Abstract
The eukaryotic initiation factor 4E (eIF4E) is a major mRNA cap-binding protein that has a central role in translation initiation. Ser209 is the single phosphorylation site within eIF4E and modulates its activity in response to MAPK pathway activation. It has been reported that phosphorylation of eIF4E at Ser209 promotes translation of key mRNAs, such as cyclin D1, that regulate ribosome biogenesis. We hypothesized that phosphorylation at Ser209 is required for skeletal muscle growth in response to a hypertrophic stimulus by promoting ribosome biogenesis. To test this hypothesis, wild-type (WT) and eIF4E knocked-in (KI) mice were subjected to synergist ablation to induce muscle hypertrophy of the plantaris muscle as the result of mechanical overload; in the KI mouse, Ser209 of eIF4E was replaced with a nonphosphorylatable alanine. Contrary to our hypothesis, we observed no difference in the magnitude of hypertrophy between WT and KI groups in response to 14 days of mechanical overload induced by synergist ablation. Similarly, the increases in cyclin D1 protein levels, ribosome biogenesis, and translational capacity did not differ between WT and KI groups. Based on these findings, we conclude that phosphorylation of eIF4E at Ser209 is dispensable for skeletal muscle hypertrophy in response to mechanical overload.
Keywords: protein synthesis, ribosome biogenesis, skeletal muscle growth, translation
INTRODUCTION
In the current model of skeletal muscle hypertrophy induced by mechanical overload, growth depends on an increase in protein synthesis (2, 16). Although an increase in protein synthesis can be achieved by enhanced translational efficiency (rate of mRNA translation per ribosome), sustained growth appears to require an increase in translational capacity (total number of ribosomes per cell) (28). An increase in the translational capacity of the cell is primarily driven by ribosome biogenesis, which is regulated by formation of the preinitiation complex and recruitment of RNA polymerase I at the ribosomal DNA (rDNA) promoter (4). Transcription of the rDNA gene is regulated by a few signaling pathways, such as phosphatidylinositol 3-kinase-AKT-mechanistic target of rapamycin (mTOR) and MAPK, and several progrowth genes, such as c-Myc and cyclins (4). After transcription, the 47S pre-rRNA is processed into the mature rRNAs, which requires the activity of the nucleolar pre-rRNA-processing protein NIP7 (17).
Eukaryotic initiation factor 4E (eIF4E) is the major mRNA cap-binding protein and has been reported to be an essential component of the eIF4F complex that regulates translation initiation (13). The mTOR complex 1 (mTORC1) pathway acts chiefly on mRNA translation at this translational step through phosphorylation of eIF4E-binding protein 1 (4E-BP1) at multiple sites (25). 4E-BP1 functions as a scaffold protein that binds eIF4E, preventing eIF4E engagement in translation; however, once hyperphosphorylated, 4E-BP1 releases eIF4E to bind to mRNAs (9, 13). During the initial hypertrophic response induced by an increase in mechanical load, mTORC1 signaling regulates the translation of 5′-terminal oligopyrimidine tract mRNAs, which are thought to be important for subsequent muscle hypertrophy (9).
In addition to being regulated by mTORC1 and 4E-BP1, eIF4E can also be regulated via phosphorylation at Ser209. This phosphorylation site is a target of the MAPK pathway, via activation of its direct upstream kinase MAPK-interacting protein kinase (MNK) (13). However, there is conflicting evidence about the impact of phosphorylation of eIF4E at Ser209 on translation (6, 11). Initially, phosphorylation of eIF4E at Ser209 was associated with increased rates of protein synthesis and cell growth, whereas a later study reported that phosphorylation at Ser209 did not immediately affect the global rate of translation (8, 15). More recent studies found that phosphorylation of eIF4E modulates the translation of a select set of mRNAs involved in cell growth (7, 20). In particular, eIF4E has been shown to regulate the translation of cyclin D1 mRNA through increased nuclear export (24), which appears to be, in part, mediated by phosphorylation of eIF4E at Ser209 (1, 26, 27). Based on these findings, we sought to determine whether phosphorylation of eIF4E is required for cyclin D1 translation during muscle overload and the subsequent ribosome biogenesis and muscle hypertrophy. Thus we hypothesized that phosphorylation of eIF4E at Ser209 is ultimately required for skeletal muscle hypertrophy. Indeed, in vitro experiments have demonstrated that treatment of myotubes with medium containing high serum, a potent anabolic stimulus, increases ribosome biogenesis via upregulation of cyclin D1 protein levels (19). Our hypothesis is further supported by human studies that have shown that resistance exercise promotes activation of the eIF4E upstream kinase MNK, as well as phosphorylation of eIF4E at Ser209, and also increases cyclin D1 protein levels (3, 5, 14). To test our hypothesis, we investigated the hypertrophic response and ribosome biogenesis of wild-type (WT) and eIF4E knock-in (KI) mice subjected to 14 days of mechanical overload induced by synergist ablation (SA). In the eIF4E KI mice, Ser209 of eIF4E was replaced with a nonphosphorylatable alanine. Should phosphorylation of eIF4E be determinant for cyclin D1 mRNA translation and the ribosome biogenesis response to SA, these events would be blunted in the eIF4E KI mice, resulting in reduced muscle hypertrophy induced by mechanical overload.
