Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2020 Nov 29.
Published in final edited form as: Gen Comp Endocrinol. 2019 Nov 30;287:113349. doi: 10.1016/j.ygcen.2019.113349

Comprehensive RNA-Seq analysis of notochord-enriched genes induced during Xenopus tropicalis tail resorption

Keisuke Nakajima 1, Yuta Tanizaki 2, Nga Luu 2, Hongen Zhang 2, Yun-Bo Shi 2
PMCID: PMC6956247  NIHMSID: NIHMS1547251  PMID: 31794731

Abstract

Anuran metamorphosis is perhaps the most dramatic developmental process regulated by thyroid hormone (TH). One of the unique processes that occur during metamorphosis is the complete resorption of the tail, including the notochord. Interestingly, recent gene knockout studies have shown that of the two known vertebrate TH receptors, TRα and TRβ, TRβ appears to be critical for notochord regression during tail resorption in Xenopus tropicalis. To determine the mechanisms underlying notochord regression, we carried out a comprehensive gene expression analysis in the notochord during metamorphosis by using RNA-Seq analyses of whole tail at stage 60 before any noticeable tail length reduction, whole tail at stage 63 when the tail length is reduced by about one half, and the rest of the tail at stage 63 after removing the notochord. This allowed us to identify many notochord-enriched, metamorphosis-induced genes at stage 63. Future studies on these genes should help to determine if they are regulated by TRβ and play any roles in notochord regression.

Keywords: Metamorphosis, Xenopus tropicalis, thyroid hormone receptor, tail resorption, notochord, RNA-Seq, matrix metalloproteinase, olfm4, scppa2

1. INTRODUCTION

Amphibian metamorphosis involves dramatic and systematic changes of different organs/tissues as a larva is transformed into an adult, including the absorption of larva-specific organs, such as the tail and gills, and formation of adult type organs, such as limbs (Tata 1993; Shi 1999). It is accompanied by the lifestyle change from being aquatic to being terrestrial. This reorganization is triggered simply by a surge of thyroid hormone (TH). TH regulates the expression of target genes via TH receptors (TRs), designated TRα and TRβ, and TRs are both necessary and sufficient for mediating the metamorphic effects of TH (Nakajima et al. 2005; Shi 2009; Grimaldi et al. 2013; Choi et al. 2015; Sachs 2015; Wen and Shi 2015; Yen 2015; Wen and Shi 2016; Choi et al. 2017; Wen et al. 2017; Buchholz and Shi 2018; Nakajima et al. 2018; Sakane et al. 2018).

A unique and one of most dramatic processes during metamorphosis is the complete resorption of the tadpole tail in anurans, by far the largest organ of the tadpole. Like other processes during metamorphosis, it is controlled by TH and TH can even induce tail resorption in organ cultures, indicating the TH can directly induced the apoptotic degeneration of all tail tissues, such as muscle, skin and notochord (Tata et al. 1991; Tata 1993; Shi 1999). While many studies have been reported on the degeneration of the tail muscle and skin, little is known about how notochord regresses during metamorphosis. Notochord is an embryonic midline structure common to all members of the phylum Chordata. In higher vertebrates, the notochord exists transiently and has at least two important functions. First, the notochord produces secreted factors that signal to all surrounding tissues, providing position and fate information. Second, the notochord plays an important structural role. Notochord consists of tension-resisting sheath and vacuolated cells under pressure, resembling the hydrostatic skeleton of the embryo until other elements, such as the vertebrae, form. In mammals, notochord disappears during embryogenesis and contributes to the center of the intervertebral discs in a structure called the nucleus pulposus (Stemple 2005; Corallo et al. 2015), in a process that appears not to involve differential proliferation and apoptosis (Aszodi et al. 1998). In the anuran tail, the notochord is expected to regress completely as the tail is resorbed, but the underlying molecular mechanism remains unclear.

Recent gene knockout studies in Xenopus tropicalis have revealed distinct roles of TRα and TRβ during metamorphosis (Choi et al. 2015; Sachs 2015; Wen and Shi 2015; Yen 2015; Wen and Shi 2016; Choi et al. 2017; Wen et al. 2017; Buchholz and Shi 2018; Nakajima et al. 2018; Sakane et al. 2018). Of particular interest is that the tail of TRβ-knockout (KO) animals have delayed tail resorption with a healthy notochord present in the tail compared to the control wild type or TRα-KO animals (Nakajima et al. 2018). This interesting phenotype indicates that TRβ may have a specific role in regulating notochord regression (Nakajima et al. 2018; Nakajima et al. 2019). Here, we have performed a comprehensive analysis of gene expression in the metamorphosing tail and our analyses have revealed many genes that are likely regulated by TRβ in the notochord during metamorphosis.

2. MATERIALS AND METHODS

2.1. Animals rearing and staging

Wild type adult X. tropicalis were provided by the Amphibian Research Center (Hiroshima University) through the National Bio-Resource Project of the MEXT, Japan or were purchased from NASCO. Tadpoles were staged according to (Nieuwkoop and Faber 1965). The stages from 58 to 60, from 60 to 62, and from 62 to 65 were judged based on the length of the forelimbs, the ratio of nervus olfactorius length to the bulbus olfactorius diameter, and the ratio of tail length to body length, respectively. All animal care and treatments were done as approved based on the guidelines established by Hiroshima University for the care and use of experimental animals or Animal Use and Care Committee of Eunice Kennedy Shriver National Institute of Child Health and Human Development (NICHD), National Institutes of Health (NIH).

2.2. Sample preparation, RNA extraction and RT-PCR

These were done as previously described (Nakajima et al. 2019). All RT-PCR analyses were done with RNA samples independent of those used for RNA-Seq analyses. RT-PCR primers were forward primer 5’-GATGAGCATGGAGTCTGTCAGTGT −3’ and reverse primer 5’-AGCTTCTGCAGGCATCCTGTTAGT −3’ for Olfm4, or forward primer 5’-CTGTGACAGCAACTGCTAAACGAC −3’ and reverse primer 5’-GAACTTTCTGAGGAATGGGAGTGG −3’ for Scppa2, or as described previously for EF1α (Wen and Shi 2015). The mRNA level was quantified and normalized against that of EF1α mRNA.

