxanthin formation [23,24,25,26] and many researches were focused on aiming to improve astaxanthin content [27,28,29]. However, as the important precursor to initial the carotenoids synthesis in H. pluvialis, limited research was conducted for the regulation of geranylgeranyl pyrophosphate (GGPP) on astaxanthin production. It was recorded that GGPP synthase (GGPPS) plays an important role on GGPP formation [6]. In Arabidopsis, a well-studied species, 12 GGPPS genes were found and 10 of them have the ability to produce GGPP [30]. Research suggested that GGPP formation was regulated with different pattern in Arabidopsis [30].
Previously, there are three GGPPS genes from H. pluvialis in Genbank and one (Genbank accession no. KX236181) have the activity to catalyze GGPP formation [31]. Unfortunately, no further information was reported regarding the other two GGPPS genes (Genbank accession nos. KX236182, KX236183). With the expectation of discovering more paralogs having enzymatic activity, this study screened an Iso-Seq data covering transcripts from the control and stressed H. pluvialis cells. The stress condition was high light and salt which was normally used to induce the astaxanthin formation [20]. Eight candidates were found and their gene structures were illustrated in this study (Figure 1), using the available genome sequences (BIG Data Center GSA Database accession no. PRJCA000614) [20]. Generally, two conserved aspartate rich motifs, FARM and SARM, and flexible CxxxC motifs are presented in the domain of amino acids of GGPPS genes [16,31,32]. Based on the domain analysis, FARM and SARM motifs were presented in all eight HpGGPPS genes while CxxxC motifs was only found in HpGGPPS1-1, HpGGPPS1-2, KX236181, and XM_001703117 (Figure 2). It has been documented that FARM, SARM and CxxxC motifs are important for GGPP biosynthesis by affecting the IPP and DMAPP substrate binding process and by affecting the physical interaction between subunits of heteroimeric GPP, respectively [31,32]. Proteins with features of conserved FARM, SARM, and CxxxC motifs displayed the function of catalyzing GGPP formation [33], indicating similar function might be employed by HpGGPPS1-1 and HpGGPPS1-2. Differently, the CxxxC motifs was not found in other six HpGGPPS genes (Figure 2). Such proteins with conserved FARM and SARM motifs but without CxxxC motifs was shown to be involved in the production of medium (C25) to long (C45) chain isoprenoids [34]. It is noted that six HpGGPPS genes isolated in this study (HpGGPPS2-1, HpGGPPS2-2, HpGGPPS3-1, HpGGPPS3-2, HpGGPPS3-3, and HpGGPPS3-4) and two previously reported GGPPS genes (KX236182 and KX236183) have modified FARM motifs (DDxx--D instead of DDxxxxD). The effect of this type of modification on their bio-function has not been reported. The feature of modified FARM motifs, conserved SARM motifs, and lacking CxxxC motifs was also observed in GGPPS genes from other species, such as Linus usitatissimum, Ricinus communis, Physcomitrella patens, Zea mays, and Vitis vinifera [16].
According to the nucleotide sequence similarity and phylogenetic tree analysis constructed from putative amino acids, eight candidates can be grouped into three classes with more than one member in each class (Figure 3). To directly evaluate their function on astaxanthin biosynthesis, hetero-expression in E. coli was performed using candidate genes together with other genes that are essential for astaxanthin biosynthesis. It is not surprised that two candidates, HpGGPPS1-1 and HpGGPPS1-2 that closely related to GGPPS1 (Genbank accession no. KX236181), could promote the formation of astaxanthin in E. coli (Figure 4). Sequence similarity analysis showed that HpGGPPS1-1 and HpGGPPS1-2 shared 99% identity in nucleotides of coding region and only one amino acid differences. By contrast, big variation (90% identity) was found in the 5’UTR region of HpGGPPS1-1 and HpGGPPS1-2, indicating there are two functional HpGGPPS in H. pluvialis rather than one as previously reported [35]. No astaxanthin or other visible pigments were observed in E. coli carrying the rest of six HpGGPPS candidates, indicating they might not directly associate with astaxanthin production. Similar findings were also found in other species, such as Arabidposis having AtGGPPS5 and AtGGPPS12 gene with GGPPS domain features but without the function of converting IPP and DMAPP to GGPP [30,36]. Additional in vitro studies could be conducted to investigate the potential function of these non-astaxanthin-related HpGGPPS genes.
