Skip to main content
PMC home page
Cell Cycle logoLink to Cell Cycle
. 2019 Dec 27;19(2):246–255. doi: 10.1080/15384101.2019.1708029

Circular RNA circDENND2A protects H9c2 cells from oxygen glucose deprivation-induced apoptosis through sponging microRNA-34a

Yuanxia Shao 1,#, Peng Zhong 1,#, Li Sheng 1,#, Hongjian Zheng 1,✉
PMCID: PMC6961690  PMID: 31878833

ABSTRACT

Background/Aims: Myocardial ischemia (MI) is a serious threat to human health. Circular RNAs (circRNAs) play an important role in many diseases including MI. The effect and mechanism of circDENND2A in MI have not been studied.

Methods: We used oxygen glucose deprivation (OGD) treatment to simulate MI in vitro. We detected circDENND2A and microRNA (miR)-34a levels by RT-qPCR. The transfection process used INTERFER and jetPRIME. Cell growth indexes including viability, apoptosis, and migration were detected by CCK8, flow cytometry, and transwell assays, respectively. In addition, the Bax, Cleaved-Caspase-3, matrix metalloproteinase (MMP)-2, MMP-9 and pathway-related protein levels were tested by Western blot.

Results: OGD upregulated circDENND2A expression in H9c2 cells. Overexpression of circDENND2A enhanced cell viability and migration but declined apoptosis under OGD. Silenced circDENND 2A played the opposite effects. circDENND2A negatively regulated miR-34a. miR-34a overexpression weakened the protective effects of circDENND2A in OGD-injury. Moreover, we considered circDENND2A and miR-34a may work via β-catenin and Ras/Raf/MEK/ERK pathways.

Conclusion: circDENND2A overexpression enhanced OGD-inhibited cell viability and migration but declined OGD-promoted apoptosis by downregulating miR-34a and via β-catenin and Ras/Raf/MEK/ERK pathways.

KEYWORDS: Myocardial ischemia, viability, apoptosis, migration, circDENND2A, miR-34a

Introduction

Myocardial ischemia (MI) is blocked by blood flow to the heart, resulting in insufficiency of blood oxygen, lack of energy and finally abnormal metabolism. This makes the heart in a pathological state that cannot work normally [1]. Some MI injury can lead to insufficient blood supply to the heart, which causes serious hazards to the heart and the whole body [2]. Studies had displayed that the main manifestations in the early stage were myocardial cell apoptosis [3]. Besides, the apoptosis influenced the severity of infarction and prognosis [4]. Moreover, a large number of studies have applied oxygen glucose deprivation (OGD) treatment to construct MI model in vitro [5]. At present, the treatment of MI lesions is very difficult due to the limitations of the application and treatment of drugs. [6]. Moreover, there is still a lack of methods for preventing MI diseases. Therefore, it is still a hot issue in the medical field to seek a safe and reliable method for the prevention and treatment of MI injury.

circular RNAs (circRNAs) are closely related to the occurrence of MI [7]. In recent years, circRNAs have attracted much attention from the scientific community because of its stability and tissue specificity [8]. These noncoding circRNAs play important regulatory roles in cell cycle, development and disease progression [9]. Moreover, its abnormal expression can protect or damage the pathophysiology of many organs [10]. circDENND2A was a newly discovered hypoxic circRNA. circDENND2A was highly expressed in HIF-1α-induced glioma cells and promoted glioma migration and invasion [11]. Currently, there were very few studies on circDENND2A and there were no studies about circDENND2A in MI.

The circRNA-microRNAs (miRNAs)-mRNA axis is closely related to the occurrence of diseases [12]. miRNAs are endogenous non-coding RNAs that can serve as important markers for the diagnosis of a variety of cardiovascular diseases [13]. Studies had displayed that miR-34a is significantly elevated in patients with MI [14] and is closely related to MI and cardiac remodeling [15]. Further evidence proved that miR-34a expression could predict the extent of coronary artery disease [16]. Therefore, miR-34a may be a potential MI predictive target.

The Ras/Raf/MEK/ERK pathway is associated with the occurrence of MI [17]. Almost all cytokine receptors could activate Ras, and then the activated Ras bound to GTP to activate Raf. This phosphorylates the two serine residues of MEK and then activates its unique substrate, ERK1/2 [18]. Activated ERK forms a dimer that is transferred into the nucleus and involved in cell proliferation, survival, differentiation, and apoptosis [19]. Once the pathway is continuously activated, cell proliferation is out of control and apoptosis is blocked. Therefore, the Ras/Raf/MEK/ERK pathway has been an important target for the treatment of diseases.

