Skip to main content
Radiation Oncology (London, England) logoLink to Radiation Oncology (London, England)
. 2020 Jan 8;15:9. doi: 10.1186/s13014-019-1456-0

Impact of genetic variant of HIPK2 on the risk of severe radiation pneumonitis in lung cancer patients treated with radiation therapy

Yang Tang 1,#, Li Yang 2,#, Wan Qin 1, Min’ Xiao Yi 1, Bo Liu 1, Xiang’Lin Yuan 1,✉
PMCID: PMC6950809  PMID: 31915028

Abstract

Background

Homeodomain-interacting protein kinase 2 (HIPK2) has increasingly drawn attention as recent researches demonstrated its unique role in the regulation of multiple fundamental processes such as apoptosis, proliferation and DNA damage repair. Most importantly, HIPK2 was shown to play regulatory role in inflammation and influence the phenotype and activity of fibroblasts. In this study, we aimed to evaluate the impact of HIPK2 gene variant on risk of radiation pneumonitis for patients with pulmonary malignancies.

Methods

169 lung cancer patients with radiotherapy were included in our prospective study and genotyped by Sanger Sequence method. Multivariable Cox hazard analysis and multiple testing were applied to estimate the hazard ratio (HR) and 95% confidence intervals (CIs) of all factors possibly related to the risk of radiation pneumonitis (RP).

Results

Patients with Mean Lung Dose (MLD) ≥ 15Gy, Lung V20 ≥ 24% had higher risk of RP ≥ grade 2 compared with those counterparts (HR = 1.888, 95% CI: 1.186–3.004, P = 0.007; HR = 2.126, 95% CI: 1.338–3.378, P = 0.001, respectively). Importantly, CC genotype of HIPK2: rs2030712 were strongly related to an increased occurrence of RP ≥ grade 2 (HR = 2.146, 95% CI: 1.215–3.791, P = 0.009).

Conclusion

HIPK2: rs2030712 was found to be significantly related to RP of grade ≥ 2 in our cohort, and may thus be one of the important predictors of severe RP before radiotherapy, if further validated in larger population.

Trial registration

Our study was prospective and observational. The research was registered in ClinicalTrials.gov database as NCT02490319.

Keywords: Radiation pneumonitis, Lung cancer, HIPK2, SNP

Background

Globally, lung cancer currently remains as the top one cause of cancer-related mortality. According to the latest statistical report, there are 2.1 million new lung cancer cases and 1.8 million deaths predicted globally in 2018, nearly close to 1 in 5 (18.4%) of all cancer deaths [1]. Among all countries worldwide, China suffered from high rates of male lung cancer (above 40 per 100,000) in 2018. Radiotherapy (RT), with or without chemotherapy, still acts as the fundamental treatment for lung cancer patients. However, the efficacy of radiotherapy is restrained due to a series of RT-related complications that cause patients intolerance.

Radiation pneumonitis (RP) is a type of inflammation and subsequent fibrosis that occurs after irradiation, which is the most common complication and the major dose-limiting toxicity associated with radiotherapy. By limiting the radiation dose that can be applied and the size of the irradiated volume, RP hinders the tumor-controlling effects of radiotherapy [2, 3]. Furthermore, poor quality of life or life-threatening symptoms can be caused by RP in 15–40% of all patients who are irradiated for lung cancer [4]. Therefore, reliable predictors for RP occurrence is of great value to maximize the therapeutic effects and to minimize its adverse effects of RT. In addition to the previous reported patient- and treatment-related factors [5], including Karnofsky performance status (KPS), chronic lung disease [6], smoking status, chemotherapy [7, 8], dosimetric parameters and plasma values of TGFβ [9, 10], some genetic variants were recently found to be associated with the occurrence and development of RP [11–16].