Furthermore, the yield of astaxanthin in E. coli carrying HpGGPPS1-1 and HpGGPPS1-2 genes is about 271–296% increased than that carrying CrtE gene (the GGPPS gene driven from Pantoea ananatis as the positive control). In general, codon optimization is considered as an essential step to produce heterologous protein in E. coli to overcome the impairment of gene expression from the codon bias [37,38]. Followed by this conventional strategy, we expected more GGPPS proteins in E. coli transformants with codon-optimized genes, thereby leading to more astaxanthin production, theoretically. Nevertheless, E. coli with codon optimized HpGGPPS1-1 and HpGGPPS1-2 produced significant lower amount of astaxanthin (Figure 5), comparing with non-codon optimized corresponding genes, but produced similar amount of astaxanthin as CrtE (Figure 5). A possible explanation would be that excessive GGPPS might inhibit the astaxanthin biosynthesis in E. coli. This hypothesis is partly supported by the evidence that no change or downregulation of GGPPS was found in the salicylic acid and jasmonic acid stressed transcriptome analysis in H. pluvialis during astaxanthin formation [39]. Further research can be conducted to test the suppressive role of GGPPS during astaxanthin biosynthesis.
In conclusion, this study found two HpGGPPS gene having the synthase activity to participate in the astaxanthin biosynthesis. Non-codon optimized H. pluvialis-driven GGPPS genes produced significant higher amount of astaxanthin in E. coli, compared with bacteria-driven GGPPS gene. This study improves the understanding of the role of GGPPS in astaxanthin biosynthesis and thereby contributes to the design of efficient pathway for astaxanthin production.
4. Materials and Methods
4.1. Microalga Culture, Treatment, and Sample Collection
The microalga Haematococcus pluvialis strain 192.80, originally purchased from EPSAG (Experimental Phycology and Culture Collection of Algae, Goettingen University, Goettingen, Germany), was used in this study. The alga cells were grown in a 250 mL flask containing 100 mL ESP Ag medium [40] at 22 °C under continuous illumination of 25 μmol photon m−2s−1 in an incubator.
For the stress treatment to induce astaxanthin production, a final concentration of 45 mM sodium acetate was added into cultures when alga cells reached to the logarithmic phase (OD730 = 0.8), along with the exposure of continuous high light (irradiance at 500 μmol photon m−2s−1). To maximize the transcripts in the following SMRT sequencing, alga samples were harvested from the control (0 h) and at the time points of 1.5 h, 3 h, 6 h, 9 h, 12 h, 24 h, and 48 h after treatment. Alga cells were collected by centrifugation at 10,000× g for 5 min and frozen immediately by liquid nitrogen. Samples were stored at −80 °C until use.
4.2. Discovery, Isolation, and Sequencing of HpGGPPS Genes
Equal amounts of algae cells collected from different time points of stress treatment were pooled together for the total RNA extraction and sent to Gene Denovo Biotechnology Co. (Guangzhou, China) for SMRT sequencing to get the Iso-Seq data. To obtain GGPPS paralogs in H. pluvialis, a local BlastN against the Iso-Seq data was performed, using three reported GGPPS genes of H. pluvialis deposited in NCBI (Genbank accession no. KX236181, KX236182, and KX236183). To clone HpGGPPS candidates, PCR was performed using gene specific primers (Table 1) designed using the target nucleotide sequences from Iso-Seq data. The cDNA template for PCR was from the total RNA that was used for SMRT sequencing. The PCR reaction was carried out in a 20 µL volume containing 1 µL cDNA, 4.0 µL 5× SuperFi buffer, 4.0 µL 5× SuperFi GC Enhancer, 1.6 µL dNTP mix (2.5 mM), 1.0 µL each forward and reverse primer (10 µM), 0.2 µL SuperFi DNA polymerase (Invitrogen Life technologies, Carlsbad, CA, USA), and 7.2 µL ddH2O. The PCR was implemented on the Bio-Rad T100 thermal cycler (Bio-Rad, Hercules, CA, USA) under following conditions: 98 °C for 2 min; 35 cycles of 98 °C for 10 s, 60 °C for 10 s, 72 °C for 1.5 min; and a final extension at 72 °C for 5 min. PCR products were run on 1.0% agarose gel and target fragments were purified by E.Z.N.A. Gel Extraction Kit (Omega Bio-tek Inc. Norcross, GA, USA) according to the manufacturer’s instruction. Purified PCR fragments were treated by A-Tailing Kit (Takara, Japan), ligated into pGEM-T easy vector (Promega, Madison, WI, USA), and transformed into E. coli Top10 chemically competent cell, as described in manufacturer’s instructions. Positive colonies were selected by the blue-white screening strategy on the LB agar plate containing ampicillin (50 μg/mL) and sent to Guangzhou IGE Biotechnology Ltd. (Guangzhou, China) for sequencing.