In this study, we conducted OGD treatment on H9c2 cells to simulate MI injury in vitro. The functions of circDENND2A and miR-34a were examined by observing cell viability, apoptosis, and migration results. In addition, we explored the relationship between circDENND2A and miR-34a and possible molecular mechanisms. The article was a further development of the effect of circDENND2A on diseases, providing a theoretical basis for the prevention and treatment of MI.

Materials and methods

Patient’s sample

We firstly included 25 patients with AMI (14 males, 11 females, aged 56.7–72.3 years) and 25 healthy subjects (13 males, 12 females, aged 52.8–73.6 years), and then tested the expression of circDENND2A in the blood.

Cell culture and treatment

Rat H9c2 cells were from Cell Bank (Shanghai Institutes for Biological Sciences, Shanghai, China) and cultured in Dulbecco’s modified Eagle’s medium (DMEM, Invitrogen, Carlsbad, CA, US). Cells were reached 85%–95% confluences before the experiment. To mimic MI-like conditions, H9c2 cells were cultured at pre-warmed glucose-free balanced salt solution (Invitrogen) for 4 h under 95% N2 and 5% CO2. Next, cells were re-oxygenated for 24 h [20]. The DMEM medium contained 100 units/mL penicillin (Solarbio, Shanghai, China), 100 μg/mL streptomycin (Solarbio) and 10% fetal bovine serum (FBS, Gibco, Grand Island, NY, US).

Cell counting kit-8 (CCK-8)

Cells (1 × 10 [5]/well, 96-well) were cultured for 24 h. CCK-8 (10 µl, Jingxin, Guangzhou, China) were subjected to cells at 37°C for 1 h in the dark. The optical density (OD) was measured by a microplate reader (Bio-Rad, Sunnyvale, CA, US) at 450 nm. Cell viability = (OD value of the experimental group – OD value of the blank group)/(OD value of the control group – OD value of the blank group) × 100%.

Flow cytometry

Cells (1 × 105/well) and FITC-conjugated annexin V kit (Solarbio) were used in this experiment. 1 × phosphate-buffered saline (PBS) washed. PI/FITC-Annexin V stained cells in 50 μg/mL RNase A (Sigma). After that, cells were hatched at 25°C for 1 h in the dark. Results were analyzed by FACS can (BD Biosciences, Franklin Lakes, NJ, US) with CellQuest software (BD Biosciences).

Transfection

miR-34a mimic, the negative controls (NC) mimic, miR-34a inhibitor, NC inhibitor, small interfering (si) RNA of circDENND2A (si-circDENND2A) and non-targeting siRNA (si-NC), as well as the circDENND2A overexpression vector and empty vector were synthesized (GenePharma, Shanghai, China). CircDENND2A or si-circDENND2A was transfected into cultured cells using mediated Lipofectamine 3000 reagent (Invitrogen, Carlsbad, CA). The sequences of miR-34a mimic/NC mimic and miR-34a inhibitor/NC inhibitor were respectively transfected into cultured cells for miR-34a overexpression and knockdown. At 48 h of transfection, the medium was replaced with DMEM:F12 medium containing 10% FBS to stop transfection. Stably transfected cells were selected by G418 medium (Solarbio). The sequences of miR-34a mimic and inhibitor are as follows: miR-34a mimic (sense 5ʹ-UGGCAGUGUCUUAGCUG

GUUGU-3ʹ, antisense 5ʹ-AACCAGCUAAGACACUGCCAUU-3ʹ), miR-34a inhibitor (ACAACCAGCUAAGACACUGCCA).

Luciferase activity assay

We inserted the 3ʹ-untransfected region (UTR) of the point mutant of circDENND2A into the XbaI/FseI site of the pGL3 vector (Promega, Madison, WI, USA) for the QuickChange Site Directed Mutagenesis Kit cloned mutant fluorescein. The enzyme luciferase reporter construct (circDENND2A-mut). The pGL3 vector of wild type 3ʹ-UTR with circDENND2A was named circDENND2A-wild type (circDENND2A-wt). Then, according to the manufacturer’s instructions, we co-transfected circDENND2A-wt or circDENND2A-mut and miR-34a mimics or NC mimics into cells using liposomeamine 3000. Luciferase activity was measured using a dual luciferase assay system (promega) approximately 48 h after transfection.