Homeodomain-interacting protein kinase 2 (HIPK2) is a member of serine/threonine kinase family. HIPK2 plays important part in phosphorylation and interaction with a series of molecules involving development gene transcription and cellular responses to stress signals [17]. In addition, HIPK2 regulates multiple transcription factors functioning in different processes including differentiation, apoptosis and proliferation [18]. Recently, the function of HIPK2 in regulation of inflammation and fibrosis has drawn much attention. A study of idiopathic lung fibrosis (IPF) patients indicated that HIPK2 gene defect was found in fibroblastic foci and such defect may result in phenotypic and biological behavioral change of fibroblasts and myofibroblasts [19]. The results provided evidences that dysfunction of HIPK2 play significant role in disease progression and treatment resistance for IPF patients. However, up till now, the research on the function of HIPK2 in RP risk and pathogenesis is lacking. HIPK2 rs2030712 has been investigated as a potential risk factor of chronic kidney fibrotic disease occurrence and progression. Despite the fact that the study presented negative result [20], considering race disparities and different disease pathogenesis of RP, we selected rs2030712 as single nucleotide polymorphism (SNP) candidate for this study. In order to identify clinical valuable SNPs on RP occurrence and severity, in this study we explored the association between HIPK2 SNP rs2030712 with RP risk in our cohort.

Methods

Patient population

Our prospective study was registered in ClinicalTrials.gov database (NCT02490319). In brief, 190 lung cancer patients were initially enrolled. All patients were treated with radiation therapy at Tongji Hospital, Huazhong University of Science and Technology (Wuhan, Hubei Province, China) between 2009 and 2015. We included the patients with a radiation dose at least 45 Gy, age > 18 years old, KPS > 60 and a life expectancy of at least 6 months. Patients with previous thoracic irradiation or severe cardiopulmonary diseases were excluded from our study. Of the 199 patients, 169 patients (114 with non-small cell lung cancer and 55 with small-cell lung cancer) were eventually included for the final genotyping analysis. Samples from 169 patients were genotyped by Sanger Sequencing for the SNP candidate. This study was approved by the Review Board of Tongji Hospital. Written informed consents were obtained from all patients for the use of their clinical information and for obtaining their blood and DNA.

Treatment and follow-up

All patients received radiotherapy with 6-MV X-rays from a linear accelerator (Elekta Synergy, Elekta, Sweden). The median total radiation dose was 56 Gy (range from 45 to 66 Gy), with 1.5 to 2 Gy administered per radiation treatment. IMRT (intensity-modulated radiation therapy) was administered to 46.7% of patients (n = 79). Computed tomography simulation (CT/e, GE, Fairfield, Connecticut, USA) was performed before the RT treatment was planned. The target volumes and critical normal organs were delineated by the three-dimensional planning system (Pinnacle Version 9.2). The baseline clinical characteristics and treatment details of the patients are shown in Table 1.

Table 1.

Detailed clinical characteristics of the patients enrolled in this study (N = 169)

Characteristic No. of Patients %
Sex
 Male 125 74.0
 Female 44 26.0
Age, years
 Median 58
 Range 28–78
Histology
 SCLC 55 32.5
 NSCLC 114 67.5
Stage
 I- II 24 10.2
 III-IV 145 85.8
KPS
 80–100 123 72.6
  < 80 46 27.4
Smoking
 Smoker 106 62.0
 Non-smoker 63 38.0
Chemotherapy
 Yes 160 94.7
 No 9 5.3
CRT
 Yes 44 26.0
 No 125 74.0
Surgery
 Yes 86 50.9
 No 83 49.1
IMRT
 Yes 79 46.7
 No 90 53.3
Radiation dose (cGy)
 Median 5600
 Range 4500–6600
MLD (cGy)
 Median 1368
 Range 178–2017
V20
 Median 24.82
 Range 0–42.00
COPD
 Yes 19 11.2
 No 150 88.8

Abbreviations: KPS Kamofsky performance status; CRT concurrent chemoradiation; IMRT intensity-modulated radiation therapy; MLD mean lung dose; V20 volume of normal lung receiving 20 Gy or more radiation; COPD chronic obstructive pulmonary disease