Table 1.
Primers used in this study.
| Primer ID | Sequences (5’–3’) | Used for |
|---|---|---|
| GGPP1F1 | CACTGCCTATCCCCGTTTCCAATC | Cloning of HpGGPPS1-1 and HpGGPPS1-2 |
| GGPP1R1 | GCACCTGCTGACCCGCTCTG | |
| GGPP2F1 | GGCGACGCGGGCAAATCAGT | Cloning of HpGGPPS2-1 and HpGGPPS2-2 |
| GGPP2R1 | AAGCGCCAGGGAATACCAAACATA | |
| GGPP3F1 | GCTCTCTTCGCACTTCTTGG | Cloning of HpGGPPS3-1, HpGGPPS3-2, HpGGPPS3-3 and HpGGPPS3-4 |
| GGPP3R1 | TGATGCCTAGACAGCTCACTT | |
| fGGPP1F2 | GTATCTGAATTCAAAAAATGATCCGAGCGATGCACA † | Subcloning of HpGGPPS1-1 |
| GGPP1R2 | CATAGAAAGCTTTCAGTTCTTGCGGTATCCTA | |
| GGPP1F3 | GTATCTGAATTCAAAAAATGATCCGAGCGATGCACA | Subcloning of HpGGPPS1-2 |
| GGPP1R3 | CATAGAAAGCTTTCAGTTCTTGCGGTACCCT | |
| GGPP2F2 | GTATCTGAATTCAAAAAATGAGGGGCCTAGCGGGCAA | Subcloning of HpGGPPS2-1 and HpGGPPS2-2 |
| GGPP2R2 | CATAGAGCGGCCGCCTATTTCTTTCTGCTCAGGACTC | |
| GGPP3F2 | GTATCTGAATTCAAAAAATGGTATCGGATGTGATGCAAG | Subcloning of HpGGPPS3-1 |
| GGPP3R2 | CATAGAAAGCTTTCACTTGCAGCGCTTGTAAATC | |
| GGPP3F3 | GTATCTGAATTCAAAAAATGGTATCGGATGTGATGCAAG | Subcloning of HpGGPPS3-2, HpGGPPS3-3, and HpGGPPS3-4 |
| GGPP3R3 | CATAGAAAGCTTTCACTTGCAGCGCTTGTAAATC | |
| CrtIB-F2 | GTATCTTCTAGAGTAAGGATCCTAACATGAAACCGACCACGGTGA | Subcloning of CrtIB |
| CrtIB-R2 | CATAGAGAATTCATGTCGACAAGTTACAGCGGACGTTGCCAC | |
| CrtE-F1 | GTATCTGAATTCATACCATGACCGTGTGTGCGAA | Subcloning of CrtE |
| CrtE-R1 | ATAGAAAGCTTTCCTTTACGACACCGCTGCCA |
† Restriction enzyme sites are formatted in italics.
4.3. Sequences Analysis and Molecular Evolution of HpGGPPS Genes
The ORFs of obtained nucleotide sequences of HpGGPPS genes and corresponding deduced amino acids were predicted by EditSeq module of DNASTAR software (Lasergene, Madison, WI, USA). Multiple sequence alignment was conducted by MegAlign module of DNASTAR software to determine the sequence identity and divergence. By aligned with genome sequences of H. pluvialis (BIG Data Center GSA Database accession no. PRJCA000614) [20], the gene structure was predicted and the schematic diagram was displayed by Gene Structure Display Server 2.0 (http://gsds.cbi.pku.edu.cn/). The domain of deduced amino acid was predicted by SMART online at http://smart.embl-heidelberg.de/. Phylogenetic relationship was analyzed by MEGA7 software with the neighbor-joining method from 1000 bootstrap replicates [41].