Reverse transcription quantitative PCR (Rt-qPCR)

Total RNA was extracted from cells by Trizol (Invitrogen). RT-qPCR was performed using the MultiScribeTM RT kit (Applied Biosystem, Foster City, California) and random hexamers or oligo (dT). β-actin was an internal parameter of circRNA and U6 was as an internal parameter of miRNA. Samples were run in triplicate. Data were analyzed by 2−ΔΔCt equation. The sequence information is as follows:

circDENND2A (Forward 5ʹ-TGAACAGAAGACTGTGGACCG-3ʹ, Reverse 5ʹ-CA

GTCTCTAGGAATGGAATGGAGG-3ʹ), β-actin (Forward 5ʹ-ATCATTGCTCCTC

CTGAGCG-3ʹ, Reverse, 5ʹ-ACTCCTGCTTGCTGATCCAC-3ʹ), miR-34a (Forward 5ʹ-ACACTCCAGCTGGG TGGCAGTGTCTTAGCT-3ʹ, Reverse 5ʹ-TGGTGTCGT

GGAGTCG-3ʹ), U6 (Forward 5ʹ-CAAATTCGTGAAGCGTT-3ʹ, Reverse, 5ʹ-TGGT

GTCGTGGAGTCG-3ʹ).

Western blot

Total proteins were extracted from H9c2 cells by cell lysis reagent (Sigma). The protein was quantified by BCA kit (Beyotime, Beijing, China). The samples (10 µg) were run at 15% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). Then, proteins were transferred onto polyvinylidene fluoride (PVDF) membrane (EMD Millipore, Billerica, MA, US). Membranes were blocked in 5% bovine serum albumin (BSA) at 4°C overnight, and then were incubated with primary antibodies at room temperature for 2 h. Next, the membrane was incubated with secondary antibody (Goat Anti-Rabbit IgG H&L, HRP, ab97051, Abcam, Cambridge, MA, US) for 2 h at 25°C. The band signals were captured and quantified by Image Lab™ Software (Bio-Rad).

Primary antibodies (Abcam): Bax (ab53154), pro-Caspase-3 (ab13847), Cleaved-Caspase-3 (ab13847), β-actin (ab179467), matrix metalloproteinase (MMP)-2 (ab86607), MMP-9 (ab38898), β-catenin (ab16051), Ras (ab52939), Raf (ab50858), p-MEK (ab96379), t-MEK (ab32091), p-ERK (ab201015) and t-ERK (ab184699).

Statistical analysis

Results at least run triplicate. Data were reported as mean ± standard deviation (SD) and analyzed by Graphpad6.0 (Graph Pad Software, CA, US). The P-values were performed by one-way analysis of variance (ANOVA) and t test. P < 0.05 was conspicuously significant.

Results

circDENND2A was upregulated in patients with MI and under OGD stimulation

We first detected the level of circDENND2A in MI patients. The expression of circDENND2A revealed that circDENND2A was significantly elevated in MI patients (Figure 1(a), P < 0.01). To detect the effects of circDENND2A on MI in vitro, RT-qPCR was used for detecting the circDENND2A expression under OGD stimulation in H9c2 cells. The result displayed circDENND2A expression was conspicuously enhanced under OGD (Figure 1, P < 0.01), indicating OGD can upregulate circDENND2A expression.

Figure 1.

Figure 1.

Open in a new tab

circDENND2A was upregulated in patients with myocardial ischemia (MI) and under oxygen glucose deprivation (OGD) stimulation.

(a) The expression of circDENND2A was upregulated in patients with AMI. (b) The expression of circDENND2A in H9c2 cells was upregulated by OGD stimulation. **P < 0.01

circDENND2A was overexpressed and silenced in H9c2 cells

In order to further detect the effects of circDENND2A, we respectively overexpressed and silenced circDENND2A. The figure displayed when transfected circDENND2A, circDENND2A expression were meaningfully enhanced (Figure 2(a), P < 0.001) while transfected si-circDENND2A caused circDENND2A expression meaningfully declined (Figure 2(b), P < 0.001).

Figure 2.

Figure 2.

Open in a new tab

circDENND2A were respectively overexpressed and silenced in H9c2 cells.