All patients enrolled in this study were examined during and one month after radiotherapy. Then, the patients were followed every three months for the first year and every six months thereafter. At each follow-up visits, all patients were asked to undergo a chest X-ray or CT and clinical information, including symptoms, was collected. RP was graded by two radiation oncologists (associate chief physician level required, with minimum 5 years of clinical experiences) according to the Common Terminology Criteria for Adverse Events 4.0 as follows: Grade 0, no change; Grade 1, asymptomatic and diagnosed by radiographic findings only; Grade 2, symptomatic, not interfering with daily activities; Grade 3, symptomatic, interfering with daily activities or oxygen required; Grade 4, assisted ventilation required; Grade 5, fatal.

Genotyping methods

Genomic DNA was extracted with a PureLink Genomic DNA Mini Kit (Invitrogen, K1820–01) from peripheral blood. HIPK2: rs2030712 was selected as single SNP candidate in this study, and was genotyped by Sanger Sequencing method for samples from 169 patients included. The primer pairs for rs2030712 were F: 5′- TGGAGATTTACAACACTCTAGGG -3′; R: 5′- ACAGAACTCACGTGTGCTTT − 3′. The 262 bp PCR products were then subjected to DNA sequencing to detect mutations.

Statistical analysis

The end point for this study was the development of RP ≥ grade 2. The time to the end point was calculated from the start of radiotherapy. Patients who did not experience RP ≥ grade 2 within 12 months of RT were censored. SPSS 21.0 statistical software (SPSS, lnc., Chicago, IL, USA) was used for the statistically analysis. Patients were divided into groups according to their genotypes, and Cox proportional hazard analysis was applied to estimate the hazard ratio (HR) and 95% confidence intervals (CIs) of all factors possibly related to the risk of RP. Moreover, multivariable Cox regression analysis was used for the adjustment of covariates. The influences of the genotypes on RP risk were assessed by Kaplan-Meier analysis and compared with log-rank tests.

Results

Patient characteristics and radiation pneumonitis

One hundred sixty-nine patients were included in this study with 125 males and 44 females. Their characteristics are listed in Table 1. The median age of the population was 58 years (range from 28 to 78 years); 114 patients had NSCLC, and 55 had SCLC. In the study cohort, 85.5% of patients had stage III-IV disease, 50.9% underwent surgery before RT, almost all patients (94.7%) received induction chemotherapy followed by radiotherapy and 26.0% had concurrent chemoradiation. The median radiation dose was 56 Gy (range from 45 to 66 Gy), the median mean lung dosage (MLD) was 13.68 Gy (range from 1.78 to 20.17 Gy), and the median V20 was 24% (range from 0 to 42.00%).

Within 12 months of radiotherapy, 99 patients (58.6%) suffered RP ≥ grade 2. The associations between patient-, tumor- and therapy-related characteristics and RP ≥ grade 2 are listed in Table 2. The univariable and multivariable analysis by Cox regression model revealed that MLD and V20 was significantly related to RP ≥ grade 2. Patients with elder age, MLD ≥ 15Gy, V20 ≥ 24% had higher risk of RP ≥ grade 2 compared with those counterparts (HR = 1.888, 95% CI: 1.186–3.004, P = 0.007; HR = 2.126, 95% CI: 1.338–3.378, P = 0.001, respectively) (Table 2), which were consistent with the results of other publications.

Table 2.