4.4. Plasmids Construction and Heterologous Expression
The plasmid used for heterologous expression targeting gene functional analysis was adopted from pFZ153, a plasmid has astaxanthin synthetic gene cluster (CrtE, CrtI, CrtB, idi, CrtY, CrtZ, and CrtW) and produces astaxanthin in E. coli [42]. To investigate the function of HpGGPPS genes on astaxanthin synthesis, the pFZ153ΔE plasmid was constructed (Figure 6b). Firstly, CrtE, CrtI, and CrtB genes were removed from pFZ153 (Figure 6a) by XbaI/EcoRI digestion. Secondly, the coding sequence of CrtI/CrtB gene was amplified from pFZ153 plasmid using primers CrtIB-F2/CrtIB-R2 containing XbaI and EcoRI restriction sites, respectively. Finally, the gel-purified fragment of CrtI/CrtB gene was digested with XbaI/EcoRI restriction enzyme and then ligated with the pFZ153 fragment without CrtE, CrtI, and CrtB genes to form the new plasmid pFZ153ΔE.
Figure 6.
Structure of plasmid pFZ153 and pFZ153ΔE used to confer the function of HpGGPPS genes on astaxanthin biosynthesis in E. coli (BL21 DE3). The plasmid pFZ153 (a) was modified to construct the plasmid pFZ153ΔE (b) by removing the CrtE gene. In this study, HpGGPPS genes were inserted into the plasmid on EcoRI/HindIII or EcoRI/NotI site to complete the astaxanthin synthetic gene cluster. The CrtE gene from pFZ153 was served as the positive control.
To complete the astaxanthin synthetic gene cluster, HpGGPPS genes were inserted into pFZ153ΔE to form plasmids pFZ153ΔE/GGPPS. In detail, the coding sequences of HpGGPPS genes were amplified from the sequenced plasmids containing HpGGPPS genes, using primers listed in Table 1 containing either EcoRI/HindIII or EcoRI/NotI restriction sites. Similar as described above, the target PCR fragments were gel-purified and ligated into pFZ153ΔE plasmid in either EcoRI/HindIII or EcoRI/NotI sites. Additionally, the coding sequence of CrtE gene amplified from pFZ153 with primers CrtE-F1/CrtE-R1 harboring EcoRI/HindIII sites, was also ligated into pFZ153ΔE plasmid to construct the positive control (pFZ153ΔE/CrtE).
The procedures of PCR amplification using Platium SuperFi DNA polymerase and gel-purification using E.Z.N.A. Gel Extraction Kit are the same as described above. The ligation process was performed by T4 ligase (Promega, Madison, WI, USA), as described by the manual. E. coli Top10 was used as a host during plasmids construction, as described above. Restriction enzymes used in this study were purchased from Thermo Fisher Scientific Inc. (Waltham, MA, USA).
For the functional analysis of HpGGPPS genes, plasmids of pFZ153ΔE/GGPPS and pFZ153ΔE/CrtE were transferred into an expression host, E. coli strain BL21 (DE3). The transformed E. coli colonies were selected on the LB agar plate with ampicillin (100 µg/mL) and then cultured in 15 mL culture tubes containing 3 mL LB liquid media supplemented with 100 µg/mL ampicillin (LB+Amp100 medium) overnight. The aliquot of 0.5 mL was added into a 250 mL flask containing 100 mL LB+Amp100 medium. The flasks were incubated at 30 °C under dark with shaking (200 rpm) until OD600 reached 0.7–0.9, followed by adding IPTG to a final concentration of 0.1 mM. Three hours later, 50 mL of each culture was harvested and pigments were extracted as described below. For each plasmid, at least three independent E. coli colonies were selected for pigment extraction as replicates.
