Abstract
As the most common type of cancer in female patients, the morbidity and mortality rates of breast cancer (BC) are high, and its incidence is gradually increasing worldwide. However, the underlying molecular and genetic mechanisms involved in the etiopathogenesis of BC remain unclear. Circular RNAs (circRNAs) are a novel type of non-coding RNAs that have been verified to serve a crucial role in tumorigenesis. However, the majority of functions and mechanisms of circRNAs remain unknown. The present study identified 47 differentially expressed circRNAs in a dataset from Gene Expression Omnibus. Using the cancer-specific circRNA database, the potential microRNA (miRNA) response elements, RNA-binding proteins and open reading frames of the candidate circRNAs were predicted. Combing the predictions of miRNAs and target mRNAs, a competing endogenous RNA network was constructed, which may serve as the theoretical basis for further research. Furthermore, the analyses conducted using Gene Ontology terms and Kyoto Encyclopedia of Genes and Genomes pathways indicated that candidate circRNAs may serve a role in transcriptional regulation. Moreover, 20 BC tissue specimens and their paired adjacent normal tissue specimens were used to evaluate the expression levels of the screened circRNAs. Thus, the analyses of the raw microarray data conducted in the present study offer perspectives on the exploration of mechanisms associated with BC tumorigenesis with regard to the circRNA-miRNA-mRNA network.
Keywords: bioinformatics, Gene Expression Omnibus, breast cancer, circular RNA, microarray, microRNA, non-coding RNA, tumorigenesis
Introduction
Breast cancer (BC) is the most frequent type of cancer in female patients, with high morbidity and mortality rates worldwide. It has been estimated that there will be 27,1270 new cases of BC and 42,260 deaths associated with BC in the USA in 2019 (1). Previous epidemiological studies have reported that obesity (2), utilization of estrogen and progestin (3), advanced maternal age at first birth (4) and alcohol abuse (5) increase the risk of developing BC. In addition, genetic mutations and epigenetic modifications are regarded as potential causes of tumorigenesis in BC (6,7). In the past decades, there has been considerable progress in preventing, diagnosing and treating BC. However, the prognosis for BC remains poor. In consequence, understanding the molecular and genetic mechanisms associated with the pathogenesis of BC is essential.
Circular RNAs (circRNAs), a new type of 3′-5′ head-to-tail covalently closed non-coding RNA, were identified in 1976 (8,9). However, in subsequent decades, circRNAs were considered to be the product of incorrect splicing (10). Recently, it was recognized that circRNAs are normal co-products of numerous eukaryotic protein-coding genes. Furthermore, circRNAs have extensive functions, including: i) Sponging microRNAs (miRNAs/miRs), thus inhibiting the expression of target genes (11); ii) binding to proteins in order to form a complex and consequently serving a role in transcription (12); iii) post-transcriptional regulation via a variety of mechanisms (13); and iv) translational functions involving the modification of the internal ribosome entry site or N6-methyladenosine (14,15). However, the majority of functions and mechanisms of circRNAs remain unknown, which suggests that circRNAs may be a promising avenue to explore in medical research (16).
miRNAs are a type of non-coding RNAs with a length of ~22 nucleotides (17). miRNAs perform a repressive function on the expression of their target genes through miRNA response elements (MREs), which exist in their target RNA transcripts (18). Previous studies have demonstrated that circRNAs sponge miRNAs via MREs in numerous diseases. This mechanism has also been reported in cancer initiation and progression (19). Accumulating evidence has demonstrated that circRNAs regulate the growth, development and metastasis of BC by acting as miRNA sponges. For instance, ciRS-7 sponges miR-7 and inhibits the expression of its target gene in numerous tumors (20). In addition, circHIPK3 may function as a miR-124 sponge and inhibit its antineoplastic function, thus inducing the proliferation of BC cells (21). However, further studies are required to explore the potential mechanisms of tumorigenesis, which may aid in the diagnosis and treatment of BC.
The application of microarray technology has enabled the extensive study of gene expression and has facilitated the research of disease susceptibility in favor of treating diseases at the molecular level. Several studies have indicated that microarray technology and in silico analysis have broad application in identifying pathogenetic mechanisms and novel diagnostic and therapeutic targets (22,23).
The present study identified novel circRNAs and revealed their underlying mechanisms in BC via the combined application of in silico analysis and microarray technology. A diagram representing the overall study design is presented in Fig. 1. First, BC-associated microarray datasets from the Gene Expression Omnibus (GEO) database were screened, the bioinformatic data were analyzed and differentially expressed circRNAs (DECs) were obtained. Next, the potential miRNAs sponged by DECs were identified through the cancer-specific circRNA database (CSCD) database. Moreover, a bioinformatics prediction of target mRNAs was performed, and a circRNA-miRNA-mRNA competing endoegenous network was constructed. Gene enrichment analyses of the candidate mRNAs were performed with the Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) databases, which resulted in the prediction of the signaling pathways involved in BC. The identification of DECs and potential mechanisms reported in the present study may facilitate future research in BC treatment and diagnosis.
Figure 1.
Sequence diagram summarizing the present study. BC, breast cancer; MRE, microRNA response element; GO, Gene Ontology; KEGG, Kyoto Encyclopedia of Genes and Genomes; circRNAs, circular RNAs; ceRNA, competing endogenous RNA.
Materials and methods
Screening of DECs in BC from the GEO database
The microarray datasets analyzed in the present study, including the circRNA expression profile in BC, were downloaded from the GEO database [National Center for Biotechnology Information (NCBI); http://www.ncbi.nlm.nih.gov/geo/] (24). The GSE101124 dataset was derived from the GEO database, and contained gene expression data from 15 samples, including 4 breast cancer cell lines, 8 cancerous breast tissues and 3 healthy mammary gland tissue samples (25). The GPL19978 platform (Agilent-069978 Arraystar Human circRNA microarray V1; Agilent Technologies, Inc.) was used to identify the GSE101124 dataset. The raw data were pretreated and homogenized, followed by detection, screening and annotation of circRNAs. The Limma package of R/Bioconductor software (version 3.9) (26) was used for the analysis of raw microarray data and the identification of DECs in the dataset. The following filtering criteria were applied: |logFC|>2 and adjusted P<0.05.
Prediction of miRNAs and competing endogenous (ceRNA) network construction
The CSCD database (http://gb.whu.edu.cn/CSCD) can calculate predictions of MREs, RNA-binding proteins (RBPs) and open reading frames (ORFs) (27). miRNAs sponged to circRNAs were identified from the GSE101124 dataset. Furthermore, potential ORFs in DECs and RBPs combined with DECs were examined. A ceRNA network was constructed to predict the association between miRNAs and the identified DECs or mRNAs. Using the sequences and annotations of miRNAs obtained from miRBase (http://www.mirbase.org/), the mRNA-miRNA interactions were predicted by miRTarbase (28), TargetScan (29) and miRDB (30). Target genes were selected from the overlapping genes for the construction of the ceRNA network.
The ceRNA network was constructed as a graphical representation by Cytoscape software (version 3.6.1) (31) with the miRNA target genes and DECs.
Functional term and signaling pathway enrichment analyses
GO (http://www.geneontology.org) annotates genes to biological process (BP), molecular function (MF) and cellular component (CC) (32). The identification and annotation of homologous genes and protein sequences in various organisms helps to elucidate the specific roles of certain genes.
The KEGG (http://www.genome.jp/kegg/) database consists of 16 main databases and is comprised of disease information organized in computable forms (33). Among these databases, the KEGG pathway database provides molecular networks for molecular systems by annotating genes to pathways (33). The R (version 3.9) package (http://www.bioconductor.org/) clusterProfiler (34) allows gene classification and calculation of enrichment for GO terms and KEGG pathways. In the present study, GO annotation and KEGG pathway analyses were conducted with clusterProfiler to explore the potential biological roles of target genes. The analysis results were visualized with the ggplot2 package of the R software. Adjusted P<0.05 and q<0.05 were considered to indicate statistically significant enriched function annotations.