(a) circDENND2A transfection meaningfully enhanced circDENND2A expression and (b) Small interfering (si)-circDENND2A transfection meaningfully declined circDENND2A expression. ***P < 0.001

circDENND2A regulated cell growth and migration under OGD stimulation

On the basis of Figure 2, the functions of circDENND2A were explored at the level of cellular and molecular in H9c2 cells. In this part, OGD conspicuously declined cell viability, enhanced apoptotic rate and the levels of Bax and Cleaved-Caspase-3 (Figure 3(a-f), P < 0.01 or P < 0.001). Furthermore, the migration assay displayed the number of migration cells and the levels of MMP-2 and MMP-9 were conspicuously declined (Figure 3(g-j), P < 0.01 or P < 0.001). Based on this, the results displayed circDENND2A transfection significantly enhanced cell viability and decreased apoptosis under OGD (Figure 3(a,b), P < 0.01). Meanwhile, si-circDENND2A further declined OGD-induced decline in cell viability (Figure 3(c), P < 0.01) and enhanced OGD-induced rise in cell apoptosis (Figure 3(d), P < 0.05). In molecular levels, circDENND2A declined Bax and Cleaved-Caspase-3 levels (Figure 3(e), P < 0.05 or P < 0.01) while si-circDENND2A enhanced Bax and Cleaved-Caspase-3 levels (Figure 3(f), P < 0.05 or P < 0.01). Moreover, when circDENND2A was transfected into OGD-induced cells, migration cells (Figure 3(g), P < 0.05) and MMP levels (Figure 3(i), both P < 0.01) were meaningfully enhanced. On the contrary, si-circDENND2A caused decline of migration (Figure 3(h), P < 0.05) and MMP levels (Figure 3(j), P < 0.01 or P < 0.001). The above results indicated that circDENND2A could regulate cell growth and migration.

Figure 3.

Figure 3.

Open in a new tab

circDENND2A regulated H9c2 cell growth and migration under oxygen glucose deprivation (OGD) stimulation.

OGD conspicuously declined cell viability and enhanced the apoptotic rate and the levels of Bax and Cleaved-Caspase-3. Moreover, it conspicuously declined migration and the levels of matrix metalloproteinase (MMP)-2 and MMP-9. Based on this above, the results expressed circDENND2A transfection meaningfully enhanced OGD-inhibited (a) cell viability and declined OGD-promoted (b) cell apoptosis. Meanwhile, (c) si-circDENND2A further declined OGD-inhibited cell viability and (d) enhanced OGD-promoted cell apoptosis. (e) circDENND2A declined Bax and Cleaved-Caspase-3 levels while (f) si-circDENND2A enhanced Bax and Cleaved-Caspase-3 levels. Moreover, when circDENND2A was transfected into OGD-induced cells, (g) migration cells and (i) MMP levels were meaningfully enhanced. To the contrary, si-circDENND2A caused decline of (h) migration and (j) MMP levels in OGD-induced cells. *P < 0.05; **P < 0.01; ***P < 0.001

circDENND2A sponged miR-34a

miR-34a levels were meaningfully enhanced with OGD treatment. circDENND2A declined the OGD-induced elevation of miR-34a (Figure 4(a), P < 0.05) and si-circDENND2A further enhanced the OGD-induced rise in miR-34a levels (Figure 4(b), P < 0.01), manifesting circDENND2A negatively regulated miR-34a. We further determined the relationship between miR-34a and circDENND2A by luciferase assay. The results showed that the luciferase activity of circDENND2A-wt was significantly reduced in miR-34a mimic compared to NC mimic, while circDENND2A-mut group did not change significantly (Figure 4(c), P < 0.05).

Figure 4.

Figure 4.

Open in a new tab

circDENND2A sponged miR-34a.