MATERIALS AND METHODS
Animals.
All animal work was conducted following a protocol approved by and in accordance with the guidelines of the Institutional Animal Care and Use Committee of the University of Kentucky. WT mice (strain C57BL6/J) were purchased from The Jackson Laboratories and bred in-house. The eIF4E KI mice (C57BL6/J background), which were obtained from Dr. Nahum Sonenberg (McGill University, Montreal, PQ, Canada), were also bred in-house. Mice were genotyped using the method described by Furic et al. (7). Body weight was recorded weekly after the animals were weaned.
Forelimb grip strength.
Forelimb muscle strength was assessed in 5-mo-old mice using a pull bar on a grip strength meter (Columbus Instruments, Columbus, OH). Each mouse was tested three times, and the peak force (in N) of each attempt was recorded; the greatest value was used for analysis and normalized to body weight.
Synergistic ablation model and muscle collection.
Skeletal muscle hypertrophy was induced by mechanical overload of the plantaris muscle of 5-mo-old mice by SA, as described previously by us (12). Briefly, under isoflurane anesthesia (3% isoflurane and 1.5 L of O2 per minute), the gastrocnemius/soleus tendon was exposed, and approximately half of the proximal portion of the gastrocnemius and the entire soleus were excised. The incision was closed with surgical sutures, and the mice were returned to a clean cage and monitored for recovery from anesthesia. At 3, 7, and 14 days after surgery, the mice were euthanized via CO2 followed by cervical dislocation. The plantaris muscles were harvested; one plantaris muscle was snap-frozen in liquid nitrogen and stored at −80°C until analysis, and the contralateral plantaris muscle was embedded in Tissue Tek Optimal Cutting Temperature compound (Sakura Finetek, Torrance, CA), pinned to a cork board, and then frozen in liquid nitrogen-cooled isopentane and stored at −80°C until immunohistochemical analysis.
RNA extraction and RT-PCR.
Total RNA was extracted from the plantaris muscle using TRI Reagent (Sigma-Aldrich, St. Louis, MO) for tissue homogenization using beads and the Bullet Blender tissue homogenizer (Next Advance, Troy, NY). After homogenization, RNA was isolated via phase separation by addition of bromochloropropane and centrifugation. The supernatant containing RNA was washed using the Direct-zol kit (Zymo Research, Irvine, CA). RNA was treated in-column with DNase, eluted in nuclease-free water (NFW), and then stored at −80°C. Since all RNA samples were eluted in the same volume of NFW, the volume of sample that was equivalent to 1 mg of tissue was loaded onto an agarose gel with ethidium bromide for rRNA quantification. The 28S and 18S rRNA bands were quantified using ImageJ software (National Institutes of Health, Bethesda, MD).
For quantitative PCR (qPCR), 500 ng of total RNA were reverse-transcribed using SuperScript IV VILO master mix (Invitrogen, Carlsbad, CA). qPCR was run using Fast SYBR Green master mix (Applied Biosystems, Foster City, CA) in a QuantStudio 3 real-time PCR system (Thermo Fisher Scientific, Waltham, MA). PCR data were normalized by the geometric mean of the three most stable reference genes (Emc7, Vcp, and Champ2a) selected from a panel of five reference genes. Primer sequences are described in Table 1. The ΔCt values (gene of interest – geometric mean of the reference genes) were used for statistical analysis.
Table 1.