Patient samples
For the validation of DECs in clinical samples, RNA was extracted from 20 BC tissue specimens and their paired adjacent normal tissue specimens to perform reverse transcription-quantitative polymerase chain reaction (RT-qPCR) analysis. These samples were collected at The Affiliated Hospital of Qingdao University between April 2018 and December 2018. Inclusion criteria of the patients were as follows: i) Age ≥18 years; ii) BC was confirmed via pathological examination; iii) routine blood count, liver and kidney function and electrocardiogram examination met the treatment requirements before operation; and iv) no serious complications prior to surgery. The exclusion criteria were: i) No pathological diagnosis and unknown TNM stage; ii) received chemotherapy or radiotherapy prior to surgery; iii) presence of other tumors; and iv) poor compliance of patients. Tissue specimens located ≥5 cm from the tumor margin were obtained via excision surgery. Patients were all female. The median age of patients was 45 years (range, 30–56). Immediately after obtaining the specimen, tissues were frozen in liquid nitrogen and stored at −80°C for preservation. Ethical approval was obtained from the Ethics Committee of The Affiliated Hospital of Qingdao University. The study participants approved the use of clinical samples by providing written informed consent.
Cell culture
BC cell lines (MCF-7 and MDA-MB-231) and a human normal mammary epithelial cell line (MCF-10A) were obtained from the American Type Culture Collection. MCF-10A cells were used as the control. BC cell lines were cultured in Dulbecco's modified Eagle's medium (DMEM) with 10% FBS (both Gibco; Thermo Fisher Scientific, Inc.). MCF-10A cells were cultured in Roswell Park Memorial Institute (RPMI)-1640 medium (Gibco; Thermo Fisher Scientific, Inc.) supplemented with 10% FBS. All cell lines were used within 6 months and cultured in a 5% CO2 incubator at 37°C. RNA was extracted when the cell confluence reached ~80%. All experiments were repeated in triplicate.
RT-qPCR
TRIzol reagent (Takara Bio, Inc.) was used for the extraction of total RNA from tissues or cells following the manufacturer's protocols. After treatment with DNAse I (Takara Bio, Inc.), reverse transcription of 1 µg total RNA was conducted with reverse transcriptase (RT reagent Kit; cat. no. RR037A, Takara Bio, Inc.).
qPCR was subsequently performed using SYBR Premix Ex Taq (Takara Bio, Inc.) on a CFX96 Real-Time PCR Detection system (Bio-Rad Laboratories, Inc.). The conditions of the amplification reaction procedure were set as follows: Pre-denaturation at 95°C for 30 sec; 95°C for 10 sec; and 60°C for 40 sec for a total of 40 cycles. The expression of circRNAs was normalized to that of internal control GAPDH, using the 2−ΔΔCq method (35). The following primer pairs were used for qPCR: GAPDH forward, 5′-CGCTCTCTGCTCCTCCTGTTC-3′ and reverse, 5′-ATCCGTTGACTCCGACCTTCAC-3′; Homo sapiens (hsa)_circ_0000520 forward, 5′-AGACTAGGGCCAGAGGCG-3′ and reverse, 5′-GAGCTTCCCTCCCCGAAG-3′; hsa_circ_0006220 forward, 5′-ATTCCATTTCACTGCAGGATGTAGC-3′ and reverse, 5′-ACATCCTGCAGTGAAATG-3′; hsa_circ_0000977 forward, 5′-ATGTGGAATAAGAACTCC-3′ and reverse, 5′-AACCTATAAACTTCAGAATGGAATG-3′; and hsa_circ_0043278 forward, 5′-GCATTTCATCAATAACCCTC-3′ and reverse, 5′-TAGTGAAATGGAATGGCTGT-3′. The expression of DECs was normalized to that of GAPDH.
Validation of circRNAs
The expression levels of DECs were verified in clinical samples and cells by RT-qPCR. In addition, to demonstrate the circularized junction of DECs, divergent (circular) primers were designed for the spliced junction of circRNAs and PCR was performed as previously described (36). The cDNA of MCF-7 cells was reverse transcribed (RT reagent Kit, Code No. RR037A, Takara Bio, Inc.), as above. The thermocycling conditions were as follows: Initial denaturation at 95°C for 5 min, and 38 cycles at 95°C for 30 sec, 61°C (annealing temperature) for 30 sec and 72°C for 30 sec, followed by a 7-min extension at 72°C (36). Convergent (linear) primers were used as the control. The spliced junction in the PCR product of DECs was then confirmed by Sanger sequencing (37). Combined with agarose gel electrophoresis, these results validated the existence of circRNAs. The primer sequences used in the present study were synthesized by the Beijing Genomics Institute and are listed in Table I.
Table I.
Divergent and convergent primers used for PCR.
| circRNA ID | Primer type | Sequence (5′-3′) |
|---|---|---|
| hsa_circ_0000520 | Div | F: GGTCTGAGACTAGGGCCAGAGG |
| R: GGAGTGGAGTGACAGGACGCAC | ||
| Con | F: ACGAGCTGAGTGCGTCCTGT | |
| R: AAGCTCAGGGAGAGCCCTGT | ||
| hsa_circ_0006220 | Div | F: CTACCCTGCTGAACCTGAAACA |
| R: TCACACTCCTCCTTGGTCTTGG | ||
| Con | F: GCAGGATGTAGCCAATCAAATGT | |
| R: TTTTTGCTTCCTCTGCTTGTTTC | ||
| hsa_circ_0000977 | Div | F: TTTACTTCCTTGGAGCCAGAGC |
| R: CAAACATTATTCTCCGCAGCAT | ||
| Con | F: GGAACAACCACAGGGCAGGT | |
| R: ATGCTCTGGCTCCAAGGAAGTAA | ||
| hsa_circ_0043278 | Div | F: GAAACAAGCAGAGGAAGCAAAA |
| R: CATTTGATTGGCTACATCCTGC | ||
| Con | F: GCAGGATGTAGCCAATCAAATGT | |
| R: TTTTTGCTTCCTCTGCTTGTTTC |
hsa, Homo sapiens; circRNA, circular RNA; div, divergent; con, convergent; F, forward; R, reverse.
Statistical analysis
Data are presented as the mean ± standard error of the mean of ≥3 independent experiments. For the comparison of two groups, a two-tailed paired Student's t-test was performed. One-way analysis of variance (ANOVA) was used to analyze more than two groups. Dunnett's test was performed as the post hoc test. P<0.05 was considered to indicate a statistically significant difference. All statistical analyses were performed with GraphPad Prism software (version 6; GraphPad Software, Inc.).
Results
Identification of DECs in BC
GEO is an international public database containing high-throughput functional genomic data (24). GEO may be used for searching, analyzing and visualizing data. The present study screened the microarray datasets of BC from the GEO database in NCBI. The retrieval terms used in GEO were as follows: (‘breast’ OR ‘mammary’ OR ‘HBL’) and (‘tumor’ OR ‘cancer’ OR ‘carcinoma’ OR ‘neoplasm’ OR ‘malignant’). ‘Homosapiens’ in the ‘Top Organisms’ and ‘Non-coding RNA profiling by array’ were selected in the ‘Study type’.
circRNA microarray datasets were selected as the subject of analysis. Data consisting only microarray samples of tissues or cells were excluded. As a result, the final search identified GSE101124, which included information from 15 microarray samples of BC cells, and tissues and paired adjacent normal tissues, and was consequently selected for further analaysis. Subsequently, the CSCD was used to identify the DECs in the GSE101124 microarray dataset. Limma, an R/Bioconductor software package, offers an integrated solution for processing large datasets with advanced computational algorithms (26). Pretreatment and homogenization of the raw data was performed with the Llimma package of R software. After filtering the data based on the inclusion criteria (|logFC|>2.0 and adjusted P<0.05), 47 circRNAs were revealed to be differentially expressed between BC and paired adjacent normal tissues. As demonstrated in Table SI, 29 upregulated and 18 downregulated circRNAs were screened out in the GSE101124 dataset. The circRNAs that ranked in the top four according to the |logFC| were hsa_circ_0000520, hsa_circ_0006220, hsa_circ_0000977 and hsa_circ_0043278. The essential characteristics and basic structural patterns of these four circRNAs are presented in Table II and Fig. 2, respectively. Furthermore, a Circos plot (http://circos.ca/) demonstrating DECs in human chromosomes was generated to exhibit the expression of DECs (Fig. 3). The results revealed that the DECs were extensively distributed in all chromosomes, including chromosome X.