(a-b) miR-34a levels were meaningfully enhanced under oxygen glucose deprivation (OGD) stimulation. circDENND2A declined and si-circDENND2A enhanced the OGD-induced changes in miR-34a levels. (c) The luciferase activity of circDENND2A-wt was significantly reduced in miR-34a mimic compared with NC mimic. *P < 0.05; **P < 0.01; ***P < 0.001

miR-34a overexpression weakened the protective effects of circDENND2A in OGD-induced injury

NC mimic and miR-34a mimic were transfected into H9c2 cells to detect the effects of miR-34a on OGD-injuried H9c2 cells, and results showed that miR-34a expression was markedly enhanced (Figure 5(a), P < 0.001). Next, when the miR-34a mimic was transfected into the cells induced by circDENND2A, the cell viability was decreased (Figure 5(b), P  <  0.05). Cell apoptosis rate (Figure 5(c), P  <  0.05) and levels of Bax and Cleaved-Caspase-3 were meaningfully enhanced (Figure 5(d), both P  <  0.05). Besides, the migration cells (Figure 5(e), P  <  0.05) and levels of MMP-2 and MMP-9 (Figure 5(f), P  <  0.01 or P  <  0.001) were meaningfully declined. In short, overexpression of circDENND2A reduced OGD-induced injury by downregulating miR-34a.

Figure 5.

Figure 5.

Open in a new tab

Overexpression of circDENND2A reduced oxygen glucose deprivation (OGD) injury by downregulating microRNA (miR)-34a in H9c2 cells.

(a) While miR-34a mimic was transfected into circDENND2A-induced cells, miR-34a expression was markedly enhanced, (b) cell viability was declined. (c) Cell apoptosis rate and (d) levels of Bax and Cleaved-Caspase-3 were meaningfully enhanced (Figure 5d). Besides, (e) the migration cells and (f) levels of matrix metalloproteinase (MMP)-2 and MMP-9 were meaningfully declined. *P < 0.05; **P < 0.01; ***P < 0.001

circDENND2A and miR-34a may work via β-catenin and Ras/Raf/MEK/ERK pathways

The effects of circDENND2A on pathways were detected in H9c2 cells by Western blot. The results showed that OGD not only significantly reduced the level of β-catenin (Figure 6(a), P < 0.01), Ras and Raf but also declined the ratios of p/t-MEK and p/t-ERK (Figure 6(b), P < 0.05 or P < 0.001). circDENND2A heightened these expressions (Figure 6(a,b), all P < 0.001). Moreover, miR-34a mimic weakened the circDENND2A-induced expression (Figure 6(a,b), all P < 0.001). The above results displayed overexpression of circDENND2A enhanced β-catenin and Ras/Raf/MEK/ERK pathways by regulating miR-34a.

Figure 6.

Figure 6.

Open in a new tab

Overexpression of circDENND2A enhanced β-catenin and Ras/Raf/MEK/ERK pathways by regulating microRNA (miR)-34a in H9c2 cells.

Oxygen glucose deprivation (OGD) declined (a) the levels of β-catenin, (b) Ras and Raf and ratios of p/t-MEK and p/t-ERK. circDENND2A heightened these OGD-induced expressions. Moreover, miR-34a mimic weakened the circDENND2A-induced expression. *P < 0.05; **P < 0.01; ***P < 0.001

Discussion

MI is an irreversible pathological injury, which seriously threatens health [21]. Our results presented the level of circDENND2A was significantly enhanced under OGD stimulation in H9c2 cells. This was identical to the expression we saw in HIF-1α-induced glioma cells [11]. Further studies proved circDENND2A could enhance cell viability and migration but restrained cell apoptosis. Further, we found circDENND2A sponged miR-34a. miR-34a weakened the protective effect of circDENND2A. Besides, circDENND2A and miR-34a may play a role via β-catenin and Ras/Raf/MEK/ERK pathways.

circRNAs plays an important role in cardiovascular disease. Studies discovered hsa_circ_0003575 enhanced angiogenesis of endothelial cells [22] and circ-Amotl1 could promote cardiac repair [23]. In addition, the literature demonstrated that circ_010567 was involved in myocardial fibrosis [24] and circDLGAP4 attenuated ischemic stroke [25]. Previous studies discovered DENND2A can improve transcriptional activity [26] and related to ischemic stroke and Parkinson’s disease [27]. Recent literature indicated that hypoxia induced the expression of circDENND2A and circDENND2A played a tumor-promoting role in glioma cells [11]. Our results indicated that circDENND2A was upregulated in patients with MI and under OGD stimulation. Besides, our results discovered OGD conspicuously declined cell viability and enhanced apoptotic rate, Bax and Cleaved-Caspase-3 levels. Moreover, it conspicuously declined migration and the levels of MMP-2 and MMP-9. Based on this above, the results expressed that transfected with circDENND2A meaningfully enhanced OGD-induced viability and declined OGD-induced apoptosis. Meanwhile, after transfection of circDENND2A into OGD-induced cells, Bax and Cleaved-Caspase-3 levels were declined while migratory cells and MMP levels were meaningfully enhanced. si-circDENND2A played the opposite functions. This suggested circDENND2A played a protective role in OGD-injury H9c2 cells.