RT-PCR primers utilized
| Sequence (5′→3′) |
||
|---|---|---|
| Primer Target | Forward | Reverse |
| Chmp2A | GTCGCTTAATCCGGAAACGG | GAACTAGCGGAGCCGAGAGA |
| Emc7 | AGAGCATGTCGGCTTCCTTA | ATCTTGCTCGCATTTTTCCTTTTG |
| Vcp | CTCCCTCCAAAGGCGTTCTT | TGGCCTCAGATTCCCCAAAC |
| Gpi1 | GATCCGGAGCGCTTCAACAAC | TGAACATGTTGTCCCGTGCAG |
| Hprt | ACAGGCCAGACTTTGTTGGAT | ACTTGCGCTCATCTTAGGCTT |
| ITS | AGAGAGGTGGTATCCCCGGT | GGAGACGAAGAAGAGCCACG |
| 5.8S-ITS | CGACACTTCGAACGCACTTG | TCTGAACTTCGGGAGACGGA |
| c-Myc | AGCCCCTAGTGCTGCATGA | TCCACAGACACCACATCAATTTC |
| Ccnd1 | GCCATCCATGCGGAAAATCG | GGAAGACCTCCTCTTCGCAC |
| Nip7 | ACTATGTGAGTGAGATGATGCTG | CGGAACTTGTGGGTCTTGGT |
Chmp2, chromatin-modifying protein/charged multivesicular body protein 2; Emc7, endoplasmic reticulum membrane protein complex subunit 7; Vcp, valosin-containing protein; Gpi1, glucose-6-phosphate isomerase 1; Hprt, hypoxanthine-guanine phosphoribosyltransferase; ITS, internal transcribed spacer; Ccnd1, cyclin D1; Nip7, nucleolar pre-rRNA-processing protein 7.
Western blot analysis.
After RNA extraction, protein was extracted from the organic phase of TRI Reagent. Samples were centrifuged, and the resulting protein pellet was solubilized using SDS-urea buffer (100 mM Tris, pH 6.8, 12% glycerol, 4% SDS, 0.008% bromophenol blue, 2% β-mercaptoethanol, and 5 M urea) supplemented with Halt protease and phosphatase (catalog nos. 78438 and 78426, respectively, Thermo Fisher) inhibitor cocktails. The protein concentration of each sample was determined using the RC DC protein assay (Bio-Rad, Hercules, CA), and the samples were subsequently diluted to the same concentration. Protein (25 μg/sample) was loaded onto a SDS-polyacrylamide gel (10–12% gels, depending on the molecular weight of the protein of interest) and electrophoretically transferred to a nitrocellulose membrane (Bio-Rad). Pool control samples were loaded onto all gels. Membranes were blocked in 5% bovine serum albumin (BSA; catalog no. A-420-1, Gold Biotechnology, St. Louis, MO) or 5% nonfat dry milk (catalog no.170-6404, Bio-Rad) in Tris-buffered saline (TBS) with 0.1% Tween 20 (TBS-T) for 2 h at room temperature. The membranes were blocked and then incubated overnight at 4°C with one of the following primary antibodies: phosphorylated (Ser209) eIF4E antibody (1:1,000 dilution; catalog no. 9741, Cell Signaling Technology, Danvers, MA), cyclin D1 antibody (1:200 dilution; catalog no. MA5-16356, Thermo Fisher Scientific), or total eIF4E (1:200 dilution; catalog no. SC-9976, Santa Cruz Biotechnology) in 5% BSA in TBS-T. The membranes were washed with TBS-T and then incubated with goat anti-rabbit (catalog no. G-21234, Thermo Fisher Scientific) or goat anti-mouse (catalog no. 31430, Invitrogen) secondary antibody (diluted 1:10,000 in blocking solution) linked to horseradish peroxidase for 1 h at room temperature. Membranes were then incubated for 5 min with enhanced chemiluminescence (ECL) reagent (Clarity Western ECL substrate, catalog no. 170-5060, Bio-Rad) and exposed to a ChemiDoc MP imaging system (Bio-Rad). Bands were quantified using ImageJ software. Coomassie blue staining was utilized to confirm equal loading and for densitometry normalization.
Immunohistochemistry.
Immunohistochemical analysis was performed as previously described by us (18). Frozen plantaris muscles were sectioned (7 µm) at −23°C on a cryostat (model CM3050 S, Leica, Nussloch, Germany), air-dried for ≥1 h, and then stored at −20°C. For determination of muscle fiber cross-sectional area (CSA), sections were incubated overnight with an antibody against dystrophin (1:100 dilution; catalog no. ab15277, Abcam, St. Louis, MO). The sections were subsequently incubated with the secondary antibody for dystrophin (1:150 dilution, anti-rabbit IgG-aminomethylcoumarin acetate; catalog no. CI-1000, Vector Laboratories) diluted in PBS. Sections were mounted using VectaShield with DAPI (catalog no. H-1200, Vector Laboratories). The images were stained and then captured at ×20 magnification using an upright fluorescence microscope (AxioImager M1, Zeiss, Oberkochen, Germany). Whole muscle sections were obtained using the mosaic function in Zeiss Zen 2.3 imaging software. Muscle fiber CSA was quantified using MyoVision automated analysis software (29). On average, 770 ± 275 myofibers were analyzed per muscle sample.
Statistical analysis.