Table II.
Essential characteristics of hsa_circ_0000520, hsa_circ_0006220, hsa_circ_0000977 and hsa_circ_0043278.
| circRNA ID | circRNA type | Genomic length, bp | Spliced length, bp | Best transcript | Gene symbol | Type of regulation |
|---|---|---|---|---|---|---|
| hsa_circ_0043278 | Exonic | 2,925 | 250 | NM_001488 | TADA2A | Downregulation |
| hsa_circ_0000977 | Exonic | 24,404 | 562 | NM_024894 | NOL10 | Downregulation |
| hsa_circ_0006220 | Exonic | 158 | 158 | NM_001488 | TADA2A | Downregulation |
| hsa_circ_0000520 | Exonic | 123 | 123 | NR_002312 | RPPH1 | Upregulation |
circRNA, circular RNA; TADA2A, transcriptional adaptor 2A; NOL10, nucleolar protein 10; RPPH1, ribonuclease P RNA component H1.
Figure 2.
Structural patterns of DECs. The essential characteristics and basic structural patterns of four DECs were analyzed by the cancer-specific circRNA database: (A) hsa_circ_0000520, (B) hsa_circ_0006220, (C) hsa_circ_0000977 and (D) hsa_circ_0043278. DECs, differentially expressed circRNAs; circRNA, circular RNA; hsa, Homo sapiens; MRE, miRNA response element; RBP, RNA binding protein; ORF, open reading frame.
Figure 3.
General expression characteristics of DECs. Circos plot displaying DECs in human chromosomes. The outermost layer corresponds to the chromosome map of the human genome; black and white bars represent chromosomal cytobands and red bars represent centromeres. The top 29 upregulated and top 18 downregulated DECs are displayed in the inner layer according to their chromosome locations. All DECs in every chromosome are clustered in the third circle. DECs, differentially expressed circular RNAs; circRNAs, circular RNAs.
Prediction of a circRNA-miRNA-mRNA network
RNA transcripts with the same MREs can competitively sponge miRNAs and subsequently inhibit their downstream functions (38). circRNAs are able to participate in miRNA-mediated post-transcriptional regulation by sponging miRNAs (36).
circRNAs are emerging as essential modulators of ceRNA networks (39). For example, circGFRA1 may sponge miR-34a to serve its regulatory role in triple-negative BC (TNBC) (40). Furthermore, circEPSTI1 may affect the proliferation and apoptosis of TNBC cells by sponging miR-4753 and miR-6809 (41). The next step in the present study was to explore whether the identified DECs acted as miRNA sponges.
CSCD supports the prediction of MREs, RBPs and ORFs for circRNAs (27). The predictions are integrated from TargetScan (29), starBase (http://starbase.sysu.edu.cn/index.php) and ORFfinder (https://indra.mullins.microbiol.washington.edu/sms2/orf_find.html) making CSCD the first comprehensive database specific for cancer-associated circRNAs. This database serves a vital role in the research of the mechanism of action of these molecules. The present study predicted the MREs, RBPs and ORFs of DECs using CSCD (Tables SII–SIV). Moreover, the target genes of miRNAs were predicted and a ceRNA network was constructed to describe the overall functions of DECs. The predicted target genes are demonstrated in Tables SV–SVIII. The specific mRNAs that bound the target miRNAs were identified using miRTarBase, TargetScan and miRDB. The regulatory network was constructed by Cytoscape and consists of DECs, miRNAs and mRNAs (Fig. 4).
Figure 4.
ceRNA network constructed by Cytoscape. The ceRNA network was constructed as a graphical representation with Cytoscape software. The red triangles represent the potential microRNAs sponged to DECs. The green circles represent the target mRNAs. hsa, Homo sapiens; circ, circular RNA; ceRNA, competing endogenous RNA.
GO annotation and KEGG pathway analysis
In cases where the functional role of the aforementioned DECs has not yet been determined, the roles of mRNAs have been explored to understand the circRNAs. In particular, GO functional term and KEGG pathway enrichment analyses of significantly differentially expressed mRNAs facilitate the understanding of circRNAs (42).
The clusterProfiler software of the R package was used in the present study in order to perform the GO analysis of target genes of the identified DECs. The results for the four aforementioned circRNAs are presented in Fig. 5. For hsa_circ_0000520, the most enriched GO term for target genes in BP was ‘transcriptional activator activity, RNA polymerase II transcription regulatory region sequence-specific DNA binding’ (Fig. 5A and Table SIX). For hsa_circ_0006220, the most enriched GO term in BP for target genes was ‘proximal promoter sequence-specific DNA binding’ (Fig. 5B and Table SX). For hsa_circ_0000977 and hsa_circ_0043278, the most enriched GO term for target genes in BP was ‘transcription factor activity, RNA polymerase II proximal promoter sequence-specific DNA binding’ (Fig. 5C and D; Tables SXI and SXII). In summary, GO enrichment analysis revealed the potential regulatory role of circRNAs in transcription. Recently, Ding et al (43) verified that circ-DONSON is capable of activating the transcription of SOX4, a transcription promoter, to promote gastric cancer progression. Thus, the results of the present study suggest the potential use of circRNAs as therapeutic biomarkers for patients with BC.
Figure 5.
GO enrichment annotations for the target mRNAs of the competing endogenous RNA network. GO analysis of (A) hsa_circ_0000520, (B) hsa_circ_0006220 on the basis of the regulatory network. GO analysis was performed with the clusterProfiler package of the R software and visualized with the ggplot2 package of the R software (version 3.9). Adjusted P<0.05 was considered to indicate significantly enriched GO annotations. p.adjust, adjusted P-value; MAP, mitogen-activated protein; UTR, untranslated region; GO, Gene Ontology; circ, circular; hsa, Homo sapiens. GO enrichment annotations for the target mRNAs of the competing endogenous RNA network. GO analysis of (C) hsa_circ_0000977 and (D) hsa_circ_0043278 on the basis of the regulatory network. GO analysis was performed with the clusterProfiler package of the R software and visualized with the ggplot2 package of the R software (version 3.9). Adjusted P<0.05 was considered to indicate significantly enriched GO annotations. p.adjust, adjusted P-value; MAP, mitogen-activated protein; UTR, untranslated region; GO, Gene Ontology; circ, circular; hsa, Homo sapiens.
The present study also performed KEGG pathway analysis (Fig. 6). For hsa_circ_0000520, the main enriched pathways for target genes were ‘endocytosis’ and the ‘cell cycle’ (Fig. 6A). For hsa_circ_0006220, the most enriched pathway for target genes was the ‘PI3K-AKT signaling pathway’ (Fig. 6B). For target genes of hsa_circ_0000977, the ‘MAPK signaling pathway’ was the most enriched pathway (Fig. 6C). For target genes of hsa_circ_0043278, KEGG pathway analysis demonstrated that the main association was with the ‘PI3K-AKT signaling pathway’ and the ‘signaling pathway regulating pluripotency of stem cells’ (Fig. 6D). These results suggested that these DECs may be involved in tumor development.
Figure 6.
KEGG pathway analysis of the target mRNAs of the competing endogenous RNA network. KEGG analysis of (A) hsa_circ_0000520, (B) hsa_circ_0006220, (C) hsa_circ_0000977 and (D) hsa_circ_0043278 on the basis of the regulatory network. KEGG analysis was performed with the clusterProfiler package of the R software and visualized with the ggplot2 package of the R software (version 3.9). Adjusted P<0.05 was considered to indicate significantly enriched KEGG pathways. p.adjust, adjusted P-value; AMPK, AMP-activated protein kinase; MAPK, mitogen-activated protein kinase; KEGG, Kyoto Encyclopedia of Genes and Genomes; circ, circular RNA; TGF-β, transforming growth factor-β; hsa, Homo sapiens.
