Key resources table.
| Reagent type (species) or resource |
Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Gene (Ambystoma mexicanum) |
Midkine (mk) | |||
| Strain, strain background (Ambystoma mexicanum) |
Axolotl, White (d/d) | Ambystoma Genetic Stock Center (AGSC) (RRID:SCR_006372) |
Cat. #AGSC_1015 | Subadults and juveniles, used for FSF transcriptional analysis and functional experiments |
| Strain, strain background (Ambystoma mexicanum) |
Axolotl, Albino (a/a) |
Ambystoma Genetic Stock Center (AGSC) (RRID:SCR_006372) |
Cat. #AGSC_1025 | Subadults, used only for FSF transcriptional analysis |
| Genetic reagent (Ambystoma mexicanum) | Mknull mutants | This paper | Generated in d/d strain | |
| Cell line (Homo sapiens) |
293T HEK Cells | ATCC (RRID:SCR_001672) |
Cat. #CRL-3216 (RRID:CVCL_0063) |
For validation of MK overexpression construct |
| Antibody | Polyclonal goat anti-tdTomato | LS Bio (RRID:SCR_013414) |
Cat. #LS-C340696 (RRID:AB_2819022) |
WB: 1:200 |
| Antibody | Polyclonal chick anti-GAPDH | Millipore (RRID:SCR_008983) |
Cat. #AB2302 (RRID:AB_10615768) |
WB: 1:2000 |
| Antibody | Polyclonal rabbit anti-midkine (axolotl-specific) | This paper, NEPeptide | IF: 1:500, WB: 1:2000 | |
| Antibody | Monoclonal mouse Anti-WE3 | DSHB (RRID:SCR_013527) |
Cat. #WE3 (RRID:AB_531902) |
IF: 1:10 |
| Antibody | Monoclonal mouse Anti-Beta III Tubulin | Sigma Aldrich (RRID:SCR_008988) |
Cat. #T8578 (RRID:AB_1841228) |
IF: 1:200 |
| Recombinant DNA reagent | pCAG-tdTomato | Pathania et al., 2012 | Addgene: Cat. #83029 | Injected and electroporated at 500 ng/uL |
| Recombinant DNA reagent | pCAG-MK | This paper | Injected and electroporated at 500 ng/uL | |
| Sequenced-based reagent | Custom RNAscope axolotl prrx-1 probe (C1) | This paper | In situ hybridization probe | |
| Sequenced-based reagent | Custom RNAscope axolotl csf1r probe (C1) | This paper | In situ hybridization probe | |
| Sequenced-based reagent | Custom RNAscope axolotl pax7 probe (C1) | This paper | In situ hybridization probe | |
| Sequenced-based reagent | Custom RNAscope axolotl pecam probe (C1) | This paper | In situ hybridization probe | |
| Sequenced-based reagent | Custom RNAscope axolotl midkine probe (C2) | This paper | In situ hybridization probe | |
| Sequenced-based reagent | Custom RNAscope axolotl ptprz probe (C1) | This paper | In situ hybridization probe | |
| Sequenced-based reagent | Custom RNAscope axolotl sdc1 probe (C1) | This paper | In situ hybridization probe | |
| Sequenced-based reagent | Alt-R CRISPR-Cas9 crRNA (mk specific): 5’AAGCCCCCACAACTGCATCC −3’ |
This paper | Midkine specific short guide RNA sequence | |
| Sequenced-based reagent | Alt-R CRISPR-Cas9 tracrRNA | Integrated DNA Technologies (IDT) | Cat. #1072534 | |
| Sequenced-based reagent |
Mk forward genotyping primer: 5’-TTGCTTATTCCTTGTGATCATGC-3’ |
This paper | Genotyping primer | |
| Sequenced-based reagent |
Mk reverse genotyping primer: 5’- GGCACATTATTACACAGAAAGCTC-3’ |
This paper | Genotyping primer | |
| Sequenced-based reagent |
Mk nested PCR forward primer: 5’- tctttccctacacgacgctcttccgatctGAGGTTTGATTGGACCCTGA-3’ |
This paper | Genotyping primer | |
| Sequenced-based reagent |
Mk nested PCR reverse primer: 5’-tggagttcagacgtgtgctcttccgatctGGCACATTATTACACAGAAAGCTC-3’ |
This paper | Genotyping primer | |
| Peptide, recombinant protein | Axolotl Midkine blocking peptide (amino acids 126 to 142) | This paper, NEPeptide | Used to validate custom polyclonal axolotl MK antibody | |
| Chemical compound, drug | iMDK (Midkine inhibitor) | Tocris Bio (RRID:SCR_003689) |
Cat. #5126 | Used at 10 uM |
| Chemical compound, drug | EdU | Thermofisher Scientific (RRID:SCR_008452) |
Cat. #A10044 | Used at 8 mg/mL concentration |
| Commercial assay or kit | In Situ Cell Death Detection Kit, TMR Red | Roche (RRID:SCR_001326) |
Cat. #12156792910 | |
| Commercial assay or kit | In Situ Cell Death Detection Kit, Fluorescein | Roche (RRID:SCR_001326) |
Cat. #11684795910 |
|
| Commercial assay or kit | Click-iT EdU Cell Proliferation Kit for Imaging | Thermofisher Scientific (RRID:SCR_008452) |
Cat. #C10337 | |
| Commercial assay or kit | α-Naphthyl Acetate Esterase (NSE) Kit | Sigma Aldrich (RRID:SCR_008988) |
Cat. #91A | |
| Commercial assay or kit | RNAScope 2.5 HD Duplex Assay | ACD Bio | Cat. #322430 | |
| Commercial assay or kit | Miseq Reagent Nano Kit v2 (300-cycle) | Illumina (RRID:SCR_010233) |
Cat. #MS-102–2002 | |
| Commercial assay or kit | Illumina Nextera XT DNA Library Prep Kit | Illumina (RRID:SCR_010233) |
Cat. #FC-131–1024 | |
| Commercial assay or kit | Ovation RNA-seq System V2 | Integrated Sciences | Cat. #7102–32 | |
| Commercial assay or kit | PrepX ILM 32i DNA Library Prep Kit | Takara Bio | Cat. #400076 | |
| Software, algorithm | Trinity | Grabherr et al., 2011 | https://github.com/trinityrnaseq/trinityrnaseq/wiki | |
| Software, algorithm | Kallisto | Bray et al., 2016 | https://pachterlab.github.io/kallisto/ | |
| Software, algorithm | Trimmomatic | Bolger et al., 2014 | http://www.usadellab.org/cms/?page=trimmomatic | |
| Software, algorithm | DESeq2 | Love et al., 2014 | https://bioconductor.org/packages/release/bioc/html/DESeq2.html | |
| Software, algorithm | WEB Gestalt | Wang et al., 2017 | http://www.webgestalt.org/ | |
| Software, algorithm | CRISPResso | Pinello et al., 2016 | http://crispresso.pinellolab.partners.org/ | |
| Software, algorithm | Complex Heatmaps | Gu et al., 2016 | https://bioconductor.org/packages/release/bioc/html/ComplexHeatmap.html | |
| Software, algorithm | ImageJ | Schindelin et al., 2012 | https://imagej.net/Fiji |