2.3. RNA-Seq

The integrity of total RNA (RIN) was determined using Agilent Bioanalyzer 2100 system (Agilent Technologies, CA, USA) with RIN > 8.0. The total RNA was then used for RNA-Seq by the Molecular Genomics Core, Eunice Kennedy Shriver National Institute of Child Health and Human Development, National Institutes of Health, Bethesda, USA. Briefly, the mRNA was purified from total RNA by using poly-T oligo-attached magnetic beads and chemically fragmented. A single set of RNA samples were subjected to RNA-Seq in three technical replicates. Briefly, first strand cDNA was synthesized by using random hexamer primers and M-MuLV Reverse Transcriptase (RNase H-). Second strand cDNA synthesis was subsequently performed by using DNA Polymerase I and RNase H. The cDNA libraries were generated by using the TruSeq RNA Sample Preparation Kit (Illumina, San Diego, CA, USA) following the standard protocols. The libraries were sequenced on the Illumina HiSeq 2500 platform to obtain 100 nt paired-end reads. The demultiplexed and adapter removed short reads were mapped with START software (version 2.6.1c) to Xenopus tropicalis genome (Ensemble_release_v94). Xenopus tropicalis.JGI_4.2.93.gtf was used for extracting splice junctions to improve accuracy of the mapping. All advanced parameters were using default.

The read counts for each gene/exon were obtained with Feature Counts tool of Subread software (version 1.6.3). The raw fastq data were deposited to the NCBI Short Read Archive (SRA) database with the GEO accession number GSE133220.

2.4. Gene ontology and pathway analysis

To identify significantly represented biological themes and functional groups among the differentially expressed genes, gene ontology (GO) and pathway analyses were performed using the Database for Annotation, Visualization and Integrated Discovery (DAVID) v6.8 program (http://david.abcc.ncifcrf.gov). The orthologs of human gene were used for analysis as described previously to increase the hit count (Nagasawa et al. 2013). The GO analysis was used to identify enriched biological themes using GO terms defined and provided by the Gene Ontology Consortium (http://www.geneontology.org). The ‘biological process’ subontology of GO (GO:BP) refers to a biological objective to which the gene contributes and is widely used to evaluate sets of relationships between genes. The pathway analysis was used to identify candidate gene involved in pathways from the Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway database (http://www.genome.jp/kegg/pathway.html).

2.5. In situ hybridization

A partial cDNA encoding olfm4 or scppa2 was obtained by PCR with primers 5 - CAGCTTCTAATCATTGCTCTGGGG −3 and 5 - CTCAAAGTCAAGCTCTGTGTAGG −3 for olfm4 and 5 - GGAAATCTGGGATCAGGCTTACAC −3 and 5 - ATGTGTTCCTACAGACCTGCAGAC −3 for scppa2, respectively. The procedure for in situ hybridization was done as previously described (Nakajima et al. 2019) except for the following modifications. The Blocking Reagent of the DIG Nucleic Acid Detection kit (MERCK, Darmstadt, Germany) was used as blocking buffer and hybridization buffer. Torula RNA in the hybridization buffer was increased to 50 μg/ml. After hybridization, samples were rinsed with TBS (50 mM Tris, 150 mM NaCl, pH 7.4–7.6)–0.1% Tween–20 prior to washing with washing buffers. BM purple (MERCK) was used for signal detection instead of BCIP/NBT and levamisol was omitted in this step.

3. RESULTS

3.1. Identification of notochord-enriched genes induced during tail resorption

The simplest way to identify the notochord-enriched genes during tail resorption is to compare the notochord between before (stage 60) and after (stage 63) the tail resorption. However, the separation of notochord from whole tail is possible only at the stage 63 (Nakajima et al. 2019). Thus, to identify genes that are upregulated mainly in the notochord during metamorphosis, we used RNA-Seq to carry out two different sets of expression profile comparisons of tail RNA samples. The first set was to compare total tail RNA from wild type tadpoles at stage 63 (wild type stage-63-tail or St63) to total tail RNA from wild type tadpoles at stage 60 (wild type stage-60-tail or St60) (Fig. 1A). As stage 60 is prior to any tail length reduction while stage 63 has about ½ resorbed with the length of the remaining tail approximately equal to the body length, this RNA-Seq analysis would reveal genes regulated during tail resorption (between stages 60 and 63). From RNA-Seq, we obtained 224,914,730 and 280,714,272 total reads at stage 60 and stage 63, respectively. Among them, the properly genome-aligned reads at stage 60 and stage 63 were 212,372,832 and 264,512,494, respectively. Analysis of these reads revealed a total of 8054 genes upregulated by 2-fold or more at stage 63 in the tail (Fig. 1B, Supplemental Table 1).

Fig. 1. Identification of notochord-enriched, metamorphosis-induced genes.

Fig. 1.

Open in a new tab

(A) The Venn diagram representation of the RNA-Seq analyses. The mRNAs from stage-60-tail (St60), stage-63-tail (St63) and stage-63-notochord-removed-tail (St63dNC, i.e., the remaining tail after removing the notochord) are sequenced by RNA-Seq and compared among each other. The lined areas represent the expression of notochord-enriched genes. The shaded areas represent the expression of metamorphosis-induced genes. The lined and shaded area represents that of notochord-enriched, metamorphosis-induced genes.

(B) The Venn diagram showing the result of the comparisons between St63 and St63dNC (solid line) and between St63 and St60 (dashed line) RNA-Seq data. Each sample was prepared from the mixture of 5 (St60), 5 (St63) and 8 (St63dNC) tails, respectively. The numbers of genes with a more than two-fold increase in St63, were indicated.

(C, D) Expression profiles of the 630 notochord-enriched, metamorphosis-induced genes. Each gene is represented by a circle in the graph, as determined by the relative expression levels in the St63 (vertical axis) and St60 (C) or St63dNC (D). The names of the most highly expressed four genes in St63 (arrows) and expression levels of elongation factor 1 alpha 1 (EF1α; [ENSXETG00000001182], white arrowhead) are also showed in figure. The dashed line indicates equal expression level between two samples. mmp9-th; matrix metalloproteinase 9-th [ENSXETG00000033145], scppa2; secretory calcium-binding phosphoprotein acidic 2 [ENSXETG00000000337], mmp13; matrix metalloproteinase 13 [ENSXETG00000022190], olfm4; olfactomedin 4 [ENSXETG00000018715]. Data were the average of three technical replications. FPKM: fragments per kilobase of exon per million reads mapped.