Data (with the exception of phosphorylation of eIF4E, resting muscle weight, and strength measurements) were analyzed by two-way ANOVA, with time (days following SA surgery) and genotype (WT or KI) as the main effects, using SigmaPlot 13 (Systat Software, San Jose, CA). When a main effect was found, post hoc pair-wise comparisons were analyzed by the Holm-Sidak method. Because phosphorylation of eIF4E was undetectable in muscles from eIF4E KI mice, one-way ANOVA was used to analyze phosphorylation of eIF4E in WT mice. Student’s two-tailed t test was used to analyze muscle strength and resting plantaris weight. Statistical significance was set at P < 0.05. Values are means ± SE.
RESULTS
Mouse model.
The targeting strategy used by Furic and colleagues (7) to generate the eIF4E KI mouse is shown in Fig. 1A. The targeting construct replaced Ser209 within exon 8 of the eIF4E gene with alanine, thereby preventing phosphorylation of eIF4E protein. Pups were genotyped using the primers shown in Fig. 1A, which clearly distinguished between WT and eIF4E KI alleles (Fig. 1B); only WT and KI homozygous mice were utilized in the study. As shown in Fig. 1C, there was no appreciable difference in the growth curve of male and female WT and KI mice.
Fig. 1.
Animal model. A: an alanine was knocked-in (KI) to the eukaryotic initiation factor 4E (eIF4E) gene in place of the wild-type (WT) allele serine at residue 209. The WT locus (intron before exon 7 and after exon 8) was replaced by the mutated gene and a neomycin-thymidine kinase (Neo-TK) cassette for selection, and later the Neo-TK cassette was removed, leaving an FRT site, which was used for genotyping (~300-bp WT band and ~400-bp KI band). [For more information about the mouse model, see Furic et al. (7).] B: gel electrophoresis for confirmation of the KI mutated eIF4E gene. Lane 1, WT mouse; lane 2, homozygous KI mouse. C: body weight curve. D: normalized plantaris muscle weight (n = 6–7/group). E: forelimb grip strength (n = 4–9/group). Values are means ± SE.
Plantaris muscle weight.
At rest, there were no significant differences in the normalized weight (mg/g body wt) of plantaris muscle isolated from female and male 5-mo-old WT and KI mice (P = 0.599 within females and P = 0.945 within males; Fig. 1D).
Grip strength.
There was no significant difference in grip strength between WI and KI mice (Fig. 1E): 0.051 ± 0.0.003 and 0.050 ± 0.003 N/g were produced by female WT and KI mice, respectively (P = 0.957), and 0.048 ± 0.003 and 0.044 ± 0.005 N/g were produced by male WT and KI mice, respectively (P = 0.479).
eIF4E phosphorylation.
At 5 mo of age, WT and KI mice were subjected to 3, 7, and 14 days of SA or sham operation (Fig. 2A). As shown in Fig. 2B and quantified in Fig. 2C, Western blot analysis revealed that phosphorylation of eIF4E at Ser209 was significantly (main effect of time, P < 0.001) higher at 3, 7, and 14 days (post hoc comparisons against sham, P < 0.05) following SA in WT mice. As expected, we detected no phosphorylation of eIF4E in the KI group at any time point.
Fig. 2.
Mechanical overload. A: synergist ablation model. Wild-type (WT) and eukaryotic initiation factor 4E (eIF4E) knock-in (KI) mice (5-mo-old) were subjected to synergist ablation (SA) surgery or a sham operation. Muscles were collected 3, 7, and 14 days after surgery. Sham mice were collected across all time points. B: Western blot for phosphorylated (Ser209) and total eIF4E in response to mechanical overload. The closest molecular weight marker is indicated to show the approximate weight of the target protein. C: quantification of eIF4E phosphorylation. D: quantification of total eIF4E. ND, not detected; AU, arbitrary units. Values are means ± SE; n = 6 mice per group at each time point after surgery, as well as sham operation. *Statistical significance vs. sham.
As shown in Fig. 2, B and D, total eIF4E protein abundance was significantly higher following SA in both WT and KI mice (time effect, P < 0.001; genotype effect, P = 0.911; interaction, P = 0.791). The post hoc analysis revealed that eIF4E protein was increased at all time points following SA compared with sham surgery (P < 0.05).
Expression of progrowth genes.
As shown in Fig. 3A, cyclin D1 mRNA expression was significantly (main effect of time, P < 0.001) higher in response to SA but was not different between WT and KI groups (main effect of genotype, P = 0.924; interaction, P = 0.688). Cyclin D1 mRNA expression was significantly higher at all time points after SA than sham surgery (all pairwise comparisons, P < 0.001).
Fig. 3.