4.5. Pigment Extraction from E. coli and HPLC Analysis
The E. coli BL21 (DE3) cells expressing plasmids constructed in the study were harvested by centrifugation at 12,000× g for 5 min at 4 °C. The pellet was washed by ddH2O twice and dried using a freeze-dryer. Consequently, the pellet was crashed into powder, weighted, and resuspended in 1 mL acetone for pigment extraction. The suspension was then incubated at a water bath at 55 °C for 15 min with vigorous shaking every 5 min. The supernatant containing pigments was collected by centrifugation at 12,000× g for 10 min at 4 °C. The pigment was subsequently dried using a vacuum evaporator and dissolved in 0.5 mL solution A (methanol/isopropanol, 8:2, V:V) for the following HPLC analysis.
The HPLC assay was performed on a Series 1260 system (Agilent Technologies, Santa Clara, CA, USA). Pigments were separated at a flow rate of 0.6 mL/min on a Phenomenex Gemini-NX C18 column (5 μ, 150 × 3.0 mm, Phenomenex Inc., Aschaffenburg, Germany) using solution A and solution B (ddH2O). The gradient elution was 85% A, 15% B at 0 min, followed by linear gradient to 100% A at 10 min, maintained at 100% A to 12 min, returned to initial condition by 12.1 min, and re-equilibrated at initial condition by 18 min. The injection volume was 5 µL. Column temperature was maintained at 35 °C. The standard astaxanthin (Aladdin Chemistry Co. Ltd., Shanghai, China) was used to identify the target in the pigment. The detection was carried out by UV absorbance at 475 nm. To determine the concentration of astaxanthin in the testing sample, a calibration curve was constructed using a serial of plots with 500, 200, 100, 50, 20, and 10 µg/mL standard astaxanthin. The linearity between concentrations of astaxanthin and their corresponding peak areas was figured out to calculate the concentration of each analyte. The final astaxanthin productivity of each constructed plasmid was calculated by the formula, astaxanthin productivity = cal-con. × 0.5 mL/DW, where cal-con. refers to the calculated astaxanthin concentration in the analyte from the calibration curve, 0.5 mL comes from the final volume for each pigment extraction, DW comes from the amount of dried cells used for a pigment extraction. All organic solvents (acetone, methanol, and isopropanol) used in this study are HPLC grade.
4.6. Statistical Analysis
The data were processed by Pearson t-test to compare two means with replicates. The statistical significance was determined according to the p < 0.05.
Acknowledgments
We thank Jiang Xia from The Chinese University of Hongkong for kindly providing the pFZ153 plasmid producing astaxanthin and Shuiming Li from Shenzhen University for technique advice on HPLC analysis.
Supplementary Materials
The following are available online at https://www.mdpi.com/1660-3397/17/12/696/s1, Table S1: Sequence characterization of HpGGPPS genes. Figure S1. Sequence similarity and divergence of eight HpGGPPS genes in the coding region. The alignment was performed by Clustal W using MegAlign module in the DNASTAR software. Figure S2. The HPLC chromatograms of pigments extracted from transformed E. coli cells. (a) the profile of standard astaxanthin purchased from Aladdin Chemistry Co. Ltd (Shanghai, China); (b) an representative profile of the extracted pigment from E. coli harboring HpGGPP genes and CrtE gene.
Author Contributions
D.H. and C.W. conceived and designed the experiments; D.H., W.L., and A.L. performed the experiments; D.H. analyzed the data; D.H. and C.W. wrote the paper; Z.H. reviewed the paper. All authors discussed the results and commented on the manuscript.
Funding
This research was funded by National key research and development plan special project for synthetic biology (2018YFA0902500), National Natural Science Foundation of China (31470389), Postdoctoral Science Foundation of China (2019M653013), and Guangdong Natural Science Foundation (2019A1515011701).
Conflicts of Interest
The authors declare no conflict of interest. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript, or in the decision to publish the results.
References
- 1.Grand View Research Astaxanthin Market Analysis by Source (Natural [Yeast, Krill/Shrimp, Microalgae] And Synthetic), by Product (Dried Biomass/Powder, Oil, Soft gels, Liquid), by Application, and Segment Forecasts, 2018–2025. [(accessed on 20 October 2017)]; Available online: https://www.grandviewresearch.com/industry-analysis/global-astaxanthin-market.