The second RNA-Seq analysis was between total tail RNA (St63 sample) and RNA isolated from the tail of wild type tadpoles at stage 63 after removing the notochord (wild type stage-63-notochord-removed-tail or St63dNC) (Fig. 1A). This comparison would identify genes that are expressed preferentially in the tail notochord (i.e., genes with higher expression in St63 than St63dNC). We obtained 264,275,380 total reads and 248,937,012 properly genome-aligned reads for the St63dNC sample, respectively. Bioinformatics analysis revealed a total of 936 genes expressed at 2-fold or higher levels in St63dNC than in St63 (Fig. 1B, Supplemental Table 2). Among them, 630 genes were also present in genes upregulated between stages 60 and 63 in the tail (Fig. 1B, C, D, Supplemental Table 3) and thus identified as notochord-enriched, metamorphosis-induced genes.

3.2. Distinct regulation of different MMPs genes during tail resorption

When the expression levels of these 630 genes in different samples were plotted based on pairwise comparisons (Fig. 1C, D), four genes stood out in both plots as having not only the highest expression levels in the St63 sample (Fig. 1C) but also being among the most dramatically upregulated in the whole tail between stages 60 and 63 (Fig. 1D). Two of them encode matrix metalloproteinases (MMPs), mmp9-th (matrix metalloproteinase 9-th [ENSXETG00000033145]) and mmp13 (matrix metalloproteinase 13 [ENSXETG00000022190]) (Fig. 1C and D).

MMPs have long been implicated in tissue resorption and cell fate determinations due to their ability to degrade the extracellular matrix (ECM) (Shi et al. 1998; Ishizuya-Oka et al. 2004; Wei and Shi 2005). Tissue resorption involve cell death and degradation of the surround ECM. We and others have previous shown that many MMP genes are upregulated during apoptotic tissues resorption and remodeling (Wang and Brown 1993; Patterton et al. 1995; Ishizuya-Oka et al. 1996; Stolow et al. 1996; Berry et al. 1998; Fu et al. 2006; Fujimoto et al. 2006; Hasebe et al. 2006; Fujimoto et al. 2007; Hasebe et al. 2007b; Fu et al. 2009; Nakajima et al. 2019). Importantly, organ-culture and transgenic studies have provided functional support for the involvement of MMPs during TH-induced apoptosis during Xenopus laevis development and metamorphosis (Su et al. 1997; Ishizuya-Oka et al. 2000; Damjanovski et al. 2001; Amano et al. 2005a; Amano et al. 2005b; Fu et al. 2005; Hasebe et al. 2007a; Mathew et al. 2009). To investigate the possible contribution of MMP gene family to notochord regression, we compared the expression levels of collagenases (mmp1, mmp8, mmp13 and mmp13l) (Fig. 2A), gelatinases (mmp2, mmp9 and mmp9-th) (Fig. 2B), stromelysins (mmp3 and mmp11) (Fig. 2C), membrane-type MMPs (mmp14, mmp15, mmp16, mmp17, mmp24 and mmp25) (Fig. 2D) and other MMPs (mmp7, mmp19, mmp20, mmp21, mmp23b and mmp28) (Fig. 2E) in St60, St63 and St63dNC samples. The expression of all MMPs except mmp21 was upregulated in St63 compared to St60. Almost all but mmp1, mmp17 and mmp21 showed more than two-fold increase in expression in St63 compared to St60. The increase in the expression of mmp9-th, mmp13l and mmp11 was more than 200-fold (886, 422 and 210-fold, respectively). Interestingly, among the MMP genes, only mmp9-th and mmp13 had more than two-fold expression differences in St63 compared to St63dNC, i.e., preferentially expressed in the notochord (Fig. 2). Thus, while essentially all MMP genes are upregulated during tail resorption, consistent with the complete removal of the organ, only two are highly enriched in the notochord, suggesting their specific roles in notochord regression.

Fig. 2. The expression profiles of matrix metalloproteinases (MMPs).

Fig. 2.

Open in a new tab

The expression levels of collagenases (A), gelatinases (B), stromelysins (C), membrane-type MMPs (D), and other MMPs (E) in stage-60-tail (St60), stage-63-tail (St63) and stage-63-notochord-removed-tail (St63dNC) were obtained from RNA-Seq data by using ENSEMBL database except for mmp7. The data for mmp7 was obtained from the same RNA-Seq data by using NCBI database because there is no accession number for mmp7 in ENSEMBL. The fold differences between St63 and St60 or St63dNC were indicated in figures. Samples were same as Fig. 1. Data were mean ± SD of three technical replications.

3.3. Characterization of two novel notochord-enriched genes

As indicated above, in addition to the two MMP genes, there were two other genes stood out with the highest expression levels in the St63 sample (Fig. 1C) and among the most dramatically upregulated in the whole tail between stages 60 and 63 (Fig. 1D). They were scppa2 (secretory calcium-binding phosphoprotein acidic 2 [ENSXETG00000000337]), and olfm4 (olfactomedin 4 [ENSXETG00000018715]) (Fig. 1C and D). Of the two, olfm4 is known as the intestinal stem cell marker (van der Flier et al. 2009) and an anti-apoptotic protein in tumor cells (Zhang et al. 2004). It is strongly expressed in the prostate, small intestine, and colon, moderately expressed in the bone marrow and stomach (Zhang et al. 2002). Olfm4 is also known as an extracellular matrix glycoprotein, facilitates cell adhesion, which is mediated by endogenous cell surface lectins and cadherin (Liu et al. 2006). The upregulation of olfm4 in notochord during metamorphosis was thus unexpected. To rule out potential RNA-Seq artifact, for example, alternative splicing using some of exons of olfm4 to produce a different protein, the expression level of every exon of the olfm4 gene was evaluated and found to be identically regulated as the whole olfm4 gene (Fig. 3A, B, E).

Fig. 3. The expression profiles of olfm4 and scppa2.

Fig. 3.

Open in a new tab

(A) The schematic representations of olfm4 gene structure with exons shown as boxes.

(B) The expression levels of each exon of olfm4 from RNA-Seq as analyzed in Fig. 2.

(C) The schematic representations of scppa2 gene structure with exons shown as boxes.

(D) The expression levels of each exon of scppa2 from RNA-Seq as analyzed in Fig. 2.

(E) The expression levels of olfm4 and scppa2 from RNA-Seq as analyzed in Fig. 2.