Upstream regulators of ribosome biogenesis response to mechanical overload. A and B: cyclin D1 mRNA and protein levels. The closest molecular weight marker is indicated to show the approximate weight of the target protein. C and D: c-Myc and nucleolar pre-rRNA-preprocessing protein (Nip7) mRNA levels. AU, arbitrary units. Values are means ± SE; n = 6 mice per group. *Statistical significance vs. sham.
The level of cyclin D1 protein (Fig. 3B) was significantly higher after SA in both WT and KI mice, with no difference between groups (main effect of time, P < 0.001; main effect of genotype, P = 0.111; interaction, P = 0.610). All pairwise comparisons were significantly different from sham (P < 0.05).
c-Myc mRNA expression (Fig. 3C) was significantly higher (main effect for time, P < 0.001) in both WT and KI mice at 3 and 7 days following SA (post hoc vs. sham, P < 0.001), with no significant difference between groups (main effect of genotype, P = 0.741; interaction, P = 0.479).
Nip7 mRNA expression was significantly (main effect of time, P < 0.001) higher at each time point following SA (Fig. 3D) but was not different between WT and KI groups (main effect of genotype, P = 0.154; interaction, P = 0.165). Nip7 mRNA expression was significantly higher at all time points after SA than sham surgery (all pair-wise comparisons, P < 0.001).
rDNA transcription.
To assess changes in rDNA transcription, two different primer sets were used to detect changes in 47S pre-rRNA expression. One primer set was designed to detect changes in the region spanning the 5.8S rRNA and the internal transcribed spacer (ITS) region (5.8S-ITS) and a second primer set was designed to detect changes in the ITS region alone of 47S pre-rRNA. As shown in Fig. 4, A and B, there were no significant differences in 47S pre-rRNA (either 5.8S-ITS or ITS) expression between WT and KI groups under resting conditions. In response to a hypertrophic stimulus induced by SA, expression of 5.8S-ITS and ITS was significantly higher (main effect of time, P < 0.001 for both) after 3 and 7 days (all respective post hoc analysis vs. sham, P < 0.001), with no difference between WT and KI groups (for 5.8S-ITS: effect of genotype, P = 0.714; interaction, P = 0.540; for ITS: effect of genotype, P = 0.262; interaction, P = 0.892). There was a trend (P = 0.084) for higher ITS expression following 14 days of SA, with no difference between WT and KI groups.
Fig. 4.
Ribosomal DNA transcription and translational capacity changes during mechanical overload in wild-type (WT) and eukaryotic initiation factor 4E (eIF4E) knock-in (KI) mice subjected to synergist ablation (SA) surgery or a sham operation. A and B: changes in 47S pre-rRNA, as measured by 5.8S-ITS and ITS (n = 6 mice per group). C and D: translational capacity markers (n = 6–9 mice per group). C: total RNA per milligram of muscle tissue. D: rRNA per milligram of tissue. Inset: representative image of gel electrophoresis of rRNA depicting 28S and 18S rRNAs. AU, arbitrary units. Values are means ± SE. *Statistical significance vs. sham.
Total RNA per milligram of muscle tissue was significantly higher in response to SA (main effect of time, P < 0.001) at 3, 7, and 14 days (all compared with sham, P < 0.001), with no difference between WT and KI groups (main effect of genotype, P = 0.245; main effect of interaction, P = 0.984; Fig. 4C). Consistent with the increase in total RNA, rRNA 28S and 18S abundance was significantly higher at all time points following SA (main effect of time, P < 0.001; all post hoc comparison against sham, P < 0.05), with no difference between genotypes (main effect of genotype, P = 0.841; interaction, P = 0.557; Fig. 4D).
Fiber size.
To assess the hypertrophic response to SA, we determined plantaris myofiber mean CSA after 14 days of SA. There was a main effect for time (P < 0.001), but not for genotype (P = 0.444) or interaction (P = 0.870) for myofiber mean CSA (Fig. 5). The myofiber mean CSA was significantly (22%) larger (P < 0.001) after 14 days of SA in both groups than their respective sham control.
Fig. 5.
Mean myofiber cross-sectional area (CSA) changes in wild-type (WT) and eukaryotic initiation factor 4E (eIF4E) knock-in (KI) mice subjected to synergist ablation (SA) surgery or a sham operation. Skeletal muscle hypertrophy was induced by mechanical overload. A: representative images of a cross section from a sham-operated mouse and a SA mouse at 14 days. Scale bar = 20 µm. B: quantification of mean myofiber CSA. Values are means ± SE; n = 3–6 mice per group. *Statistical significance vs. sham.