Association between patient-, tumor-, and therapy-related characteristics and Grade ≥ 2 radiation pneumonitis (N = 169)

Parameter Univariable Analysis Multivariable Analysis
HR 95% CI P HR 95% CI P
Sex
 Female 1 1
 Male 1.216 0.773–1.915 0.398 1.379 0.758–2.511 0.292
Age, years
  < 58 1 1
  ≥ 58 1.413 0.951–2.098 0.087 1.541 0.997–2.383 0.052
Histology
 SCLC 1 1
 NSCLC 1.195 0.791–1.804 0.398 1.251 0.727–2.153 0.418
Stage
 I-II 1 1
 III-IV 1.100 0.601–2.013 0.758 1.132 0.593–2.163 0.707
KPS
 80–100 1 1
  < 80 1.341 0.877–2.052 0.176 1.566 0.993–2.470 0.054
Smoking
 Smoker 1 1
 Nonsmoker 0.926 0.619–1.386 0.708 0.964 0.337–2.192 0.435
Surgery
 Yes 1 1
 No 1.014 0.684–1.504 0.945 0.690 0.390–1.223 0.204
Chemotherapy
 Yes 1 1 1
 No 0.500 0.203–1.233 0.132 0.473 0.189–1.187 0.111
CRT
 Yes 1 1
 No 0.843 0.529–1.344 0.472 0.956 0.575–1.588 0.861
IMRT
 Yes 1 1
 No 1.077 0.726–1.598 0.712 1.098 0.710–1.699 0.675
Radiation dose, cGy
 <5600 1 1
  ≥ 5600 1.083 0.729–1.610 0.692 1.139 0.633–2.535 0.737
MLD, cGy
  < 1500 1 1
  ≥ 1500 1.510 1.093–2.235 0.045 1.888 1.186–3.004 0.007
V20
  < 24% 1 1
  ≥ 24% 1.730 1.138–2.631 0.010 2.126 1.338–3.378 0.001
COPD
 Yes 1 1
 No 0.639 0.246–1.661 0.358 0.780 0.339–1.998 0.472

Note: Multivariable analyses were adjusted for all of the factors in this table, statistically significant p values for multivariable analysis were shown in boldface.

*Either MLD or V20 was used in the multivariable analyses, but not both

HIPK2 SNPs and RP

HIPK2: rs2030712 was found to be significantly associated with the occurrence of RP ≥ grade 2 (Table 3). Figure 1 is a plot of the RP-free survival percentage for RP ≥ grade 2 for each genotype of HIPK2: rs2030712 determined by the Kaplan-Meier method. Patients with the CC genotype of HIPK2: rs2030712 had significantly higher risks of RP ≥ grade 2 than patients with CT genotype (P < 0.0001). Furthermore, multiple Cox proportional hazard analyses with adjustments for all of the characteristics listed in Table 1 revealed that the CC genotype of HIPK2: rs2030712 were strongly related to a increased occurrence of RP ≥ grade 2 (HR = 2.146, 95% CI: 1.215–3.791, P = 0.009) (Table 3).

Table 3.

Association between genotypes and Grade ≥ 2 RP

Polymorphism and Genotype No.of event No.of total Univariable analysis Multivariable analysis
HR 95% CL P HR 95% CL P
HIPK2: rs2030712
 CT 14 35 1 1
 CC 85 134 2.009 1.140–3.539 0.016 2.146 1.215–3.791 0.009

NOTE: Multiple analyses in this table were adjusted for all the factors listed in Table 1

Abbreviations: HR hazard ratio; CI confidence interval

Pc: P-value corrected by Benjamini and Hochberg False Discovery Rate correction

Fig. 1.

Fig. 1

Kaplan-Meier estimates RP-free survival (RP ≥ grade 2) for each genotype of HIPK2:rs2030712

HIPK2: rs2030712 and Dosimetric factors

Patients were divided to four groups based on the dosimetric factors-V20 or MLD and HIPK2: rs2030712 genotypes in order to evaluate the impact of the HIPK2: rs2030712 genotypes on RP in different dosimetric groups. Patients with CC genotype of HIPK2: rs2030712 and MLD ≥ 15Gy or V20 ≥ 24% had the highest risk of RP grade ≥ 2 compared with other groups (P < 0.0001 and P < 0.0001, respectively, Fig. 2a, b). Interestingly, for the patients with HIPK2: rs2030712 CC genotype and MLD <15Gy or V20 < 24%, they had even higher incidence of RP ≥ grade 2 with the patients who received MLD more than 15Gy or V20 more than 24%, suggesting the dominant and independent role of HIPK2: rs2030712 genotypes in RP.