(F) RT-PCR analysis of the expression levels of olfm4 and scppa2 in St60, St63, St63dNC and notochord (noto-A and noto-B) samples. The expression levels were shown as the copy number normalized against that of EF1α in each sample. The notochord samples were prepared from a mixture of 38 and 15 tadpoles, respectively, by using two different methods as described in previously (Nakajima et al. 2019).

The fold changes between St63 and St60 or St63dNC (B and D-F), and between St63dNC and the average of the two notochord samples (F) were indicated. The samples of St60, St63 and St63dNC were the same as in Fig. 1. Data were mean ± SD of three technical replications.

The last of the 4 most highly expressed genes in St63 sample was Scppa2, one of the secretory calcium-binding phosphoprotein (SCPP) genes. SCPPs are involved in the mineralization of bone, dentin, enameloid, and enamel. Among zebrafish, frog and human, Scppa2 has been identified only in frog and its expression is strong in both osteoblasts surrounding bone and osteocytes embedded in bone (Kawasaki 2009). The expression level of every exon of scppa2 was also analyzed and found to be the same as the scppa2 gene (Fig. 3C, D, E).

To further confirm the regulation of olfm4 and scppa2, we carried out RT-PCR analysis on independent RNA samples and observed similar regulation patterns (Fig. 3F vs. E). More importantly, when the expression in two different preparations of the stage 63 tail notochord (Nakajima et al. 2019) was analyzed, we observed 493- and 64-fold higher expression in the notochord samples compared to the rest of the tail (St63dNC) for olfm4 and scppa2, respectively, supporting the notochord-enriched expression of these two genes as discovered by RNA-Seq. Finally, in situ hybridization showed both were highly expressed in the notochordal tissues at stage 62 (Fig. 4) but at low or non-detectable levels at stage 60 (Supplemental Fig. 1) (note that we did not use the tail at stage 63 for in situ hybridization because the notochord at stage 63 has already shrunk significantly, making it difficult to accurately identify tissue/cell types morphologically (Nakajima et al. 2018; Nakajima et al. 2019)). The olfm4 mRNA was highly restricted to the outer sheath cells while scppa2 mRNA was expressed in outer sheath cells and connective tissue sheath (Fig. 4). These gene expression patterns support notochord-specific role of these two genes during tail resorption.

Fig. 4. Distinct localizations of olfm4 and scppa2 expression in the tail at the climax of metamorphosis.

Fig. 4.

Open in a new tab

Cross sections of the tail at stage 62 were hybridized with sense olfm4 or scppa2 probes (A, A’, C, C’) or their antisense probes (B, B’, D, D’). Dark purple deposits indicate the sites of probe binding. Black pigments in some areas, e.g., spinal cord (SC), are melanin (see A, A’, C, C’). Note that olfm4 mRNA is expressed in the outer sheath cells (OS), but not in the connective tissue sheath (CT). Scppa2 mRNA is expressed in the OS and in the CT surrounding the notochord (NC). These same expression patterns were observed in three individual animals (not shown). Scale bars, 0.5 mm in A-D, 0.1 mm in A’-D’.

3.4. Gene ontology (GO) terms and KEGG pathways enriched among the notochord-enriched, metamorphosis-induced genes

To gain a global picture of the notochord regression, we obtained the human gene IDs for the regulated genes. We were able to obtain human gene IDs for 173 of the 630 notochord-enriched, metamorphosis-induced genes (Supplemental Table 3) and carried out GO and KEGG analyses. A number of ‘biological process’ subontology of GO (GO:BP) terms and KEGG pathways were found to be enriched among the notochord-enriched, metamorphosis-induced genes. These GO:BP terms (Table 1) and KEGG pathways (Table 2) were quite diverse and their involvement in notochord regression remains to be determined. Of interest among them are the two most significantly enriched GO:BP terms: chromatin silencing and nucleosome assembly (Table 1), which likely reflect the requirement of transcriptional regulation of many genes critical for notochord regression. Additionally, the three other highly enriched GO:BP terms: cell adhesion, cytolysis, integrin-mediated signaling pathway (Table 1), are consistent with extensive ECM remodeling and cell death needed for notochord regression. Consistent with this, we also found that the “phagosome” pathway (Fig. 5), which likely important for cell death and tissue resorption, is a highly enriched KEGG pathway (Table 2). Within this pathway, in addition to the notochord-enriched, metamorphosis-induced genes, many other genes were also strongly induced during tail resorption, suggesting the involvement of this pathway in the resorption of other tail tissues as well.

Table 1.

Enriched GO terms among the notochord-specific, metamorphosis-induced genes.

Term Count % P Value
GO:0006342∼chromatin silencing 18 6.766917293 9.61E-21
GO:0006334∼nucleosome assembly 21 7.894736842 1.78E-16
GO:0002227∼innate immune response in mucosa 10 3.759398496 2.55E-11
GO:0019731∼antibacterial humoral response 10 3.759398496 7.04E-09
GO:0007155∼cell adhesion 23 8.646616541 3.99E-07
GO:0050830∼defense response to Gram-positive bacterium 10 3.759398496 2.51E-06
GO:0007565∼female pregnancy 10 3.759398496 3.69E-06
GO:0030449∼regulation of complement activation 5 1.879699248 7.22E-04
GO:0042472∼inner ear morphogenesis 6 2.255639098 7.24E-04
GO:0019373∼epoxygenase P450 pathway 4 1.503759398 0.001799897
GO:0019835∼cytolysis 4 1.503759398 0.002845842
GO:0050776∼regulation of immune response 9 3.383458647 0.003279896
GO:0019532∼oxalate transport 3 1.127819549 0.009549479
GO:1902358∼sulfate transmembrane transport 3 1.127819549 0.01135622
GO:0007229∼integrin-mediated signaling pathway 6 2.255639098 0.011862848
GO:0007218∼neuropeptide signaling pathway 6 2.255639098 0.012853102
GO:0042391∼regulation of membrane potential 5 1.879699248 0.019831109
GO:0006885∼regulation of pH 3 1.127819549 0.019916249
GO:0015701∼bicarbonate transport 4 1.503759398 0.022495598
GO:0010951∼negative regulation of endopeptidase activity 6 2.255639098 0.025939076
GO:0050900∼leukocyte migration 6 2.255639098 0.026755537
GO:0046967∼cytosol to ER transport 2 0.751879699 0.027324667
GO:0015860∼purine nucleoside transmembrane transport 2 0.751879699 0.027324667
GO:0001970∼positive regulation of activation of membrane attack complex 2 0.751879699 0.027324667
GO:0002418∼immune response to tumor cell 2 0.751879699 0.027324667
GO:0019882∼antigen processing and presentation 4 1.503759398 0.039956232
GO:0006837∼serotonin transport 2 0.751879699 0.040706918
GO:1904823∼purine nucleobase transmembrane transport 2 0.751879699 0.040706918
GO:0010866∼regulation of triglyceride biosynthetic process 2 0.751879699 0.040706918
GO:0045916∼negative regulation of complement activation 2 0.751879699 0.040706918
GO:0042335∼cuticle development 2 0.751879699 0.040706918
GO:0015855∼pyrimidine nucleobase transport 2 0.751879699 0.040706918
GO:0072531∼pyrimidine-containing compound transmembrane transport 2 0.751879699 0.040706918
GO:0006958∼complement activation, classical pathway 5 1.879699248 0.047778277
Open in a new tab