Validation of candidate circRNAs
The circRNAs (hsa_circ_0000520, hsa_circ_0006220, hsa_circ_0000977 and hsa_circ_0043278) that ranked in the top four according to |logFC| (>2.0) were selected for validation experiments. First, the expression levels of these four DECs were evaluated in 20 BC tissue specimens and their paired adjacent normal tissue specimens. Subsequently, the expression levels of these four DECs were also examined in BC cells (MCF-7 and MDA-MB-231) and a human normal mammary epithelial cell line (MCF-10A). The relative expression of hsa_circ_0000520 was significantly higher in BC than that in the adjacent normal tissues and MCF-10A cells (Fig. 7A and E). The relative expression levels of hsa_circ_0006220, hsa_circ_0000977 and hsa_circ_0043278 were significantly lower in BC than in the adjacent normal tissues and MCF-10A cells (Fig. 7B-E). To validate whether these circRNAs were actually circular transcripts, PCR was performed using divergent and convergent primers specific for spliced junctions of circRNAs. The cDNA and genomic DNA (gDNA) extracted from MCF-7 cells were used as templates. The results revealed that these circRNAs were amplified with the divergent primers on cDNA instead of gDNA. Furthermore, the sequences of the spliced junctions were confirmed by Sanger sequencing (Fig. 8A-D).
Figure 7.
Scatter plots of the expression of DECs. The expression of four DECs in 20 BC tissue specimens and their paired adjacent normal tissue specimens. (A) hsa_circ_0000520, (B) hsa_circ_0006220, (C) hsa_circ_0000977 and (D) hsa_circ_0043278. P<0.001 (n=20). (E) Expression levels of the top four DECs in BC cells (MCF-7 and MDA-MB-231) and in human normal mammary epithelial cells (MCF-10A) were analyzed by RT-qPCR. MCF-10A cells were used as the control. *P<0.05 vs. control. BC, breast cancer; DECs, differentially expressed circRNAs; circRNA, circular RNA; hsa, Homo sapiens; RT-qPCR, reverse transcription-quantitative PCR; ANT, adjacent normal tissue.
Figure 8.
Verification of DECs. PCR products were amplified from the cDNA of MCF-7 cells by divergent primers. The genomic DNA did not produce amplification products by divergent primers. Sanger sequencing was used to validate the head-to-tail splicing of DECs. (A) hsa_circ_0000520. (B) hsa_circ_0006220. (C) hsa_circ_0000977. (D) hsa_circ_0043278. DECs, differentially expressed circRNAs; circ, circular; cDNA, complementary DNA; gDNA, genomic DNA; hsa, Homo sapiens.
Discussion
As the most common type of cancer among females, BC has high morbidity and mortality rates, and its incidence is gradually increasing worldwide. A previous study in the USA estimated 27,1270 new cases and 42,260 deaths caused by BC in 2019 (1). The main reasons for morbidity and mortality in patients with BC include cancer cell invasion, migration and metastasis. The mechanisms of tumorigenesis remain unclear due to the complex genetic mutations and epigenetic alterations involved in this process.
The development of effective therapies for patients with BC requires the identification of therapeutic and prognostic targets. Recent studies have focused on the identification of differentially expressed non-coding RNAs, including long non-coding RNAs, miRNAs and circRNAs, by gene chip and high-throughput sequencing (44–46). It is essential to identify early clinical diagnostic markers in order to understand the molecular mechanism underlying, and facilitate the diagnosis of, BC.
As naturally occurring RNAs, circRNAs are a subclass of non-coding RNAs widely expressed in mammalian cells (47). It was recently demonstrated that circRNAs may serve a vital role in the progression of various human cancer types (48–51). For example, circCEP128 promotes bladder cancer progression by sponging miR-145-5p, which inhibits the function of SRY-box transcription factor 11 (48). However, their roles in breast tumorigenesis are not yet well understood. Further research of the molecular mechanisms of circRNAs may provide insight into the diagnosis and treatment of BC.
There are two primary methods of circRNA detection: RNA sequencing (RNA-seq) and high-throughput circRNA microarray. RNA-seq is a common method for genome-wide analysis of circRNAs, though limited by the low reads that cover the specific splicing junction (52). In previous studies, Lan et al (53) investigated circRNA expression profiles via high-throughput RNA-seq in papillary thyroid carcinoma, while Coscujuela et al (45) used RNA-seq to profile and characterize circRNAs in luminal-like BC. Nair et al (44) created a comprehensive workflow termed Circ-Seq based on existing bioinformatics approaches to screen expressed circRNAs in BC subtypes.
For the detection of known circRNAs, high-throughput circRNA microarray assays are able to efficiently target the reported back-splice sites in the samples of interest. Microarray data have been largely examined to identify pathogenetic pathways and therapeutic targets in several diseases, including cancer and autoimmune, fibrotic, neurodegenerative and infectious diseases (22,23,54–59). Presti et al (22) utilized RNA-seq data of 281 and 283 DNA-sequenced glioblastoma multiforme and low-grade glioma patients, respectively, to evaluate the expression levels of migration inhibitory factor (MIF) and related genes in glioma. After screening for differentially expressed genes, a correlation analysis was performed. Moreover, microarray transcriptomic data were used to assess the mean difference in MIF levels between neoadjuvant and non-neoadjuvant therapy. In uveal melanoma (UM), Petralia et al (54) characterized the pathophysiological role of CD47. CD47 expression levels were found to affect the tumor microenvironment, immune capacity and stroma in UM. Microarray datasets were used to identify 64 differentially expressed genes in metastatic UM. These genes, which are associated with the metastatic properties of UM, may be useful for the verification of potential chemotherapeutic methods.
In colorectal cancer (CRC), KCNMA1 has been reported to be downregulated, and assessment of the GSE35834 microarray dataset has suggested that mir-17-5p may be a target for KCNMA1. Therefore, KCNMA1 has been indicated as a therapeutic target in the early stages of CRC (60). For the study of multiple sclerosis (MS), Fagone et al (23) utilized microarray dataset analysis to obtain 45 genes that were differentially expressed between low and high responder CD4+ T cells. The identification of a specific gene signature for natalizumab responsiveness may provide a theoretical basis for suitable treatments for patients with MS, indicating the potential of microarray dataset analysis in improving the understanding of multiple disease types. Fagone et al (57) analyzed 254 upregulated genes in activated hepatic stellate cells by screening microarray datasets in order to investigate liver fibrosis. Regarding BC, a recent study systematically identified DECs by circRNA microarray, and identified the hsa_circ0087378/miR-1260b/secreted frizzled-related protein 1 axis as a potential regulatory mechanism in estrogen receptor-positive BC (61).
In the present study, circRNA microarray was utilized to construct a general expression profile of BC. Specific circRNAs were analyzed, and a ceRNA network was constructed with the aim of exploring the potential mechanisms of these circRNAs as diagnostic biomarkers.