It is worth noting that a considerable number of literatures had confirmed that circRNAs plays a role in MI through miRNAs. Studies discovered circCdr1as exerted its functions by sponging miR-7a in MI [28]. Another study displayed silenced circNCX1 attenuated MI injury by targeting miR-133a-3p [29]. Besides, the literature had also confirmed that circDENND2A worked in cancer through miR-625-5p [11]. In this article, we demonstrated that circDENND2A played a corresponding role by regulating miR-34a, and we discovered that circDENND2A could negatively regulate miR-34a. We further determined the relationship between miR-34a and circDENND2A by luciferase assay. The result indicated that circDENND2A sponged miR-34a.

miR-34a was predicted to be a candidate target gene of DENND2A by the miRNA target gene prediction website (circbase). Therefore, we further studied the role of miR-34a in MI. miR-34a is a miRNA closely related to vascular injury, cell growth and apoptosis [30]. miR-34a was expressed abnormally in a variety of cardiovascular diseases [31]. The studies proved miR-34a was upregulated in aged heart tissues and decreased miR-34a levels in vivo or in vitro could alleviate the aging of cardiomyocytes [32]. Moreover, studies had displayed miR-34a was closely related to MI and the pathophysiological changes of heart tissue after infarction [33]. Moreover, it was reported that miR-34a upregulation aggravated the injury after MI and inhibited miR-34a expression may be a new therapeutic method for MI injury [34]. In this paper, we discovered while miR-34a mimic was transfected into circDENND2A-induced cells, cell viability was declined. Cell apoptosis rate and Bax and Cleaved-Caspase-3 levels were obviously increased. Besides, the migration cells and levels of MMP-2 and MMP-9 were meaningfully declined. This was consistent with previous results, proving miR-34a played a promoting role in MI.

Furthermore, β-catenin and Ras/Raf/MEK/ERK pathways are two momentous signaling pathways in cardiovascular diseases [35,36]. Studies have shown that circRNA_102171 played a relevant role by regulating the β-catenin pathway [37]. Moreover, researchers discovered miR-214 worked in diseases via β-catenin pathways [38] and miR-373 exerted functions in fibrosarcoma via Ras/Raf/MEK/ERK pathway [39]. Not surprisingly, we expressed circDENND2A heightened OGD-induced levels of β-catenin, Ras and Raf and ratios of p/t-MEK and p/t-ERK. Moreover, miR-34a mimic weakened the circDENND2A-induced expression. All these demonstrated circDENND2A and miR-34a may work via β-catenin and Ras/Raf/MEK/ERK pathways.

In conclusion, circDENND2A enhanced OGD-induced cell viability and migration but declined OGD-induced apoptosis by downregulating miR-34a and via β-catenin and Ras/Raf/MEK/ERK pathways. This work may provide a theoretical basis for the prevention and treatment of MI.

Funding Statement

This research did not receive any specific grant from funding agencies in the public, commercial, or not-for-profit sectors.

Authors’ contributions

Conceived and designed the experiments: Hongjian Zheng

Performed the experiments and analyzed the data: Yuanxia Shao, Peng Zhong, Li Sheng

Manuscript writing and revision: Yuanxia Shao, Peng Zhong, Li Sheng, Hongjian Zheng

All authors read and approved the final manuscript.

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Consent for publication

All authors are informed and agree to publish.

Disclosure statement

No potential conflict of interest was reported by the authors.

Ethics approval and consent to participate

Not applicable.