Table 2.

Enriched KEGG pathways among the notochord-specific, metamorphosis-induced genes.

KEGG_PATHWAY Count % P Value
hsa05322:Systemic lupus erythematosus 45 16.91729323 4.31E-47
hsa05034:Alcoholism 41 15.41353383 2.56E-35
hsa05203:Viral carcinogenesis 21 7.894736842 1.90E-10
hsa04610:Complement and coagulation cascades 8 3.007518797 1.64E-04
hsa04145:Phagosome 11 4.135338346 2.34E-04
hsa05150:Staphylococcus aureus infection 7 2.631578947 2.96E-04
hsa05140:Leishmaniasis 6 2.255639098 0.007215671
hsa05152:Tuberculosis 9 3.383458647 0.010845419
hsa04976:Bile secretion 5 1.879699248 0.030278342
Open in a new tab

Fig. 5. The up-regulated genes in the phagosome pathway.

Fig. 5.

Open in a new tab

The metamorphosis-induced genes were showed in red and the genes induced specifically in notochord during metamorphosis were showed in purple. There were no genes which were expressed at 2 fold or higher level in the whole tail compared to the notochord-removed tail at stage 63 but not upregulated between stage 60 and 63, i.e., all notochord-enriched genes in this pathway were upregulated during metamorphosis. The genes whose expression was not changed were shown in light green.

4. DISCUSSIONS

Anuran metamorphosis involves coordinated changes in essentially all organs/tissues within a tadpole. Even within a single organ, such as the tail, different tissues need to undergo their individual temporally regulated transformations. We and others have previously shown that knocking out TRα and TRβ individually has distinct effect on tail resorption. In particular, notochord regression is most affected by TRβ knockout. The TRβ knockout tadpoles retain a healthy notochord while other tail tissues are being resorbed in the tail of wild type or TRα-KO animals (Nakajima et al. 2018). This together with fact that TRβ is specifically highly expressed in the notochord compared to TRα (Nakajima et al. 2019) suggests that TRβ specifically regulate genes for notochord regression. Our gene expression analysis here uncovers genes and gene regulation pathways that are likely regulated by TRβ, either directly or indirectly, and critical for notochord regression.

One way to identify TRβ-regulated genes during notochord regression may be to directly compare the expression patterns between wild type and TRβ-knockout notochord. However, this is difficult if not impossible. First, it is problematic to choose tail samples for comparison: whether to compare morphologically identical tails or tadpoles of the same age. As TRβ knockout tadpoles take much longer time to reach stage 63 than wild type tadpoles (Nakajima et al. 2018), animals of the same ages would not be appropriate for comparison as the genes thus identified may be due to stage difference rather than TRβ knockout. If we compare tails of same stage regardless of the age, we may not be able to find most of genes regulated by TRβ. This is because TRβ knockout tadpoles do complete metamorphosis, likely due to compensation by TRα, although complete tail resorption is delayed.

To best way to identify notochord-enriched genes induced during metamorphosis with just wild type animals would be to compare the gene expression in isolated notochord from tail at different stages. Unfortunately, we found that it was impossible to isolate tail notochord without signification contamination of other tissues at stages before tail resorption takes place, e.g., stage 60. In addition, the notochordal RNA is only a tiny fraction of the total tail RNA (Nakajima et al. 2019). Thus, we designed a two-step process to identify notochord-enriched, metamorphosis-induced genes. We first compared wild type stage-63-tail (St63) to wild type stage-60-tail (St60) or wild type stage-63-notochord-removed-tail (St63dNC), and next determine the common genes between the two comparisons. This allowed us to discover 630 genes that are upregulated by at least 2 fold between stage 60 (before tail length reduction) and 63 (the climax of tail resorption) and also highly enriched in the notochord (with a 2 fold or more difference in the mRNA levels of the whole tail vs tail after removing the notochord). (Note that this sample set does not allow us to identify notochord-enriched, down-regulated genes. To do so, we would need the gene expression ratios of St60/St63 and St60/St60dNC (stage 60 tail minus the notochord). Since we could not obtain St60dNC due to the difficulty to separate notochord in stage 60 tail, we could not identify down-regulated genes.)

In a previous study, we demonstrated the notochord-enriched expression of mmp9-th and mmp13 gene during metamorphosis (Nakajima et al. 2019). Consistently, our comprehensive RNA-Seq analysis here showed that those two genes were two of the highest expressed genes among notochord-enriched, metamorphosis-induced genes at stage 63. Interestingly, while the expression of nearly all MMP genes was upregulated during metamorphosis, only these two MMPs are notochord-enriched, suggesting that different MMPs play different roles during tail resorption. Interestingly, the olfm4 mRNA was highly restricted to the outer sheath cells just like mmp13, while scppa2 mRNA was expressed in outer sheath cells and connective tissue sheath, resembling mmp9-th. These distinct gene expression patterns suggest different but notochord-enriched role of these genes during tail resorption. Whether and how these co-expressing genes coordinate to effect notochord regression remain to be determined. It is known that the connective tissue sheath is first chondrified before stage 63 and subsequently degraded (Nieuwkoop and Faber 1965). Given the fact that Scppa2 is one of the secretory calcium-binding phosphoprotein (SCPP) implicated in bone mineralization (Kawasaki 2009) and its expression pattern at stage 60 was similar to the chondrification pattern (Smit 1953) (Supplemental Fig. 1), it might contribute to this changes in the connective tissue sheath. Our results may further suggest that the connective tissue sheath may first have osteoblasts during development similar to mammalian vertebrae but lose them toward the end of metamorphosis.