- 2.Higuera-ciapara I., Felix-valenzuela L., Goycoolea F.M. Astaxanthin: A review of its chemistry and applications. Crit. Rev. Food Sci. Nutr. 2006;46:185–196. doi: 10.1080/10408690590957188. [DOI] [PubMed] [Google Scholar]
- 3.Krause W., Henrich K., Paust J., Ernst H. Preparation of Astaxanthin. [(accessed on 5 August 1997)]; Available online: https://www.google.com/patents/US5654488.
- 4.Koller M., Muhr A., Braunegg G. Microalgae as versatile cellular factories for valued products. Algal Res. 2014;6:52–63. doi: 10.1016/j.algal.2014.09.002. [DOI] [Google Scholar]
- 5.Lorenz R.T., Cysewski G.R. Commercial potential for Haematococcus microalgae as a natural source of astaxanthin. Trends Biotechnol. 2000;18:160–167. doi: 10.1016/S0167-7799(00)01433-5. [DOI] [PubMed] [Google Scholar]
- 6.McGarvey D.J., Croteau R. Terpenoid metabolism. Plant Cell. 1995;7:1015–1026. doi: 10.1105/tpc.7.7.1015. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Shah M.M.R., Yuanmei L., Cheng J.J., Maurycy D. Astaxanthin-producing green microalga Haematococcus pluvialis: From single cell to high value commercial products. Front. Plant Sci. 2016;7:531. doi: 10.3389/fpls.2016.00531. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Rohmer M., Knani M., Simonin P., Sutter B., Sahm H. Isoprenoid biosynthesis in bacteria: A novel pathway for the early steps leading to isopentenyl diphosphate. Biochem. J. 1993;295:517–524. doi: 10.1042/bj2950517. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Liang C., Zhang W., Zhang X., Fan X., Xu D., Ye N., Yang Q. Isolation and expression analyses of methyl-d-erythritol 4-phosphate (MEP) pathway genes from Haematococcus pluvialis. J. Appl. Phycol. 2015;28:1–10. doi: 10.1007/s10811-015-0604-7. [DOI] [Google Scholar]
- 10.Sun Z., Cunningham F.X., Jr., Gantt E. Differential expression of two isopentenyl pyrophosphate isomerases and enhanced carotenoid accumulation in a unicellular chlorophyte. Proc. Natl. Acad. Sci. USA. 1998;95:11482–11488. doi: 10.1073/pnas.95.19.11482. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Hoeffler J.F., Hemmerlin A., Grosdemange-Billiard C., Bach T.J., Rohmer M. Isoprenoid biosynthesis in higher plants and in Escherichia coli: On the branching in the methylerythritol phosphate pathway and the independent biosynthesis of isopentenyl diphosphate and dimethylallyl diphosphate. Biochem. J. 2002;366:573–583. doi: 10.1042/bj20020337. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Gwak Y., Hwang Y.S., Wang B., Kim M., Jeong J., Lee C.G., Jin E. Comparative analyses of lipidomes and transcriptomes reveal a concerted action of multiple defensive systems against photo oxidative stress in Haematococcus pluvialis. J. Exp. Bot. 2014;65:4317–4334. doi: 10.1093/jxb/eru206. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Britton G. Biosynthesis of carotenoids. In: Young A., Britton G., editors. Carotenoids in Photosynthesis. Springer; London, UK: 1993. pp. 96–126. [Google Scholar]
- 14.Mende K., Homann V., Tudzynski B. The geranylgeranyl diphosphate synthase gene of Gibberella fujikuroi: Isolation and expression. Mol. Gen. Genet. 1997;255:96–105. doi: 10.1007/s004380050477. [DOI] [PubMed] [Google Scholar]
- 15.Kainou T., Kawamura K., Tanaka K., Matsuda H., Kawamukai M. Identification of the GGPS1 genes encoding geranylgeranyl diphosphate synthases from mouse and human. Biochim. Biophys. Acta. 1999;1437:333–340. doi: 10.1016/S1388-1981(99)00028-1. [DOI] [PubMed] [Google Scholar]