Fig. 2.

Fig. 2

Kaplan-Meier estimates effect of genotype in HIPK2:rs2030712 and dosimetric parameters on RP-free survival (RP ≥ grade 3) (a) HIPK2:rs2030712 and MLD; (b) HIPK2:rs2030712 and V20

Discussion

In this study, HIPK2: rs2030712 were found for the first time to be significantly associated with the occurrence of RP ≥ grade 2. Patients with the CC genotype of HIPK2: rs2030712 had a significantly increased risk of RP after radiotherapy for lung cancer. We also discovered that the association between HIPK2: rs2030712 and RP grade ≥ 2 was independent of MLD and V20.

The occurrences of RP ≥ grade 2 were 58.6%, which were similar to those reported previously. Due to the prospective nature of our study, the incidence rate of RP was relatively higher than in some retrospective studies. We also confirmed that age, MLD and V20 was closely related to the risk of RP. In our cohort, patients with MLD ≥ 15Gy and V20 ≥ 24% had a greater risk of developing RP grade ≥ 2, which verified the associations between the radiation dosimetric-related factors and the occurrence of RP.

As is well known that pro-inflammatory and fibrogenic cytokines induced by irradiation are involved in the pathogenesis of RP [21]. Our previous studies have already demonstrated that SNPs of several genes involving inflammation regulation are associated with RP risk [11–14]. However, the exact role that HIPK2 playing in tissue inflammation and fibrosis is largely unknown. Recent advances in kidney fibrotic disease indicated that the protein expression of HIPK2 was significantly elevated in human HIV- associated nephropathy patients [22]. In renal tubular epithelial cell model, study demonstrated that HIPK2 not only up-regulated expression of several pro-fibrotic cytokines, such as smooth muscle actin, fibronectin, collagen I, but also activated several pro-fibrotic and pro-inflammatory signal pathways including TGF- β (transforming growth factor β)–Smad3, Wnt-Notch and NF-κB pathways [23]. On the other hand, the role of HIPK2 in pulmonary fibrotic disease, especially in RP is much less clear. Results from study on idiopathic pulmonary fibrosis (IPF) patients demonstrated that HIPK2 expression in IPF-derived fibroblasts is significantly lower compared with normal counterparts [19]. In addition, allelic deletion was detected specifically in IPF fibroblast, which may be caused by chronic inflammation. This phenomenon was shown to be similar with precancerous lesion, which defective HIPK2 was accumulated during clonal expansion of IPF fibroblast under inflammatory stimulus. Therefore, HIPK2 may represent a novel therapeutic target in pulmonary fibrotic diseases.

Furthermore, in this study we demonstrated for the first time the prevalence and clinical value of HIPK2: rs2030712 on RP in independent Chinese Han cohort, and may thus be one of the important predictors of severe RP before radiotherapy in addition to the radiation dosimetric factors. Those patients with RP susceptibility genotypes will greatly benefit from early prediction and prevention of RP by genotyping before the initiation of RT. And this study will help us to choose the patients without RP susceptibility genotypes and elevate their radiation dose appropriately for a better control of tumor. Especially for the patients with favorable genotypes, elevated MLD and V20 will not increase their incidence of severe RP, which could assist the oncologist to adjust the radiation dose personally. Moreover, our findings suggest the possible role of HIPK2 in the pathogenesis of RP, which will aid in the discovery of target to treat RP in future research.

On the other hand, interstitial lung disease (ILD) is one of the risk factors that have been demonstrated to be related with increased RP incidence [24]. Unfortunately, in this study we didn’t include the status of ILD as clinical parameter for cohort analysis, which had potential influence in our conclusion. Therefore, our results still require further validation in expanded cohorts with related ILD status information from different races, since the substantial ethnic variation exist in SNP frequencies. Moreover, HIPK2: rs2030712 warrant further investigation to identify the causative SNPs and their molecular mechanisms. Furthermore, we need to explore the potential role of HIPK2 pathway in the pathogenesis of RP, which would provide novel insight into the treatment of RP.