Our GO:BP and KEGG analyses revealed a number of GO:BP terms and KEGG pathways enriched among the notochord-enriched, metamorphosis-induced genes. While the involvement of many of these GO:BP terms and KEGG pathways require further investigation, the enrichment of the GO:BP terms “nucleosome assembly” and “chromatin silencing” is consistent with the extensive transcriptional regulation. Similarly, the enrichment of the GO:BP terms “cell adhesion”, “cytolysis”, and “integrin-mediated signaling pathway” is likely important for ECM remodeling associated with apoptotic tissue degeneration. Among the enriched KEGG pathways, the presence of the “phagosome” pathway is in agreement with an earlier report that regressing tail of Rana Catesbeiana has macrophages containing autophagic vacuoles (Watanabe and Sasaki 1974). Within this pathway, in addition to the notochord-enriched, metamorphosis-induced genes, many other genes were also strongly induced during tail resorption, suggesting the involvement of this pathway in the resorption of other tail tissues as well. In addition, the enrichment of the “leishmaniasis” pathway is likely related to the “phagosome” pathway (Table 2). This is because leishmaniasis is induced by the parasite of leishmania in macrophage and leishmania is able to regulate phagosome maturation in order to make the phagosome more hospitable for parasite growth and to avoid destruction (Podinovskaia and Descoteaux 2015).

The mechanism of notochord regression in tail during amphibian metamorphosis remains to be determined. Cell death in notochord during tail regression has been reported in Microhyla fissipes, which shares similar gene expression pattern with Xenopus during metamorphosis (Wang et al. 2019). However, the apoptotic signals were observed mainly in outer sheath cells but not of vacuolated cells. The vacuoles are lysosome-related organelles whose formation and maintenance requires late endosomal trafficking regulated by the vacuole-specific Rab32a and H+-ATPase-dependent acidification (Ellis et al. 2013). Our gene expression analysis suggests potential models for notochord regression (Fig. 6). The strong induction of mmp9-th and mmp13 specifically in notochord and enrichment of the GO term “cell adhesion” among the notochord-enriched, metamorphosis-induced genes suggest that the detachment of adhesion of notochordal cells is an important event during notochord shrinkage and apoptosis (Fig. 6, scenario 1). Another scenario may involve olfm4, which is expressed in and released from outer sheath cells. Olfm4 is known to be anti-apoptotic and facilitate cell adhesion (Zhang et al. 2004; Liu et al. 2006) and may mediate attachment among vacuolated cells to induce the shrinkage of notochord (Fig. 6 scenario 2). This scenario is also consistent with the enrichment of the GO term “cell adhesion” among the notochord-enriched, metamorphosis-induced genes. Clearly, these two scenarios are not mutually exclusive and other possible mechanisms may also contribute to notochord regression. Functional studies on notochord-enriched, metamorphosis-induced genes, such as olfm4 and scppa2, and the enriched pathways that we discovered here are required to understand their involvement in notochord regression and test these models. Additionally, it will be interesting to determine if and how these notochord genes are regulated by TRβ by using wild type and TR knockout animals and molecular approaches such ChIP (chromatin immunoprecipitation)-seq analysis with TR antibodies.

Fig. 6. Two potential models for notochord regression.

Fig. 6.

Open in a new tab

MMP13 (13) expressed by outer sheath cells (solid green line) digests the notochordal sheath (solid red line). MMP9-TH (9TH) expressed by outer sheath cells digest the peri-notochordal basement membrane, thereby leading to the detachment of outer sheath cells from notochordal sheath, which in turn causes their apoptosis (dashed green lines). The ECM digestions by MMPs are indicated as yellow marks. Subsequently, two possible scenarios may occur. Scenario 1: The inner vacuolated cells are induced to undergo apoptosis (dashed gray circles) due to the loss of outer sheath cells. The notochord regression is mainly driven by the apoptosis of inner vacuolated cells. Some of inner vacuolated cells may survive, shrink and divide into the nucleus pulposus in intervertebral discs. Scenario 2: Expression of olfm4 (olfm) as an extracellular matrix glycoprotein by the outer sheath cells facilitates the cell adhesion among inner vacuolated cells (purple arrow). They would aggregate, shrink and divide into the nucleus pulposus. The major driving force of notochord regression is the shrinkage of inner vacuolated cells.

Supplementary Material

1
2
3

Highlights.

Identified genes upregulated during tail resorption

Identified genes preferrentially expressed in the tail notochord

Identified notochord-enriched genes upregulated during tail resorption

Characterized two novel, highly expressed, notochord-enriched genes olfm4 and scppa2

Revealed GO terms and KEGG pathways enriched during notochord regression

7. ACKNOWLEDGEMENT

This work was supported in part by the Grant- in-Aid for Scientific Research from the Ministry of Education, Culture, Sports, Science and Technology, Japan (Grant 19K06677 to K.N.) and the intramural Research Program of NICHD, NIH. We thank all members of laboratory for advices and helps, and animal care staff for frog husbandry.

Grant Support: This work was supported in part by the Grant- in-Aid for Scientific Research from the Ministry of Education, Culture, Sports, Science and Technology, Japan (Grant 19K06677 to K.N.) and the intramural Research Program of NICHD, NIH.