DISCUSSION
The main finding of the present study was that phosphorylation of eIF4E is dispensable for skeletal muscle hypertrophy induced by mechanical overload. We hypothesized that phosphorylation of eIF4E at Ser209 would be required for the activation of ribosome biogenesis by promoting translation of cyclin D1 mRNA and the subsequent hypertrophic response. To test our hypothesis, we took advantage of a KI mouse strain in which the Ser209 residue of eIF4E was replaced by alanine, thereby effectively eliminating phosphorylation of eIF4E at Ser209 (7). Contrary to our hypothesis, we found no difference in the hypertrophic response between WT and KI groups as assessed by myofiber CSA, ribosome biogenesis, rRNA abundance, and expression of genes involved in ribosome biogenesis and maturation (cyclin D1, c-Myc, and Nip7).
The KI mouse showed no overt phenotype, as previously reported (7). The growth curve from weaning (3 wk of age) to 5 mo of age of the KI mice was similar to that of the WT mice (Fig. 1C). Similarly, on average, plantaris muscle mass was the same for adult KI and WT mice, with no difference in forelimb grip strength between groups (Fig. 1, D and E). Basal translational capacity (as assessed by total RNA per milligram of tissue and rRNA abundance) was also similar between WT and KI strains (Fig. 4, C and D). Thus we concluded that phosphorylation of eIF4E is not necessary for postnatal skeletal muscle growth.
It has been shown that the KI mouse is resistant to tumorigenesis and that phosphorylation of eIF4E promotes tumor development and progression due to enhanced translation of mRNAs involved in several cellular processes, including cellular growth and proliferation (7). Thus we postulate that only when the animal is challenged with a stimulus such as tumor progression or mechanical overload, thereby substantially increasing the requirement for muscle protein synthesis, does the importance of eIF4E phosphorylation become evident. Indeed, after mechanical overload, there was a robust phosphorylation at Ser209 in WT mice (Fig. 2, B and C). This response was completely absent in the KI mice. However, contrary to our hypothesis, mean myofiber CSA was significantly greater in KI mice at 14 days after SA than sham operation, which was the same magnitude of hypertrophy in WT mice. In both groups, myofiber hypertrophy was preceded by a significant increase in translational capacity based on total RNA and rRNA abundance 3 and 7 days following SA as the result of higher rDNA transcription, as assessed by expression of 47S pre-rRNA (Fig. 4). These results provide further evidence that ribosome biogenesis is necessary for skeletal muscle hypertrophy (4, 28) and demonstrate that phosphorylation of eIF4E is dispensable for these events.
Protein synthesis is highly regulated. A main point of regulation and a rate-limiting step of mRNA translation is initiation (21). Several eukaryotic initiation factors are required for association of ribosomes with mRNAs and promotion of their translation (10). In particular, in response to a growth stimulus, progrowth genes are selectively translated, which promotes ribosome biogenesis. The synthesis of new ribosomes to sustain increased protein synthesis has been shown to be important for skeletal muscle hypertrophy induced by mechanical overload (reviewed in Ref. 4). The expression of progrowth genes, such as c-Myc, cyclin D1, and Nip7, was higher in response to SA but did not depend on eIF4E phosphorylation, as there was no difference between WT and KI groups.
Cyclin D1 protein levels were markedly upregulated in the mice subjected to SA. This is consistent with human data, which showed an increase in cyclin D1 levels following resistance exercise (3, 5). It has been shown that phosphorylation of eIF4E at Ser209 regulates nuclear trafficking of the cyclin D1 mRNA and, thus, may regulate its translation (1, 26, 27). However, contrary to our hypothesis, cyclin D1 protein levels were not affected by eIF4E phosphorylation status. These findings indicate that phosphorylation of eIF4E at Ser209 is not required for cyclin D1 mRNA translation in adult skeletal muscle. An alternative explanation is that other mechanisms to drive cyclin D1 mRNA translation are operating during overload. 1) The robust increase in cyclin D1 mRNA levels (Fig. 3A) during overload (>3-fold higher than sham levels) is sufficient to increase the translation of cyclin D1. Indeed, protein levels of cyclin D1 paralleled mRNA levels of cyclin D1, which indicates that cyclin D1 expression may also be controlled at the level of transcription in adult skeletal muscle undergoing hypertrophy. 2) We also observed a robust increase in total levels of eIF4E in both WT and KI mice (Fig. 2B). Overexpression of eIF4E has been shown to promote cyclin D1 translation (22, 23). Thus it is possible that both increased cyclin D1 mRNA expression and eIF4E protein levels overcome the lack of eIF4E phosphorylation to drive cyclin D1 mRNA translation. Therefore, our data regarding eIF4E phosphorylation should be taken into consideration in this context, where there is a robust induction of both cyclin D1 mRNA expression and eIF4E protein levels. In other scenarios where such effects are not observed, phosphorylation of eIF4E may have a more determinant role in cyclin D1 mRNA translation and ribosome biogenesis. Nevertheless, the data herein suggest that phosphorylation of eIF4E at Ser209 plays a minor role in skeletal muscle hypertrophy. More studies are warranted to determine other roles of eIF4E phosphorylation in skeletal muscle and whether another molecular mechanism may be involved in translation of cyclin D1 mRNA in muscle during mechanical load.