Conclusions

In summary, it is the first study to confirm the associations between RP risk and HIPK2: rs2030712, and thus indicated that in addition to the radiation dosimetric factors, HIPK2 SNP can be used as useful predictive biomarker of RP risk before RT. Thus, patients will greatly benefit from early prediction and prevention of RP by genotyping before the initiation of RT. And this study will benefit lung cancer patients receiving radiotherapy since appropriately tailored radiation dose might result in better control of their diseases and lower occurrence and severity of RP.

Acknowledgements

Not applicable.

Abbreviations

IPF

Idiopathic pulmonary fibrosis

KPS

Karnofsky performance status

MLD

Mean lung dosage

NSCLC

Non small cell lung cancer

RP

Radiation pneumonitis

RT

Radiotherapy

SCLC

Small cell lung cancer

SNP

Single nucleotide polymorphism

Authors’ contributions

TY designed and conducted the major analytical work of the study; YL wrote the draft of the manuscript; QW, YMX and LB contributed in the data collection and statistical analysis. YXL supervised the whole study conduction; All authors have read and approved the final manuscript.

Funding

This study was funded by National Natural Science Foundation of China (grant No. 81773360 and 81700145).

Availability of data and materials

The detailed genetic data from our cohort analyzed during the current study are not publicly available due to the private gene information protection policy of our center. But they are available from the corresponding author on reasonable request.

Ethics approval and consent to participate

This study was approved by the Review Board of Tongji Hospital. Written informed consents were obtained from all patients for the use of their clinical information and for obtaining their blood and DNA.

Consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Footnotes

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Yang Tang and Li Yang contributed equally to this work.