Footnotes

6. CONFLICT OF INTEREST STATEMENT

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

8. REFERENCES

  1. Amano T, Fu L, Marshak A, Kwak O, Shi YB. 2005a. Spatio-temporal regulation and cleavage by matrix metalloproteinase stromelysin-3 implicate a role for laminin receptor in intestinal remodeling during Xenopus laevis metamorphosis. Dev Dyn 234: 190–200. [DOI] [PubMed] [Google Scholar]
  2. Amano T, Kwak O, Fu L, Marshak A, Shi Y-B. 2005b. The matrix metalloproteinase stromelysin-3 cleaves laminin receptor at two distinct sites between the transmembrane domain and laminin binding sequence within the extracellular domain. Cell Research 15: 150–159. [DOI] [PubMed] [Google Scholar]
  3. Aszodi A, Chan D, Hunziker E, Bateman JF, Fassler R. 1998. Collagen II is essential for the removal of the notochord and the formation of intervertebral discs. J Cell Biol 143: 1399–1412. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Berry DL, Schwartzman RA, Brown DD. 1998. The expression pattern of thyroid hormone response genes in the tadpole tail identifies multiple resorption programs. Dev Biol 203: 12–23. [DOI] [PubMed] [Google Scholar]
  5. Buchholz DR, Shi YB. 2018. Dual function model revised by thyroid hormone receptor alpha knockout frogs. Gen Comp Endocrinol 265: 214–218. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Choi J, Ishizuya-Oka A, Buchholz DR. 2017. Growth, development, and intestinal remodeling occurs in the absence of thyroid hormone receptor alpha in tadpoles of Xenopus tropicalis. Endocrinology 158: 1623–1633. [DOI] [PubMed] [Google Scholar]
  7. Choi J, Suzuki KI, Sakuma T, Shewade L, Yamamoto T, Buchholz DR. 2015. Unliganded thyroid hormone receptor alpha regulates developmental timing via gene repression as revealed by gene disruption in Xenopus tropicalis. Endocrinology 156: 735–744. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Corallo D, Trapani V, Bonaldo P. 2015. The notochord: structure and functions. Cell Mol Life Sci 72: 2989–3008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Damjanovski S, Amano T, Li Q, Pei D, Shi Y-B. 2001. Overexpression of Matrix Metalloproteinases Leads to Lethality in Transgenic Xenopus Laevis: Implications for Tissue-Dependent Functions of Matrix Metalloproteinases during Late Embryonic development. Dev Dynamics 221: 37–47. [DOI] [PubMed] [Google Scholar]
  10. Ellis K, Bagwell J, Bagnat M. 2013. Notochord vacuoles are lysosome-related organelles that function in axis and spine morphogenesis. J Cell Biol 200: 667–679. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Fu L, Das B, Mathew S, Shi YB. 2009. Genome-wide identification of Xenopus matrix metalloproteinases: conservation and unique duplications in amphibians. BMC Genomics 10: 81. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Fu L, Ishizuya-Oka A, Buchholz DR, Amano T, Matsuda H, Shi YB. 2005. A causative role of stromelysin-3 in extracellular matrix remodeling and epithelial apoptosis during intestinal metamorphosis in Xenopus laevis. J Biol Chem 280: 27856–27865. [DOI] [PubMed] [Google Scholar]
  13. Fu L, Tomita A, Wang H, Buchholz DR, Shi Y-B. 2006. Transcriptional regulation of the Xenopus laevis stromelysin-3 gene by thyroid hormone is mediated by a DNA element in the first intron. . J Biol Chem 281: 16870–16878. [DOI] [PubMed] [Google Scholar]
  14. Fujimoto K, Nakajima K, Yaoita Y. 2006. One of the duplicated matrix metalloproteinase-9 genes is expressed in regressing tail during anuran metamorphosis. Develop Growth Differ 48: 223–241. [DOI] [PubMed] [Google Scholar]
  15. −. 2007. Expression of matrix metalloproteinase genes in regressing or remodeling organs during amphibian metamorphosis. Develop Growth Differ 49: 131–143. [DOI] [PubMed] [Google Scholar]
  16. Grimaldi A, Buisine N, Miller T, Shi YB, Sachs LM. 2013. Mechanisms of thyroid hormone receptor action during development: lessons from amphibian studies. Biochim Biophys Acta 1830: 3882–3892. [DOI] [PubMed] [Google Scholar]
  17. Hasebe T, Fu L, Amano T, Shi Y-B. 2007a. Evidence for a cooperative role of gelatinase A and membrane type-1 matrix metalloproteinase during Xenopus laevis development. Mechanisms of Development 124: 11–22. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Hasebe T, Hartman R, Matsuda H, Shi YB. 2006. Spatial and temporal expression profiles suggest the involvement of gelatinase A and membrane type 1 matrix metalloproteinase in amphibian metamorphosis. Cell Tissue Res 324: 105–116. [DOI] [PubMed] [Google Scholar]
  19. Hasebe T, Kajita M, Fujimoto K, Yaoita Y, Ishizuya-Oka A. 2007b. Expression profiles of the duplicated matrix metalloproteinase-9 genes suggest their different roles in apoptosis of larval intestinal epithelial cells during Xenopus laevis metamorphosis. Dev Dyn 236: 2338–2345. [DOI] [PubMed] [Google Scholar]
  20. Ishizuya-Oka A, Amano T, Fu L, Shi Y-B. 2004. Regulation of apoptosis by extracellular matrix during postembryonic development in Xenopus laevis in When cells die II: A comprehensive evaluation of apoptosis and programmed cell death (eds. Lockshin RA, Zakeri Z), pp. 123–141. John Wiley & Sons, Inc., New York. [Google Scholar]
  21. Ishizuya-Oka A, Li Q, Amano T, Damjanovski S, Ueda S, Shi Y-B. 2000. Requirement for matrix metalloproteinase stromelysin-3 in cell migration and apoptosis during tissue remodeling in Xenopus laevis. J Cell Biol 150: 1177–1188. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Ishizuya-Oka A, Ueda S, Shi Y-B. 1996. Transient expression of stromelysin-3 mRNA in the amphibian small intestine during metamorphosis. Cell Tissue Res 283: 325–329. [DOI] [PubMed] [Google Scholar]
  23. Kawasaki K 2009. The SCPP gene repertoire in bony vertebrates and graded differences in mineralized tissues. Dev Genes Evol 219: 147–157. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Liu W, Chen L, Zhu J, Rodgers GP. 2006. The glycoprotein hGC-1 binds to cadherin and lectins. Exp Cell Res 312: 1785–1797. [DOI] [PubMed] [Google Scholar]