- 16.Coman D., Altenhoff A., Zoller S., Gruissem W., Vranová E. Distinct evolutionary strategies in the GGPPS family from plants. Front. Plant Sci. 2014;5:230. doi: 10.3389/fpls.2014.00230. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Merchant S.S., Prochnik S.E., Vallon O., Harris E.H., Karpowicz S.J., Witman G.B. The Chlamydomonas genome reveals the evolution of key animal and plant functions. Science. 2007;318:245–250. doi: 10.1126/science.1143609. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Gonzalez-Garay M.L. Introduction to isoform sequencing using pacific biosciences technology (Iso-Seq) In: Wu J., editor. Transcriptomics and Gene Regulation. Springer; Dordrecht, The Netherlands: 2016. pp. 141–160. [Google Scholar]
- 19.Abdelghany S.E., Hamilton M., Jacobi J.L., Ngam P., Devitt N., Schilkey F., Reddy A.S. A survey of the sorghum transcriptome using single-molecule long reads. Nat. Commun. 2016;7:11706. doi: 10.1038/ncomms11706. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Luo Q., Bian C., Tao M., Huang Y., Zheng Y., Lv Y., Xu J. Genome and transcriptome sequencing of the astaxanthin-producing green microalga, Haematococcus pluvialis. Genome Biol. Evol. 2019;11:166–173. doi: 10.1093/gbe/evy263. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Wayama M., Ota S., Matsuura H., Nango N., Hirata A., Kawano S. Three-dimensional ultra structural study of oil and astaxanthin accumulation during encystment in the green alga Haematococcus pluvialis. PLoS ONE. 2013;8:e53618. doi: 10.1371/journal.pone.0053618. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Capelli B., Bagchi D., Cysewski G.R. Synthetic astaxanthin is significantly inferior to algal-based astaxanthin as an antioxidant and may not be suitable as a human nutraceutical supplement. Nutrafoods. 2013;12:145–152. doi: 10.1007/s13749-013-0051-5. [DOI] [Google Scholar]
- 23.Linden H. Carotenoid hydroxylase from Haematococcus pluvialis: cDNA sequence, regulation and functional complementation. Biochim. Biophys. Acta Gene Struct. Expr. 1999;1446:203–212. doi: 10.1016/S0167-4781(99)00088-3. [DOI] [PubMed] [Google Scholar]
- 24.Lotan T., Hirschberg J. Cloning and expression in Escherichia coli of the gene coding β-C-4-oxygenase, that converts β-carotene to the ketocarotenoid canthaxanthin in Haematococcus pluvialis. FEBS Lett. 1995;364:125–128. doi: 10.1016/0014-5793(95)00368-j. [DOI] [PubMed] [Google Scholar]
- 25.Kajiwara S., Kakizono T., Saito T., Saito T., Kondo K., Ohtani T., Nishio N., Misawa N. Isolation and functional identification of a novel cDNA for astaxanthin biosynthesis from Haematococcus pluvialis, and astaxanthin synthesis in Escherichia coli. Plant Mol. Biol. 1995;29:343–352. doi: 10.1007/BF00043657. [DOI] [PubMed] [Google Scholar]
- 26.Huang J.C., Chen F., Sandmann G. Stress-related differential expression of multiple β-carotene ketolase genes in the unicellular green alga Haematococcus pluvialis. J. Biotech. 2006;122:176–185. doi: 10.1016/j.jbiotec.2005.09.002. [DOI] [PubMed] [Google Scholar]
- 27.Ye L., Zhu X., Wu T., Wang W., Zhao D., Bi C., Zhang X. Optimizing the localization of astaxanthin enzymes for improved productivity. Biotechnol. Biofuels. 2018;11:278–287. doi: 10.1186/s13068-018-1270-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Henke N.A., Wendisch V.F. Improved astaxanthin production with Corynebcterium glutamicum by application of a membrane fusion protein. Mar. Drugs. 2019;17:621. doi: 10.3390/md17110621. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Wu Y., Yan P., Liu X., Wang Z., Tang Y.J., Chen T., Zhao X. Combinatorial expression of different β-carotene hydroxylases and ketolases in Escherichia coli for increased astaxanthin production. J. Ind. Microbiol. Biotechnol. 2019;46:1505–1516. doi: 10.1007/s10295-019-02214-1. [DOI] [PubMed] [Google Scholar]