Collectively, the results from this study are in agreement with several lines of evidence suggesting that ribosome biogenesis may be an important mediator of skeletal muscle hypertrophy in response to mechanical overload. rDNA transcription was significantly higher following the initial onset of overload (3–7 days of SA) and returned to baseline levels at 14 days. This led to an accumulation of rRNA (and total RNA) that peaked at 7 days. Myofibers were significantly larger at 14 days, demonstrating that ribosome biogenesis and the subsequent increase in translational capacity precede skeletal muscle hypertrophy. More studies, however, are necessary to determine the role of ribosome biogenesis in the translational control of muscle hypertrophy. In particular, loss- and gain-of-function studies will be important to determine the necessity of ribosome biogenesis for skeletal muscle hypertrophy.
In conclusion, the initial increase in ribosome biogenesis and the subsequent increase in translational capacity in response to mechanical overload were remarkably intact in KI mice. Consequently, skeletal muscle hypertrophy was similar between WT and KI mice. Hence, we conclude that phosphorylation of eIF4E at Ser209 is not required to promote skeletal muscle ribosome biogenesis and hypertrophy following mechanical overload.
GRANTS
This work was supported by National Institutes of Health Grants AR-060701 and AG-049806 (to C. A. Peterson and J. J. McCarthy) and National Center for Advancing Translational Sciences Grant TL1 TR-001997 (to D. A. Englund).
DISCLOSURES
No conflicts of interest, financial or otherwise, are declared by the authors.
DISCLAIMERS
The content is solely the responsibility of the authors and does not necessarily represent the official views of the NIH.
AUTHOR CONTRIBUTIONS
V.C.F., C.A.P., and J.J.M. conceived and designed research; V.C.F., D.A.E., I.J.V., and A.A. performed experiments; V.C.F. and D.A.E. analyzed data; V.C.F., D.A.E., C.A.P., and J.J.M. interpreted results of experiments; V.C.F. and D.A.E. prepared figures; V.C.F. and J.J.M. drafted manuscript; V.C.F., D.A.E., I.J.V., A.A., C.A.P., and J.J.M. edited and revised manuscript; V.C.F., D.A.E., I.J.V., A.A., C.A.P., and J.J.M. approved final version of manuscript.
ACKNOWLEDGMENTS
We thank Dr. Nahum Sonenberg for kindly gifting us with breeding pairs of the eIF4E knocked-in mice.
REFERENCES
- 1.Culjkovic B, Topisirovic I, Skrabanek L, Ruiz-Gutierrez M, Borden KL. eIF4E promotes nuclear export of cyclin D1 mRNAs via an element in the 3′UTR. J Cell Biol 169: 245–256, 2005. doi: 10.1083/jcb.200501019. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Figueiredo VC. Revisiting the roles of protein synthesis during skeletal muscle hypertrophy induced by exercise. Am J Physiol Regul Integr Comp Physiol 317: R709–R718, 2019. doi: 10.1152/ajpregu.00162.2019. [DOI] [PubMed] [Google Scholar]
- 3.Figueiredo VC, Caldow MK, Massie V, Markworth JF, Cameron-Smith D, Blazevich AJ. Ribosome biogenesis adaptation in resistance training-induced human skeletal muscle hypertrophy. Am J Physiol Endocrinol Metab 309: E72–E83, 2015. doi: 10.1152/ajpendo.00050.2015. [DOI] [PubMed] [Google Scholar]
- 4.Figueiredo VC, McCarthy JJ. Regulation of ribosome biogenesis in skeletal muscle hypertrophy. Physiology (Bethesda) 34: 30–42, 2019. doi: 10.1152/physiol.00034.2018. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Figueiredo VC, Roberts LA, Markworth JF, Barnett MPG, Coombes JS, Raastad T, Peake JM, Cameron-Smith D. Impact of resistance exercise on ribosome biogenesis is acutely regulated by post-exercise recovery strategies. Physiol Rep 4: e12670, 2016. doi: 10.14814/phy2.12670. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Flynn A, Proud CG. Serine 209, not serine 53, is the major site of phosphorylation in initiation factor eIF-4E in serum-treated Chinese hamster ovary cells. J Biol Chem 270: 21684–21688, 1995. doi: 10.1074/jbc.270.37.21684. [DOI] [PubMed] [Google Scholar]