First, the GSE101124 dataset from the GEO database was screened and 47 DECs were detected using Limma. Among them, hsa_circ_0000520 was found to be upregulated, whereas hsa_circ_0006220, hsa_circ_0000977 and hsa_circ_0043278 were found to be downregulated. hsa_circ_0000520 was spliced from ribonuclease PRNA component H1 gene, the RNA component of the RNase P ribonucleoprotein, which is an endoribonuclease that assists in the formation of the mature 5′ termini of tRNA sequences by cleaving tRNA precursor molecules (62). hsa_circ_0006220 and hsa_circ_0043278 were found to be encoded by transcriptional adaptor 2A (TADA2A), which encodes proteins as a transcriptional activator adaptor and as part of the PCAF (human Gcn5 homologue) histone acetylase complex (63). circTADA2A, also known as hsa_circ_0043278, has been demonstrated to serve a role in promoting osteosarcoma progression and metastasis by sponging miR-203a-3p (64). hsa_circ_0000977 was derived from the nucleolar protein 10 (NOL10) gene. Bammert et al (65) hypothesized that NOL10 formed a salt-stable protein complex in conjunction with neuroguidin (NGDN) and apoptosis-antagonizing transcription factor (AATF/Che-1/TRB) and demonstrated that the AATF-NGDN-NOL10 complex is involved in ribosome biogenesis. In the present study, the presence and expression level of the four circRNAs were validated in both 20 BC tissues and their paired adjacent normal tissues, using qPCR and RT-qPCR, respectively. hsa_circ_000052 was upregulated in BC, whereas hsa_circ_0006220, hsa_circ_0000977 and hsa_circ_0043278 were downregulated. Back-splicing in the RT-qPCR products of hsa_circ_000052, hsa_circ_0006220, hsa_circ_0000977 and hsa_circ_0043278 was confirmed by Sanger sequencing.
circRNAs have been demonstrated to serve a vital role in cancer cell proliferation (66), migration and invasion (67), anchorage-independent cell growth (68) and cell cycle progression (69). It has been reported that exonic circRNAs are involved in miRNA or protein sponging and are able to inhibit their functional activities in the cytoplasm (70). hsa_circ_0000520, hsa_circ_0006220, hsa_circ_0000977 and hsa_circ_0043278 were both cyclized from exons. To identify whether the identified circRNAs act as miRNA sponges, the bioinformatics database CSCD was employed to analyze the presence of potential miRNA binding sites. In addition, CSCD can also be used for the prediction of RBPs and ORFs for circRNAs. hsa_circ_0000977 and hsa_circ_0043278 were revealed to have ORFs, which implies that these circRNAs may be translated. The results demonstrated that hsa_circ_0000520 has 87 potential MREs, hsa_circ_0006220 has 56 potential MREs, hsa_circ_0000977 has 37 potential MREs and hsa_circ_0043278 has 68 potential MREs. To elucidate the molecular mechanism behind the functions of miRNAs, their hypothetical target genes were analyzed using TargetScan, miRDB and miRTarBase. The results of the analysis were used to construct the ceRNA network.
Currently, there is no direct method of predicting the function of circRNAs. However, the functions of mRNAs in the ceRNA network may be analyzed to identify the potential mechanisms of circRNAs. GO, as a bioinformatics tool, consists of three separate ontologies: BP, MF and CC. The clusterProfiler software of the R package was used to perform GO analysis, and the results demonstrated that the four circRNAs may function as transcriptional regulatory factors. For example, the most enriched GO term for hsa_circ_0000520 in BP was ‘transcriptional activator activity, RNA polymerase II transcription regulatory region sequence-specific DNA binding’. Ding et al (43) reported that circDONSON recruited the nucleosome remodeling factor complex to the SOX4 promoter and initiated its transcription in gastric cancer. Huang et al (71) confirmed that circNfix, as a super enhancer-associated circRNA, may be the key regulator of cardiac regeneration. The results of the GO analysis in the present study provided information on the mechanism of circRNA regulation in BC tumorigenesis.
KEGG analysis revealed that the aforementioned DECs were related to tumor-associated pathways. For hsa_circ_0000520, the main enriched pathways were ‘endocytosis’ and the ‘cell cycle’. Cell cycle arrest results in decreased cell proliferation and increased cell apoptosis. For example, upregulation of circRNA-BARD1 has been identified to inhibit BC cell proliferation, lead to cell cycle arrest and stimulate apoptosis (72). For hsa_circ_0006220, the most enriched pathway was the ‘PI3K-AKT signaling pathway’. The PI3K-AKT pathway is a ubiquitous signaling pathway that triggers a series of responses, including cell survival, growth and proliferation (73). Imbalance in the components of this pathway may cause cells to proliferate abnormally, which may facilitate tumor formation and progression (74). Recently, Zhen et al (75) revealed that circHMGCS1 serves an important role in hepatoblastoma cell proliferation by regulating IGF2 and IGF1R expression and upregulating the downstream effectors of the PI3K-AKT signaling pathway. Regarding hsa_circ_0000977, the ‘MAPK signaling pathway’ was observed as the most enriched pathway. Once activated, mitogen-activated protein kinases (MAPKs) phosphorylate other protein kinases and numerous transcription factors in various cellular processes, including cell survival, differentiation, proliferation and migration (76). A previous study has reported that the circSETD3/miR-421/MAPK14 signaling axis prevents the proliferation of hepatocellular carcinoma (77). KEGG pathway analysis demonstrated that hsa_circ_0043278 was mainly associated with the ‘PI3K-AKT signaling pathway’ and ‘signaling pathways regulating pluripotency of stem cells’. One study demonstrated that the combined inhibition of PI3K/Akt/mTOR and sonic hedgehog pathways modulates the activity of pluripotency promoting factors and inhibits the survival, self-renewal and tumorigenic potential of glioblastoma-initiating cells (78).
However, there are various limitations in the present study due to the small sample size of the dataset employed. In the future, integrated analysis of additional datasets may reduce the likelihood of false-positives. In addition, the DECs identified in the present study should be verified in a larger number of clinical samples and other experiments should be conducted, including in vivo studies and western blotting. The present study provides a theoretical basis for the future study of circRNAs-miRNAs-mRNAs in BC.
In conclusion, the present study revealed the expression profiles of specific DECs in BC. Specifically, 47 DECs were identified by circRNA microarray analysis of the GSE101124 dataset. Four specific DECs (hsa_circ_0000520, hsa_circ_0006220, hsa_circ_0000977 and hsa_circ_0043278) were selected for further validation. Following the construction of ceRNA networks and function enrichment analysis, it was concluded that these four circRNAs may serve a role in BC tumorigenesis as transcriptional regulators. In summary, the present study provides further knowledge on the mechanism by which circRNAs may serve as biomarkers in BC.
Supplementary Material
Acknowledgements
The authors would like to thank Mr. Tong Lu and Mr. Yuanyong Wang (Department of Thoracic Surgery, Affiliated Hospital of Qingdao University) for their suggestions on the design of the present study.
Funding
The present study was supported by the National Natural Science Foundation of China (grant no. 81770900) and the Science and Technology Development Foundation of Shandong Province (grant no. 2014GHY115025).
Availability of data and materials
The datasets used and/or analyzed during the current study are available from the corresponding authors on reasonable request.
Authors' contributions
XW contributed to the conception of the present study and completed the draft of the manuscript. All authors participated in the design of the study and conducted the research. YD and WL processed and analyzed the data from the dataset. QW, TL and YW were responsible for the clinical data collection. CL and WX contributed to the experimental design and were responsible for revising the manuscript and approving the version to be published. All authors reviewed all the data and approved the final version of the manuscript.
Ethics approval and consent to participate
The present study was conducted in accordance with the Declaration of Helsinki. The Ethics Committee of the Affiliated Hospital of Qingdao University approved the study. The participants approved the use of clinical samples by providing written informed consent.
Patient consent for publication
Not applicable.
Competing interests
The authors declare that they have no competing interests.