References

  • [1].Levy S. Bundle branch blocks and/or hemiblocks complicating acute myocardial ischemia or infarction. J Interv Card Electrophysiol. 2018;52:287–292. [DOI] [PubMed] [Google Scholar]
  • [2].Taqueti VR, Dorbala S. The role of positron emission tomography in the evaluation of myocardial ischemia in women. J Nucl Cardiol. 2016;23:1008–1015. [DOI] [PubMed] [Google Scholar]
  • [3].Frangogiannis NG. Pathophysiology of myocardial infarction. Compr Physiol. 2015;5:1841–1875. [DOI] [PubMed] [Google Scholar]
  • [4].Biondi-Zoccai GG, Baldi A, Biasucci LM, et al. Female gender, myocardial remodeling and cardiac failure: are women protected from increased myocardiocyte apoptosis? Ital Heart J. 2004;5:498–504. [PubMed] [Google Scholar]
  • [5].Li X, Dai Y, Yan S, et al. Down-regulation of lncRNA KCNQ1OT1 protects against myocardial ischemia/reperfusion injury following acute myocardial infarction. Biochem Biophys Res Commun. 2017;491:1026–1033. [DOI] [PubMed] [Google Scholar]
  • [6].Nordlie MA, Wold LE, Simkhovich BZ, et al. Molecular aspects of ischemic heart disease: ischemia/reperfusion–induced genetic changes and potential applications of gene and RNA interference therapy. J Cardiovasc Pharmacol Ther. 2006;11:17–30. [DOI] [PubMed] [Google Scholar]
  • [7].Zhou LY, Zhai M, Huang Y, et al. The circular RNA ACR attenuates myocardial ischemia/reperfusion injury by suppressing autophagy via modulation of the Pink1/FAM65B pathway. Cell Death Differ. 2019;26:1299–1315. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [8].Greene J, Baird AM, Brady L, et al. Circular RNAs: biogenesis, function and role in human diseases. Front Mol Biosci. 2017;4:38. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [9].Holdt LM, Kohlmaier A, Teupser D. Molecular roles and function of circular RNAs in eukaryotic cells. Cell Mol Life Sci. 2018;75:1071–1098. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [10].Yao J, Dai Q, Liu Z, et al. Circular RNAs in organ fibrosis. Adv Exp Med Biol. 2018;1087:259–273. [DOI] [PubMed] [Google Scholar]
  • [11].Su H, Zou D, Sun Y, et al. Hypoxia-associated circDENND2A promotes glioma aggressiveness by sponging miR-625-5p. Cell Mol Biol Lett. 2019;24:24. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [12].Rong D, Sun H, Li Z, et al. An emerging function of circRNA-miRNAs-mRNA axis in human diseases. Oncotarget. 2017;8:73271–73281. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [13].Arias-Pérez A, Ramírez-Torres D, Rodríguez ME, et al. In silico detection and fish analysis to determine location of mirnas in solea senegalensis chromosomes using BACs. OBM Genetics. 2018;2:1–17. [Google Scholar]
  • [14].Fan F, Sun A, Zhao H, et al. MicroRNA-34a promotes cardiomyocyte apoptosis post myocardial infarction through down-regulating aldehyde dehydrogenase 2. Curr Pharm Des. 2013;19:4865–4873. [DOI] [PubMed] [Google Scholar]
  • [15].Lv P, Zhou M, He J, et al. Circulating miR-208b and miR-34a are associated with left ventricular remodeling after acute myocardial infarction. Int J Mol Sci. 2014;15:5774–5788. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [16].Han H, Qu G, Han C, et al. MiR-34a, miR-21 and miR-23a as potential biomarkers for coronary artery disease: a pilot microarray study and confirmation in a 32 patient cohort. Exp Mol Med. 2015;47:e138. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [17].Chen Y, Ba L, Huang W, et al. Role of carvacrol in cardioprotection against myocardial ischemia/reperfusion injury in rats through activation of MAPK/ERK and Akt/eNOS signaling pathways. Eur J Pharmacol. 2017;796:90–100. [DOI] [PubMed] [Google Scholar]
  • [18].Ritt DA, Abreu-Blanco MT, Bindu L, et al. Inhibition of Ras/Raf/MEK/ERK pathway signaling by a stress-induced phospho-regulatory circuit. Mol Cell. 2016;64:875–887. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [19].Wang AX, Qi XY. Targeting RAS/RAF/MEK/ERK signaling in metastatic melanoma. IUBMB Life. 2013;65:748–758. [DOI] [PubMed] [Google Scholar]
  • [20].Li W, Li Y, Sun R, et al. Dual character of flavonoids in attenuating and aggravating ischemia‑reperfusion‑induced myocardial injury. Exp Ther Med. 2017;14:1307–1314. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [21].Farber J, Chien K, Mittnacht S Jr. Myocardial ischemia: the pathogenesis of irreversible cell injury in ischemia. Am J Pathol. 1981;102:271. [PMC free article] [PubMed] [Google Scholar]