References

  • 1.Bray Freddie, Ferlay Jacques, Soerjomataram Isabelle, Siegel Rebecca L., Torre Lindsey A., Jemal Ahmedin. Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA: A Cancer Journal for Clinicians. 2018;68(6):394–424. doi: 10.3322/caac.21492. [DOI] [PubMed] [Google Scholar]
  • 2.Jain Varsha, Berman Abigail T. Radiation Pneumonitis: Old Problem, New Tricks. Cancers. 2018;10(7):222. doi: 10.3390/cancers10070222. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Tsujino Kayoko, Hashimoto Tomohisa, Shimada Temiko, Yoden Eisaku, Fujii Osamu, Ota Yosuke, Satouchi Miyako, Negoro Shunichi, Adachi Shuji, Soejima Toshinori. Combined Analysis of V20, VS5, Pulmonary Fibrosis Score on Baseline Computed Tomography, and Patient Age Improves Prediction of Severe Radiation Pneumonitis After Concurrent Chemoradiotherapy for Locally Advanced Non–Small-Cell Lung Cancer. Journal of Thoracic Oncology. 2014;9(7):983–990. doi: 10.1097/JTO.0000000000000187. [DOI] [PubMed] [Google Scholar]
  • 4.Rodrigues George, Lock Michael, D'Souza David, Yu Edward, Van Dyk Jake. Prediction of radiation pneumonitis by dose–volume histogram parameters in lung cancer—a systematic review. Radiotherapy and Oncology. 2004;71(2):127–138. doi: 10.1016/j.radonc.2004.02.015. [DOI] [PubMed] [Google Scholar]
  • 5.Vogelius Ivan R., Bentzen Søren M. A literature-based meta-analysis of clinical risk factors for development of radiation induced pneumonitis. Acta Oncologica. 2012;51(8):975–983. doi: 10.3109/0284186X.2012.718093. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Takeda Atsuya, Kunieda Etsuo, Ohashi Toshio, Aoki Yousuke, Oku Yohei, Enomoto Tatsuji, Nomura Koichiro, Sugiura Madoka. Severe COPD Is Correlated With Mild Radiation Pneumonitis Following Stereotactic Body Radiotherapy. Chest. 2012;141(4):858–866. doi: 10.1378/chest.11-1193. [DOI] [PubMed] [Google Scholar]
  • 7.Onishi H, Kuriyama K, Yamaguchi M, et al. Concurrent two-dimensional radiotherapy and weekly docetaxel in the treatment of stage III non-small cell lung cancer: a good local response but no good survival due to radiation pneumonitis. Lung Cancer. 2003;40:79–84. doi: 10.1016/S0169-5002(02)00532-9. [DOI] [PubMed] [Google Scholar]
  • 8.Parashar B, Edwards A, Mehta R, et al (2011) Chemotherapy significantly increases the risk of radiation pneumonitis in radiation therapy of advanced lung cancer. Am J Clin Oncol 34:160–164. 10.1097/COC.0b013e3181d6b40f. [DOI] [PubMed]
  • 9.Zhao Lujun, Wang Luhua, Ji Wei, Wang Xiaozhen, Zhu Xiangzhi, Hayman James A., Kalemkerian Gregory P., Yang Weizhi, Brenner Dean, Lawrence Theodore S., Kong Feng-Ming. Elevation of Plasma TGF-β1 During Radiation Therapy Predicts Radiation-Induced Lung Toxicity in Patients With Non-Small-Cell Lung Cancer: A Combined Analysis From Beijing and Michigan. International Journal of Radiation Oncology*Biology*Physics. 2009;74(5):1385–1390. doi: 10.1016/j.ijrobp.2008.10.065. [DOI] [PubMed] [Google Scholar]
  • 10.Shi Shiming, Zeng Zhaochong, Ye Luxi, Huang Yan, He Jian. Risk Factors Associated With Symptomatic Radiation Pneumonitis After Stereotactic Body Radiation Therapy for Stage I Non–Small Cell Lung Cancer. Technology in Cancer Research & Treatment. 2016;16(3):316–320. doi: 10.1177/1533034616661665. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Tang Yang, Liu Bo, Li Jing, Wu Huanlei, Yang Ju, Zhou Xiao, Yi Mingxiao, Li Qianxia, Yu Shiying, Yuan Xianglin. Genetic variants in PI3K/AKT pathway are associated with severe radiation pneumonitis in lung cancer patients treated with radiation therapy. Cancer Medicine. 2015;5(1):24–32. doi: 10.1002/cam4.564. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Yi Minxiao, Tang Yang, Liu Bo, Li Qianxia, Zhou Xiao, Yu Shiying, Fu Shengling, Cai Yixin, Yuan Xianglin. Genetic variants in the ITGB6 gene is associated with the risk of radiation pneumonitis in lung cancer patients treated with thoracic radiation therapy. Tumor Biology. 2015;37(3):3469–3477. doi: 10.1007/s13277-015-4171-y. [DOI] [PubMed] [Google Scholar]