- 30.Ruiz-Sola M.A., Coman D., Beck G., Barja M., Colinas M., Graf A., Gruissem W. Arabidopsis GERANYLGERANYL DIPHOSPHATE SYNTHASE 11 is a hub isozyme required for the production of most photosynthesis-related isoprenoids. New Phytol. 2016;209:252–264. doi: 10.1111/nph.13580. [DOI] [PubMed] [Google Scholar]
- 31.Liang P.H., Ko T.P., Wang A.H.J. Structure, mechanism and function of prenyltransferases. Eur. J. Biochem. 2002;269:3339–3354. doi: 10.1046/j.1432-1033.2002.03014.x. [DOI] [PubMed] [Google Scholar]
- 32.Tholl D., Kish C.M., Orlova I., Sherman D., Gershenzon J., Pichersky E., Dudareva N. Formation of monoterpenes in Antirrhinum majus and Clarkia breweri flowers involves heterodimeric geranyldiphosphate synthases. Plant Cell. 2004;16:977–992. doi: 10.1105/tpc.020156. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Beck G., Coman D., Herren E., Ruiz-Sola M.Á., Rodríguez-Concepción M., Gruissem W., Vranová E. Characterization of the GGPP synthase gene family in Arabidopsis thaliana. Plant Mol. Biol. 2013;82:393–416. doi: 10.1007/s11103-013-0070-z. [DOI] [PubMed] [Google Scholar]
- 34.Hsieh F.L., Chang T.H., Ko T.P., Wang A.H.J. Structure and mechanism of an Arabidopsis medium/long-chain-length prenylpyrophosphate synthase. Plant Physiol. 2011;155:1079–1090. doi: 10.1104/pp.110.168799. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Lao Y.M., Jin H., Zhou J., Zhang H.J., Zhu X.S., Cai Z.H. A novel hydrolytic activity of tri-functional geranylgeranyl pyrophosphate synthase in Haematococcus pluvialis. Plant Cell Physiol. 2018;59:2536–2548. doi: 10.1093/pcp/pcy173. [DOI] [PubMed] [Google Scholar]
- 36.Wang J., Lin H., Su P., Chen T., Guo J., Gao W., Huang L.Q. Molecular cloning and functional characterization of multiple geranylgeranyl pyrophosphate synthase (ApGGPPS) from Andrographis paniculata. Plant Cell Rep. 2019;38:117–128. doi: 10.1007/s00299-018-2353-y. [DOI] [PubMed] [Google Scholar]
- 37.Kane J.F. Effects of rare codon clusters on high-level expression of heterologous proteins in Escherichia coli. Curr. Opin. Biotechnol. 1995;6:494–500. doi: 10.1016/0958-1669(95)80082-4. [DOI] [PubMed] [Google Scholar]
- 38.Gustafsson C., Govindarajan S., Minshull J. Codon bias and heterologous protein expression. Trends Biotechnol. 2004;22:346–353. doi: 10.1016/j.tibtech.2004.04.006. [DOI] [PubMed] [Google Scholar]
- 39.Gao Z., Li Y., Wu G., Li G., Sun H., Deng S., Zhang X. Transcriptome analysis in Haematococcus pluvialis: Astaxanthin induction by salicylic acid (SA) and jasmonic acid (JA) PLoS ONE. 2015;10:e0140609. doi: 10.1371/journal.pone.0140609. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Zheng Y., Li Z., Tao M., Li J., Hu Z. Effects of selenite on green microalga Haematococcus pluvialis: Bioaccumulation of selenium and enhancement of astaxanthin production. Aquat. Toxicol. 2017;183:21–27. doi: 10.1016/j.aquatox.2016.12.008. [DOI] [PubMed] [Google Scholar]
- 41.Kumar S., Stecher G., Tamura K. MEGA7: Molecular Evolutionary Genetics Analysis version 7.0 for bigger datasets. Mol. Biol. Evol. 2016;33:1870–1874. doi: 10.1093/molbev/msw054. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Ma T., Zhou Y., Li X., Zhu F., Cheng Y., Liu Y., Liu T. Genome mining of astaxanthin biosynthetic genes from Sphingomonas sp. ATCC 55669 for heterologous overproduction in Escherichia coli. Biotechnol. J. 2016;11:228–237. doi: 10.1002/biot.201400827. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.