  25. Mathew S, Fu L, Fiorentino M, Matsuda H, Das B, Shi Y-B. 2009. Differential regulation of cell type specific apoptosis by stromelysin-3: A potential mechanism via the cleavage of the laminin receptor during tail resorption in Xenopus laevis. J Biol Chem 284: 18545–18556. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Nagasawa K, Tanizaki Y, Okui T, Watarai A, Ueda S, Kato T. 2013. Significant modulation of the hepatic proteome induced by exposure to low temperature in Xenopus laevis. Biol Open 2: 1057–1069. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Nakajima K, Fujimoto K, Yaoita Y. 2005. Programmed cell death during amphibian metamorphosis. Semin Cell Dev Biol 16: 271–280. [DOI] [PubMed] [Google Scholar]
  28. Nakajima K, Tazawa I, Shi YB. 2019. A unique role of thyroid hormone receptor beta in regulating notochord resorption during Xenopus metamorphosis. Gen Comp Endocrinol 277: 66–72. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Nakajima K, Tazawa I, Yaoita Y. 2018. Thyroid Hormone Receptor alpha- and beta-Knockout Xenopus tropicalis Tadpoles Reveal Subtype-Specific Roles During Development. Endocrinology 159: 733–743. [DOI] [PubMed] [Google Scholar]
  30. Nieuwkoop PD, Faber J. 1965. Normal table of Xenopus laevis. North Holland Publishing, Amsterdam. [Google Scholar]
  31. Patterton D, Hayes WP, Shi YB. 1995. Transcriptional activation of the matrix metalloproteinase gene stromelysin-3 coincides with thyroid hormone-induced cell death during frog metamorphosis. Dev Biol 167: 252–262. [DOI] [PubMed] [Google Scholar]
  32. Podinovskaia M, Descoteaux A. 2015. Leishmania and the macrophage: a multifaceted interaction. Future Microbiol 10: 111–129. [DOI] [PubMed] [Google Scholar]
  33. Sachs LM. 2015. Unliganded thyroid hormone receptor function: amphibian metamorphosis got TALENs. Endocrinology 156: 409–410. [DOI] [PubMed] [Google Scholar]
  34. Sakane Y, Iida M, Hasebe T, Fujii S, Buchholz DR, Ishizuya-Oka A, Yamamoto T, Suzuki KT. 2018. Functional analysis of thyroid hormone receptor beta in Xenopus tropicalis founders using CRISPR-Cas. Biol Open 7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Shi Y-B. 1999. Amphibian Metamorphosis: From morphology to molecular biology. John Wiley & Sons, Inc., New York. [Google Scholar]
  36. −. 2009. Dual functions of thyroid hormone receptors in vertebrate development: the roles of histone-modifying cofactor complexes. Thyroid 19: 987–999. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Shi Y-B, Li Q, Damjanovski S, Amano T, Ishizuya-Oka A. 1998. Regulation of apoptosis during development: Input from the extracellular matrix. Intern J of Mol Medicine 2: 273–282. [DOI] [PubMed] [Google Scholar]
  38. Smit AL. 1953. The ontogenesis of the vertebral column of Xenopus laevis (Daudin) with special reference to the segmentation of the metotic region of the skull. Annals of the University of Stellenbosch 3: 79–136 [Google Scholar]
  39. Stemple DL. 2005. Structure and function of the notochord: an essential organ for chordate development. Development 132: 2503–2512. [DOI] [PubMed] [Google Scholar]
  40. Stolow MA, Bauzon DD, Li J, Sedgwick T, Liang VC, Sang QA, Shi YB. 1996. Identification and characterization of a novel collagenase in Xenopus laevis: possible roles during frog development. Mol Biol Cell 7: 1471–1483. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Su Y, Shi Y, Stolow M, Shi Y-B. 1997. Thyroid hormone induces apoptosis in primary cell cultures of tadpole intestine: cell type specificity and effects of extracellular matrix. J Cell Biol 139: 1533–1543. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Tata JR. 1993. Gene expression during metamorphosis: an ideal model for post-embryonic development. Bioessays 15: 239–248. [DOI] [PubMed] [Google Scholar]
  43. Tata JR, Kawahara A, Baker BS. 1991. Prolactin inhibits both thyroid hormone-induced morphogenesis and cell death in cultured amphibian larval tissues. Devel Biol 146: 72–80. [DOI] [PubMed] [Google Scholar]
  44. van der Flier LG, Haegebarth A, Stange DE, van de Wetering M, Clevers H. 2009. OLFM4 is a robust marker for stem cells in human intestine and marks a subset of colorectal cancer cells. Gastroenterology 137: 15–17. [DOI] [PubMed] [Google Scholar]
  45. Wang S, Liu L, Liu J, Zhu W, Tanizaki Y, Fu L, Bao L, Shi YB, Jiang J. 2019. Gene Expression Program Underlying Tail Resorption During Thyroid Hormone-Dependent Metamorphosis of the Ornamented Pygmy Frog Microhyla fissipes. Front Endocrinol (Lausanne) 10: 11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Wang Z, Brown DD. 1993. Thyroid hormone-induced gene expression program for amphibian tail resorption. J Biol Chem 268: 16270–16278. [PubMed] [Google Scholar]
  47. Watanabe K, Sasaki F. 1974. Ultrastructural changes in the tail muscles of anuran tadpoles during metamorphosis. Cell Tissue Res 155: 321–336. [DOI] [PubMed] [Google Scholar]
  48. Wei L, Shi Y-B. 2005. Matrix metalloproteinase stromelysin-3 in development and pathogenesis. Histology and histopathology 20: 177–185. [DOI] [PubMed] [Google Scholar]
  49. Wen L, Shi YB. 2015. Unliganded thyroid hormone receptor alpha controls developmental timing in Xenopus tropicalis. Endocrinology 156: 721–734. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. −. 2016. Regulation of growth rate and developmental timing by Xenopus thyroid hormone receptor alpha. Dev Growth Differ 58: 106–115. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Wen L, Shibata Y, Su D, Fu L, Luu N, Shi Y-B. 2017. Thyroid hormone receptor α controls developmental timing and regulates the rate and coordination of tissue specific metamorphosis in Xenopus tropicalis. Endocrinology 158: 1985–1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Yen PM. 2015. Unliganded TRs regulate growth and developmental timing during early embryogenesis: evidence for a dual function mechanism of TR action. Cell Biosci 5: 8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. Zhang J, Liu WL, Tang DC, Chen L, Wang M, Pack SD, Zhuang Z, Rodgers GP. 2002. Identification and characterization of a novel member of olfactomedin-related protein family, hGC-1, expressed during myeloid lineage development. Gene 283: 83–93. [DOI] [PubMed] [Google Scholar]
  54. Zhang X, Huang Q, Yang Z, Li Y, Li CY. 2004. GW112, a novel antiapoptotic protein that promotes tumor growth. Cancer Res 64: 2474–2481. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

1
NIHMS1547251-supplement-1.tif (370KB, tif)
2
NIHMS1547251-supplement-2.tif (2.5MB, tif)
3
NIHMS1547251-supplement-3.pdf (1.5MB, pdf)

RESOURCES