  • 13.Liu Bo, Tang Yang, Yi Minxiao, Liu Qingxu, Xiong Huihua, Hu Guangyuan, Yuan Xianglin. Genetic variants in the plasminogen activator inhibitor-1 gene are associated with an increased risk of radiation pneumonitis in lung cancer patients. Cancer Medicine. 2017;6(3):681–688. doi: 10.1002/cam4.1011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Liu B, Yi M, Tang Y, et al (2016) MMP-1 promoter polymorphism is associated with risk of radiation-induced lung injury in lung cancer patients treated with radiotherapy. Oncotarget 7:70175–70184. 10.18632/oncotarget.12164 [DOI] [PMC free article] [PubMed]
  • 15.Xiao Y, Yuan X, Qiu H, Li Q. Single-nucleotide polymorphisms of TGFbeta1 and ATM associated with radiation-induced pneumonitis: a prospective cohort study of thoracic cancer patients in China. Int J Clin Exp Med. 2015;8:16403–16413. [PMC free article] [PubMed] [Google Scholar]
  • 16.Wen Juyi, Liu Hongliang, Wang Lili, Wang Xiaomeng, Gu Ning, Liu Zhensheng, Xu Ting, Gomez Daniel R., Komaki Ritsuko, Liao Zhongxing, Wei Qingyi. Potentially Functional Variants of ATG16L2 Predict Radiation Pneumonitis and Outcomes in Patients with Non–Small Cell Lung Cancer after Definitive Radiotherapy. Journal of Thoracic Oncology. 2018;13(5):660–675. doi: 10.1016/j.jtho.2018.01.028. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Calzado Marco A., De La Vega Laureano, Munoz Eduardo, Schmitz M. Lienhard. From top to bottom: The two faces of HIPK2 for regulation of the hypoxic response. Cell Cycle. 2009;8(11):1659–1664. doi: 10.4161/cc.8.11.8597. [DOI] [PubMed] [Google Scholar]
  • 18.Rinaldo Cinzia, Prodosmo Andrea, Siepi Francesca, Soddu Silvia. HIPK2: a multitalented partner for transcription factors in DNA damage response and developmentThis paper is one of a selection of papers published in this Special Issue, entitled 28th International West Coast Chromatin and Chromosome Conference, and has undergone the Journal's usual peer review process. Biochemistry and Cell Biology. 2007;85(4):411–418. doi: 10.1139/O07-071. [DOI] [PubMed] [Google Scholar]
  • 19.Ricci Alberto, Cherubini Emanuela, Ulivieri Alessandra, Lavra Luca, Sciacchitano Salvatore, Scozzi Davide, Mancini Rita, Ciliberto Gennaro, Bartolazzi Armando, Bruno Pierdonato, Graziano Paolo, Mariotta Salvatore. Homeodomain-interacting protein kinase2 in human idiopathic pulmonary fibrosis. Journal of Cellular Physiology. 2012;228(1):235–241. doi: 10.1002/jcp.24129. [DOI] [PubMed] [Google Scholar]
  • 20.Zywiec J, Kiliś-Pstrusińska K, Gumprecht J, et al. No associations between rs2030712 and rs7456421 single nucleotide polymorphisms of HIPK2 gene and prevalence of chronic kidney disease. Results of a family-based study. Ann Agric Environ Med. 2013;20:131–134. [PubMed] [Google Scholar]
  • 21.Lierova A, Jelicova M, Nemcova M, et al (2018) Cytokines and radiation-induced pulmonary injuries. J Radiat Res 59:709–753. 10.1093/jrr/rry067. [DOI] [PMC free article] [PubMed]
  • 22.Fan Ying, Wang Niansong, Chuang Peter, He John C. Role of HIPK2 in kidney fibrosis. Kidney International Supplements. 2014;4(1):97–101. doi: 10.1038/kisup.2014.18. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Jin Yuanmeng, Ratnam Krishna, Chuang Peter Y, Fan Ying, Zhong Yifei, Dai Yan, Mazloom Amin R, Chen Edward Y, D'Agati Vivette, Xiong Huabao, Ross Michael J, Chen Nan, Ma'ayan Avi, He John Cijiang. A systems approach identifies HIPK2 as a key regulator of kidney fibrosis. Nature Medicine. 2012;18(4):580–588. doi: 10.1038/nm.2685. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Tamiya A, Tamiya M, Nakahama K, et al (2017) Correlation of radiation pneumonitis history before nivolumab with onset of interstitial lung disease and progression-free survival of patients with pre-treated advanced non-small cell lung cancer. Anticancer Res 37:5199–5205. 10.21873/anticanres.11943 [DOI] [PubMed]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

The detailed genetic data from our cohort analyzed during the current study are not publicly available due to the private gene information protection policy of our center. But they are available from the corresponding author on reasonable request.


Articles from Radiation Oncology (London, England) are provided here courtesy of BMC

RESOURCES