  • [22].Li CY, Ma L, Yu B. Circular RNA hsa_circ_0003575 regulates oxLDL induced vascular endothelial cells proliferation and angiogenesis. Biomed Pharmacother. 2017;95:1514–1519. [DOI] [PubMed] [Google Scholar]
  • [23].Zeng Y, Du WW, Wu Y, et al. A circular RNA binds to and activates AKT phosphorylation and nuclear localization reducing apoptosis and enhancing cardiac repair. Theranostics. 2017;7:3842–3855. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [24].Zhou B, Yu JW. A novel identified circular RNA, circRNA_010567, promotes myocardial fibrosis via suppressing miR-141 by targeting TGF-beta1. Biochem Biophys Res Commun. 2017;487:769–775. [DOI] [PubMed] [Google Scholar]
  • [25].Bai Y, Zhang Y, Han B, et al. Circular RNA DLGAP4 ameliorates ischemic stroke outcomes by targeting miR-143 to regulate endothelial-mesenchymal transition associated with blood-brain barrier integrity. J Neurosci. 2018;38:32–50. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [26].Schütz LF, Hurst RE, Schreiber NB, et al. Transcriptome profiling of bovine ovarian theca cells treated with fibroblast growth factor 9. Domest Anim Endocrinol. 2018;63:48–58. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [27].Lang W, Wang J, Ma X, et al. Identification of shared genes between ischemic stroke and parkinson’s disease using genome-wide association studies. Front Neurol. 2019;10:297. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [28].Geng HH, Li R, Su YM, et al. The circular RNA Cdr1as promotes myocardial infarction by mediating the regulation of miR-7a on its target genes expression. PloS One. 2016;11:e0151753. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [29].Li M, Ding W, Tariq MA, et al. A circular transcript of ncx1 gene mediates ischemic myocardial injury by targeting miR-133a-3p. Theranostics. 2018;8:5855–5869. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [30].Hermeking H. The miR-34 family in cancer and apoptosis. Cell Death Differ. 2010;17:193–199. [DOI] [PubMed] [Google Scholar]
  • [31].Li N, Wang K, Li PF. MicroRNA-34 family and its role in cardiovascular disease. Crit Rev Eukaryot Gene Expr. 2015;25:293–297. [DOI] [PubMed] [Google Scholar]
  • [32].Boon RA, Iekushi K, Lechner S, et al. MicroRNA-34a regulates cardiac ageing and function. Nature. 2013;495:107. [DOI] [PubMed] [Google Scholar]
  • [33].Yang Y, Cheng HW, Qiu Y, et al. MicroRNA-34a plays a key role in cardiac repair and regeneration following myocardial infarction. Circ Res. 2015;117:450–459. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [34].Fu BC, Lang JL, Zhang DY, et al. Suppression of miR-34a expression in the myocardium protects against ischemia-reperfusion injury through SIRT1 protective pathway. Stem Cells Dev. 2017;26:1270–1282. [DOI] [PubMed] [Google Scholar]
  • [35].Haidari M, Zhang W, Caivano A, et al. Integrin alpha2beta1 mediates tyrosine phosphorylation of vascular endothelial cadherin induced by invasive breast cancer cells. J Biol Chem. 2012;287:32981–32992. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [36].Lengfeld JE, Lutz SE, Smith JR, et al. Endothelial Wnt/beta-catenin signaling reduces immune cell infiltration in multiple sclerosis. Proceedings of the National Academy of Sciences of the United States of America. 2017;114:E1168–e77. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [37].Bi W, Huang J, Nie C, et al. CircRNA circRNA_102171 promotes papillary thyroid cancer progression through modulating CTNNBIP1-dependent activation of beta-catenin pathway. J Exp Clin Cancer Res. 2018;37:275. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [38].Li JP, Zhuang HT, Xin MY, et al. MiR-214 inhibits human mesenchymal stem cells differentiating into osteoblasts through targeting beta-catenin. Eur Rev Med Pharmacol Sci. 2017;21:4777–4783. [PubMed] [Google Scholar]
  • [39].Liu P, Wilson MJ. miR-520c and miR-373 upregulate MMP9 expression by targeting mTOR and SIRT1, and activate the Ras/Raf/MEK/Erk signaling pathway and NF-kappaB factor in human fibrosarcoma cells. J Cell Physiol. 2012;227:867–876. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Articles from Cell Cycle are provided here courtesy of Taylor & Francis

RESOURCES