References
- 1.Siegel RL, Miller KD, Jemal A. Cancer statistics, 2019. CA Cancer J Clin. 2019;69:7–34. doi: 10.3322/caac.21551. [DOI] [PubMed] [Google Scholar]
- 2.Guo Y, Warren Andersen S, Shu XO, Michailidou K, Bolla MK, Wang Q, Garcia-Closas M, Milne RL, Schmidt MK, Chang-Claude J, et al. Genetically predicted body mass index and breast cancer risk: Mendelian randomization analyses of data from 145,000 women of european descent. PLoS Med. 2016;13:e1002105. doi: 10.1371/journal.pmed.1002105. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Chlebowski RT, Manson JE, Anderson GL, Cauley JA, Aragaki AK, Stefanick ML, Lane DS, Johnson KC, Wactawski-Wende J, Chen C, et al. Estrogen plus progestin and breast cancer incidence and mortality in the women's health initiative observational study. J Natl Cancer Inst. 2013;105:526–535. doi: 10.1093/jnci/djt043. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Lambertini M, Santoro L, Del Mastro L, Nguyen B, Livraghi L, Ugolini D, Peccatori FA, Azim HA., Jr Reproductive behaviors and risk of developing breast cancer according to tumor subtype: A systematic review and meta-analysis of epidemiological studies. Cancer Treat Rev. 2016;49:65–76. doi: 10.1016/j.ctrv.2016.07.006. [DOI] [PubMed] [Google Scholar]
- 5.Rice MS, Eliassen AH, Hankinson SE, Lenart EB, Willett WC, Tamimi RM. Breast cancer research in the Nurses' health studies: Exposures across the life course. Am J Public Health. 2016;106:1592–1598. doi: 10.2105/AJPH.2016.303325. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Wu L, Shen Y, Peng X, Zhang S, Wang M, Xu G, Zheng X, Wang J, Lu C. Aberrant promoter methylation of cancer-related genes in human breast cancer. Oncol Lett. 2016;12:5145–5155. doi: 10.3892/ol.2016.5351. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Wang SM, Dowhan DH, Muscat G. Epigenetic Arginine Methylation in Breast Cancer: Emerging therapeutic strategies. J Mol Endocrinol. 2019;62:R223–R237. doi: 10.1530/JME-18-0224. [DOI] [PubMed] [Google Scholar]
- 8.Sanger HL, Klotz G, Riesner D, Gross HJ, Kleinschmidt AK. Viroids are single-stranded covalently closed circular RNA molecules existing as highly base-paired rod-like structures. Proc Natl Acad Sci USA. 1976;73:3852–3856. doi: 10.1073/pnas.73.11.3852. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Memczak S, Jens M, Elefsinioti A, Torti F, Krueger J, Rybak A, Maier L, Mackowiak SD, Gregersen LH, Munschauer M, et al. Circular RNAs are a large class of animal RNAs with regulatory potency. Nature. 2013;495:333–338. doi: 10.1038/nature11928. [DOI] [PubMed] [Google Scholar]
- 10.Salzman J. Circular RNA expression: Its potential regulation and function. Trends Genet. 2016;32:309–316. doi: 10.1016/j.tig.2016.03.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Xu H, Guo S, Li W, Yu P. The circular RNA Cdr1as, via miR-7 and its targets, regulates insulin transcription and secretion in islet cells. Sci Rep. 2015;5:12453. doi: 10.1038/srep12453. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Du WW, Yang W, Liu E, Yang Z, Dhaliwal P, Yang BB. Foxo3 circular RNA retards cell cycle progression via forming ternary complexes with p21 and CDK2. Nucleic Acids Res. 2016;44:2846–2858. doi: 10.1093/nar/gkw027. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Li Z, Huang C, Bao C, Chen L, Lin M, Wang X, Zhong G, Yu B, Hu W, Dai L, et al. Exon-intron circular RNAs regulate transcription in the nucleus. Nat Struct Mol Biol. 2015;22:256–264. doi: 10.1038/nsmb.2959. [DOI] [PubMed] [Google Scholar]
- 14.Zhang M, Zhao K, Xu X, Yang Y, Yan S, Wei P, Liu H, Xu J, Xiao F, Zhou H, et al. A peptide encoded by circular form of LINC-PINT suppresses oncogenic transcriptional elongation in glioblastoma. Nat Commun. 2018;9:4475. doi: 10.1038/s41467-018-06862-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Yang Y, Fan X, Mao M, Song X, Wu P, Zhang Y, Jin Y, Yang Y, Chen LL, Wang Y, et al. Extensive translation of circular RNAs driven by N6-methyladenosine. Cell Res. 2017;27:626–641. doi: 10.1038/cr.2017.31. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Shao Y, Li J, Lu R, Li T, Yang Y, Xiao B, Guo J. Global circular RNA expression profile of human gastric cancer and its clinical significance. Cancer Med. 2017;6:1173–1180. doi: 10.1002/cam4.1055. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Salmena L, Poliseno L, Tay Y, Kats L, Pandolfi PP. A ceRNA hypothesis: The Rosetta Stone of a hidden RNA language? Cell. 2011;146:353–358. doi: 10.1016/j.cell.2011.07.014. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Thomas M, Lieberman J, Lal A. Desperately seeking microRNA targets. Nat Struct Mol Biol. 2010;17:1169–1174. doi: 10.1038/nsmb.1921. [DOI] [PubMed] [Google Scholar]
- 19.Swain AC, Mallick B. miRNA-mediated ‘tug-of-war’ model reveals ceRNA propensity of genes in cancers. Mol Oncol. 2018;12:855–868. doi: 10.1002/1878-0261.12198. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Peng L, Yuan XQ, Li GC. The emerging landscape of circular RNA ciRS-7 in cancer (Review) Oncol Rep. 2015;33:2669–2674. doi: 10.3892/or.2015.3904. [DOI] [PubMed] [Google Scholar]
- 21.Zheng Q, Bao C, Guo W, Li S, Chen J, Chen B, Luo Y, Lyu D, Li Y, Shi G, et al. Circular RNA profiling reveals an abundant circHIPK3 that regulates cell growth by sponging multiple miRNAs. Nat Commun. 2016;7:11215. doi: 10.1038/ncomms11215. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Presti M, Mazzon E, Basile MS, Petralia MC, Bramanti A, Colletti G, Bramanti P, Nicoletti F, Fagone P. Overexpression of macrophage migration inhibitory factor and functionally-related genes, D-DT, CD74, CD44, CXCR2 and CXCR4, in glioblastoma. Oncol Lett. 2018;16:2881–2886. doi: 10.3892/ol.2018.8990. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Fagone P, Mazzon E, Mammana S, Di Marco R, Spinasanta F, Basile MS, Petralia MC, Bramanti P, Nicoletti F, Mangano K. Identification of CD4+ T cell biomarkers for predicting the response of patients with relapsing-remitting multiple sclerosis to natalizumab treatment. Mol Med Rep. 2019;20:678–684. doi: 10.3892/mmr.2019.10283. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Barrett T, Wilhite SE, Ledoux P, Evangelista C, Kim IF, Tomashevsky M, Marshall KA, Phillippy KH, Sherman PM, Holko M, et al. NCBI GEO: Archive for functional genomics data sets-update. Nucleic Acids Res. 2013;41:D991–D995. doi: 10.1093/nar/gks1193. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Xu JZ, Shao CC, Wang XJ, Zhao X, Chen JQ, Ouyang YX, Feng J, Zhang F, Huang WH, Ying Q, et al. circTADA2As suppress breast cancer progression and metastasis via targeting miR-203a-3p/SOCS3 axis. Cell Death Dis. 2019;10:175. doi: 10.1038/s41419-019-1382-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Ritchie ME, Phipson B, Wu D, Hu Y, Law CW, Shi W, Smyth GK. limma powers differential expression analyses for RNA-sequencing and microarray studies. Nucleic Acids Res. 2015;43:e47. doi: 10.1093/nar/gkv007. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Xia S, Feng J, Chen K, Ma Y, Gong J, Cai F, Jin Y, Gao Y, Xia L, Chang H, et al. CSCD: A database for cancer-specific circular RNAs. Nucleic Acids Res. 2018;46:D925–D929. doi: 10.1093/nar/gkx863. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Chou CH, Shrestha S, Yang CD, Chang NW, Lin YL, Liao KW, Huang WC, Sun TH, Tu SJ, Lee WH, et al. miRTarBase update 2018: A resource for experimentally validated microRNA-target interactions. Nucleic Acids Res. 2018;46:D296–D302. doi: 10.1093/nar/gkx1067. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Agarwal V, Bell GW, Nam JW, Bartel DP. Predicting effective microRNA target sites in mammalian mRNAs. Elife. 2015;4 doi: 10.7554/eLife.05005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Wong N, Wang X. miRDB: An online resource for microRNA target prediction and functional annotations. Nucleic Acids Res. 2015;43:D146–D152. doi: 10.1093/nar/gku1104. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Su G, Morris JH, Demchak B, Bader GD. Biological network exploration with Cytoscape 3. Curr Protoc Bioinformatics. 2014;47:8.13.1–24. doi: 10.1002/0471250953.bi0813s47. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Ashburner M, Ball CA, Blake JA, Botstein D, Butler H, Cherry JM, Davis AP, Dolinski K, Dwight SS, Eppig JT, et al. Gene ontology: Tool for the unification of biology. The gene ontology consortium. Nat Genet. 2000;25:25–29. doi: 10.1038/75556. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Kanehisa M, Goto S, Furumichi M, Tanabe M, Hirakawa M. KEGG for representation and analysis of molecular networks involving diseases and drugs. Nucleic Acids Res. 2010;38:D355–D360. doi: 10.1093/nar/gkp896. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Yu G, Wang LG, Han Y, He QY. clusterProfiler: An R package for comparing biological themes among gene clusters. OMICS. 2012;16:284–287. doi: 10.1089/omi.2011.0118. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 2001;25:402–408. doi: 10.1006/meth.2001.1262. [DOI] [PubMed] [Google Scholar]
- 36.Li M, Ding W, Tariq MA, Chang W, Zhang X, Xu W, Hou L, Wang Y, Wang J. A circular transcript of ncx1 gene mediates ischemic myocardial injury by targeting miR-133a-3p. Theranostics. 2018;8:5855–5869. doi: 10.7150/thno.27285. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Ludwig NF, Sperb-Ludwig F, Velho RV, Schwartz IV. Next-generation sequencing corroborates a probable de novo GNPTG variation previously detected by Sanger sequencing. Mol Genet Metab Rep. 2017;11:92–93. doi: 10.1016/j.ymgmr.2017.02.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Zhong Y, Du Y, Yang X, Mo Y, Fan C, Xiong F, Ren D, Ye X, Li C, Wang Y, et al. Circular RNAs function as ceRNAs to regulate and control human cancer progression. Mol Cancer. 2018;17:79. doi: 10.1186/s12943-018-0827-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Hansen TB, Jensen TI, Clausen BH, Bramsen JB, Finsen B, Damgaard CK, Kjems J. Natural RNA circles function as efficient microRNA sponges. Nature. 2013;495:384–388. doi: 10.1038/nature11993. [DOI] [PubMed] [Google Scholar]
- 40.He R, Liu P, Xie X, Zhou Y, Liao Q, Xiong W, Li X, Li G, Zeng Z, Tang H. circGFRA1 and GFRA1 act as ceRNAs in triple negative breast cancer by regulating miR-34a. J Exp Clin Cancer Res. 2017;36:145. doi: 10.1186/s13046-017-0614-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Chen B, Wei W, Huang X, Xie X, Kong Y, Dai D, Yang L, Wang J, Tang H, Xie X. circEPSTI1 as a prognostic marker and mediator of triple-negative breast cancer progression. Theranostics. 2018;8:4003–4015. doi: 10.7150/thno.24106. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Yang R, Xing L, Wang M, Chi H, Zhang L, Chen J. Comprehensive analysis of differentially expressed profiles of lncRNAs/mRNAs and miRNAs with associated ceRNA networks in triple-negative breast cancer. Cell Physiol Biochem. 2018;50:473–488. doi: 10.1159/000494162. [DOI] [PubMed] [Google Scholar]
- 43.Ding L, Zhao Y, Dang S, Wang Y, Li X, Yu X, Li Z, Wei J, Liu M, Li G. Circular RNA circ-DONSON facilitates gastric cancer growth and invasion via NURF complex dependent activation of transcription factor SOX4. Mol Cancer. 2019;18:45. doi: 10.1186/s12943-019-1006-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44.Nair AA, Niu N, Tang X, Thompson KJ, Wang L, Kocher JP, Subramanian S, Kalari KR. Circular RNAs and their associations with breast cancer subtypes. Oncotarget. 2016;7:80967–80979. doi: 10.18632/oncotarget.13134. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45.Coscujuela Tarrero L, Ferrero G, Miano V, De Intinis C, Ricci L, Arigoni M, Riccardo F, Annaratone L, Castellano I, Calogero RA, et al. Luminal breast cancer-specific circular RNAs uncovered by a novel tool for data analysis. Oncotarget. 2018;9:14580–14596. doi: 10.18632/oncotarget.24522. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46.Zhang HD, Jiang LH, Hou JC, Zhou SY, Zhong SL, Zhu LP, Wang DD, Yang SJ, He YJ, Mao CF, et al. Circular RNA hsa_circ_0072995 promotes breast cancer cell migration and invasion through sponge for miR-30c-2-3p. Epigenomics. 2018;10:1229–1242. doi: 10.2217/epi-2018-0002. [DOI] [PubMed] [Google Scholar]
- 47.Du WW, Yang W, Chen Y, Wu ZK, Foster FS, Yang Z, Li X, Yang BB. Foxo3 circular RNA promotes cardiac senescence by modulating multiple factors associated with stress and senescence responses. Eur Heart J. 2017;38:1402–1412. doi: 10.1093/eurheartj/ehw001. [DOI] [PubMed] [Google Scholar]
- 48.Wu Z, Huang W, Wang X, Wang T, Chen Y, Chen B, Liu R, Bai P, Xing J. Circular RNA CEP128 acts as a sponge of miR-145-5p in promoting the bladder cancer progression via regulating SOX11. Mol Med. 2018;24:40. doi: 10.1186/s10020-018-0039-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 49.Wei H, Pan L, Tao D, Li R. Circular RNA circZFR contributes to papillary thyroid cancer cell proliferation and invasion by sponging miR-1261 and facilitating C8orf4 expression. Biochem Biophys Res Commun. 2018;503:56–61. doi: 10.1016/j.bbrc.2018.05.174. [DOI] [PubMed] [Google Scholar]
- 50.Wang L, Tong X, Zhou Z, Wang S, Lei Z, Zhang T, Liu Z, Zeng Y, Li C, Zhao J, et al. Circular RNA hsa_circ_0008305 (circPTK2) inhibits TGF-β-induced epithelial-mesenchymal transition and metastasis by controlling TIF1γ in non-small cell lung cancer. Mol Cancer. 2018;17:140. doi: 10.1186/s12943-018-0889-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 51.Qu S, Liu Z, Yang X, Zhou J, Yu H, Zhang R, Li H. The emerging functions and roles of circular RNAs in cancer. Cancer Lett. 2018;414:301–309. doi: 10.1016/j.canlet.2017.11.022. [DOI] [PubMed] [Google Scholar]
- 52.Li S, Teng S, Xu J, Su G, Zhang Y, Zhao J, Zhang S, Wang H, Qin W, Lu ZJ, et al. Microarray is an efficient tool for circRNA profiling. Brief Bioinform. 2019;20:1420–1433. doi: 10.1093/bib/bby006. [DOI] [PubMed] [Google Scholar]
- 53.Lan X, Xu J, Chen C, Zheng C, Wang J, Cao J, Zhu X, Ge M. the landscape of circular RNA expression profiles in papillary thyroid carcinoma based on RNA sequencing. Cell Physiol Biochem. 2018;47:1122–1132. doi: 10.1159/000490188. [DOI] [PubMed] [Google Scholar]
- 54.Petralia MC, Mazzon E, Fagone P, Russo A, Longo A, Avitabile T, Nicoletti F, Reibaldi M, Basile MS. Characterization of the pathophysiological role of CD47 in uveal melanoma. Molecules. 2019;24(pii):E2450. doi: 10.3390/molecules24132450. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 55.Basile MS, Mazzon E, Russo A, Mammana S, Longo A, Bonfiglio V, Fallico M, Caltabiano R, Fagone P, Nicoletti F, et al. Differential modulation and prognostic values of immune-escape genes in uveal melanoma. PLoS One. 2019;14:e0210276. doi: 10.1371/journal.pone.0210276. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 56.Fagone P, Caltabiano R, Russo A, Lupo G, Anfuso CD, Basile MS, Longo A, Nicoletti F, De Pasquale R, Libra M, Reibaldi M. Identification of novel chemotherapeutic strategies for metastatic uveal melanoma. Sci Rep. 2017;7:44564. doi: 10.1038/srep44564. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 57.Fagone P, Mangano K, Mammana S, Pesce A, Pesce A, Caltabiano R, Giorlandino A, Portale TR, Cavalli E, Lombardo GA, et al. Identification of novel targets for the diagnosis and treatment of liver fibrosis. Int J Mol Med. 2015;36:747–752. doi: 10.3892/ijmm.2015.2264. [DOI] [PubMed] [Google Scholar]
- 58.Fagone P, Mazzon E, Cavalli E, Bramanti A, Petralia MC, Mangano K, Al-Abed Y, Bramati P, Nicoletti F. Contribution of the macrophage migration inhibitory factor superfamily of cytokines in the pathogenesis of preclinical and human multiple sclerosis: In silico and in vivo evidences. J Neuroimmunol. 2018;322:46–56. doi: 10.1016/j.jneuroim.2018.06.009. [DOI] [PubMed] [Google Scholar]
- 59.Fagone P, Nunnari G, Lazzara F, Longo A, Cambria D, Distefano G, Palumbo M, Nicoletti F, Malaguarnera L, Di Rosa M. Induction of OAS gene family in HIV monocyte infected patients with high and low viral load. Antiviral Res. 2016;131:66–73. doi: 10.1016/j.antiviral.2016.04.009. [DOI] [PubMed] [Google Scholar]
- 60.Basile MS, Fagone P, Mangano K, Mammana S, Magro G, Salvatorelli L, Li Destri G, La Greca G, Nicoletti F, Puleo S, Pesce A. KCNMA1 expression is downregulated in colorectal cancer via epigenetic mechanisms. Cancers (Basel) 2019;11(pii):E245. doi: 10.3390/cancers11020245. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 61.Yuan C, Zhou L, Zhang L, Yin K, Peng J, Sha R, Zhang S, Xu Y, Sheng X, Wang Y, et al. Identification and integrated analysis of key differentially expressed circular RNAs in ER-positive subtype breast cancer. Epigenomics. 2019;11:297–321. doi: 10.2217/epi-2018-0147. [DOI] [PubMed] [Google Scholar]
- 62.Baer M, Nilsen TW, Costigan C, Altman S. Structure and transcription of a human gene for H1 RNA, the RNA component of human RNase P. Nucleic Acids Res. 1990;18:97–103. doi: 10.1093/nar/18.12.3688. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 63.Barlev NA, Emelyanov AV, Castagnino P, Zegerman P, Bannister AJ, Sepulveda MA, Robert F, Tora L, Kouzarides T, Birshtein BK, Berger SL. A novel human Ada2 homologue functions with Gcn5 or Brg1 to coactivate transcription. Mol Cell Biol. 2003;23:6944–6957. doi: 10.1128/MCB.23.19.6944-6957.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 64.Wu Y, Xie Z, Chen J, Chen J, Ni W, Ma Y, Huang K, Wang G, Wang J, Ma J, et al. Circular RNA circTADA2A promotes osteosarcoma progression and metastasis by sponging miR-203a-3p and regulating CREB3 expression. Mol Cancer. 2019;18:73. doi: 10.1186/s12943-019-1007-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 65.Bammert L, Jonas S, Ungricht R, Kutay U. Human AATF/Che-1 forms a nucleolar protein complex with NGDN and NOL10 required for 40S ribosomal subunit synthesis. Nucleic Acids Res. 2016;44:9803–9820. doi: 10.1093/nar/gkw790. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 66.Zhao F, Han Y, Liu Z, Zhao Z, Li Z, Jia K. circFADS2 regulates lung cancer cells proliferation and invasion via acting as a sponge of miR-498. Biosci Rep. 2018;38(pii):BSR20180570. doi: 10.1042/BSR20180570. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 67.He JH, Li YG, Han ZP, Zhou JB, Chen WM, Lv YB, He ML, Zuo JD, Zheng L. The CircRNA-ACAP2/Hsa-miR-21- 5p/Tiam1 regulatory feedback circuit affects the proliferation, migration, and invasion of colon cancer SW480 cells. Cell Physiol Biochem. 2018;49:1539–1550. doi: 10.1159/000493457. [DOI] [PubMed] [Google Scholar]
- 68.Hsiao KY, Lin YC, Gupta SK, Chang N, Yen L, Sun HS, Tsai SJ. Noncoding effects of circular RNA CCDC66 promote colon cancer growth and metastasis. Cancer Res. 2017;77:2339–2350. doi: 10.1158/0008-5472.CAN-16-1883. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 69.Xue J, Liu Y, Luo F, Lu X, Xu H, Liu X, Lu L, Yang Q, Chen C, Fan W, Liu Q. Circ100284, via miR-217 regulation of EZH2, is involved in the arsenite-accelerated cell cycle of human keratinocytes in carcinogenesis. Biochim Biophys Acta Mol Basis Dis. 2017;1863:753–763. doi: 10.1016/j.bbadis.2016.12.018. [DOI] [PubMed] [Google Scholar]
- 70.Chen LL. The biogenesis and emerging roles of circular RNAs. Nat Rev Mol Cell Biol. 2016;17:205–211. doi: 10.1038/nrm.2015.32. [DOI] [PubMed] [Google Scholar]
- 71.Huang S, Li X, Zheng H, Si X, Li B, Wei G, Li C, Chen Y, Chen Y, Liao W, et al. Loss of super-enhancer-regulated CircRNA Nfix induces cardiac regeneration after myocardial infarction in adult mice. Circulation. 2019;139:2857–2876. doi: 10.1161/CIRCULATIONAHA.118.038361. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 72.Zhao J, Zou H, Han C, Ma J, Zhao J, Tang J. Circlular RNA BARD1 (Hsa_circ_0001098) overexpression in breast cancer cells with TCDD treatment could promote cell apoptosis via miR-3942/BARD1 axis. Cell Cycle. 2018;17:2731–2744. doi: 10.1080/15384101.2018.1556058. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 73.Vivanco I, Sawyers CL. The phosphatidylinositol 3-Kinase AKT pathway in human cancer. Nat Rev Cancer. 2002;2:489–501. doi: 10.1038/nrc839. [DOI] [PubMed] [Google Scholar]
- 74.Mehrian-Shai R, Chen CD, Shi T, Horvath S, Nelson SF, Reichardt JK, Sawyers CL. Insulin growth factor-binding protein 2 is a candidate biomarker for PTEN status and PI3K/Akt pathway activation in glioblastoma and prostate cancer. Proc Natl Acad Sci USA. 2007;104:5563–5568. doi: 10.1073/pnas.0609139104. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 75.Zhen N, Gu S, Ma J, Zhu J, Yin M, Xu M, Wang J, Huang N, Cui Z, Bian Z, et al. CircHMGCS1 promotes hepatoblastoma cell proliferation by regulating the IGF signaling pathway and glutaminolysis. Theranostics. 2019;9:900–919. doi: 10.7150/thno.29515. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 76.Wagner EF, Nebreda AR. Signal integration by JNK and p38 MAPK pathways in cancer development. Nat Rev Cancer. 2009;9:537–549. doi: 10.1038/nrc2694. [DOI] [PubMed] [Google Scholar]
- 77.Xu L, Feng X, Hao X, Wang P, Zhang Y, Zheng X, Li L, Ren S, Zhang M, Xu M. CircSETD3 (Hsa_circ_0000567) acts as a sponge for microRNA-421 inhibiting hepatocellular carcinoma growth. J Exp Clin Cancer Res. 2019;38:98. doi: 10.1186/s13046-019-1041-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 78.Nanta R, Shrivastava A, Sharma J, Shankar S, Srivastava RK. Inhibition of sonic hedgehog and PI3K/Akt/mTOR pathways cooperate in suppressing survival, self-renewal and tumorigenic potential of glioblastoma-initiating cells. Mol Cell Biochem. 2019;454:11–23. doi: 10.1007/s11010-018-3448-z. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
The datasets used and/or analyzed during the current study are available from the corresponding authors on reasonable request.