- 7.Furic L, Rong L, Larsson O, Koumakpayi IH, Yoshida K, Brueschke A, Petroulakis E, Robichaud N, Pollak M, Gaboury LA, Pandolfi PP, Saad F, Sonenberg N. eIF4E phosphorylation promotes tumorigenesis and is associated with prostate cancer progression. Proc Natl Acad Sci USA 107: 14134–14139, 2010. doi: 10.1073/pnas.1005320107. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Gingras AC, Raught B, Sonenberg N. eIF4 initiation factors: effectors of mRNA recruitment to ribosomes and regulators of translation. Annu Rev Biochem 68: 913–963, 1999. doi: 10.1146/annurev.biochem.68.1.913. [DOI] [PubMed] [Google Scholar]
- 9.Goodman CA. Role of mTORC1 in mechanically induced increases in translation and skeletal muscle mass. J Appl Physiol (1985) 127: 581–590, 2019. doi: 10.1152/japplphysiol.01011.2018. [DOI] [PubMed] [Google Scholar]
- 10.Jackson RJ, Hellen CU, Pestova TV. The mechanism of eukaryotic translation initiation and principles of its regulation. Nat Rev Mol Cell Biol 11: 113–127, 2010. doi: 10.1038/nrm2838. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Joshi B, Cai AL, Keiper BD, Minich WB, Mendez R, Beach CM, Stepinski J, Stolarski R, Darzynkiewicz E, Rhoads RE. Phosphorylation of eukaryotic protein synthesis initiation factor 4E at Ser-209. J Biol Chem 270: 14597–14603, 1995. doi: 10.1074/jbc.270.24.14597. [DOI] [PubMed] [Google Scholar]
- 12.Kirby TJ, McCarthy JJ, Peterson CA, Fry CS. Synergist ablation as a rodent model to study satellite cell dynamics in adult skeletal muscle. Methods Mol Biol 1460: 43–52, 2016. doi: 10.1007/978-1-4939-3810-0_4. [DOI] [PubMed] [Google Scholar]
- 13.Mamane Y, Petroulakis E, Rong L, Yoshida K, Ler LW, Sonenberg N. eIF4E—from translation to transformation. Oncogene 23: 3172–3179, 2004. doi: 10.1038/sj.onc.1207549. [DOI] [PubMed] [Google Scholar]
- 14.Markworth JF, Vella LD, Figueiredo VC, Cameron-Smith D. Ibuprofen treatment blunts early translational signaling responses in human skeletal muscle following resistance exercise. J Appl Physiol (1985) 117: 20–28, 2014. doi: 10.1152/japplphysiol.01299.2013. [DOI] [PubMed] [Google Scholar]
- 15.McKendrick L, Morley SJ, Pain VM, Jagus R, Joshi B. Phosphorylation of eukaryotic initiation factor 4E (eIF4E) at Ser209 is not required for protein synthesis in vitro and in vivo. Eur J Biochem 268: 5375–5385, 2001. doi: 10.1046/j.0014-2956.2001.02478.x. [DOI] [PubMed] [Google Scholar]
- 16.Miyazaki M, Esser KA. Cellular mechanisms regulating protein synthesis and skeletal muscle hypertrophy in animals. J Appl Physiol (1985) 106: 1367–1373, 2009. doi: 10.1152/japplphysiol.91355.2008. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Morello LG, Hesling C, Coltri PP, Castilho BA, Rimokh R, Zanchin NI. The NIP7 protein is required for accurate pre-rRNA processing in human cells. Nucleic Acids Res 39: 648–665, 2011. doi: 10.1093/nar/gkq758. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Murach KA, White SH, Wen Y, Ho A, Dupont-Versteegden EE, McCarthy JJ, Peterson CA. Differential requirement for satellite cells during overload-induced muscle hypertrophy in growing versus mature mice. Skelet Muscle 7: 14, 2017. doi: 10.1186/s13395-017-0132-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Nader GA, McLoughlin TJ, Esser KA. mTOR function in skeletal muscle hypertrophy: increased ribosomal RNA via cell cycle regulators. Am J Physiol Cell Physiol 289: C1457–C1465, 2005. doi: 10.1152/ajpcell.00165.2005. [DOI] [PubMed] [Google Scholar]
- 20.Pelletier J, Sonenberg N. The organizing principles of eukaryotic ribosome recruitment. Annu Rev Biochem 88: 307–335, 2019. doi: 10.1146/annurev-biochem-013118-111042. [DOI] [PubMed] [Google Scholar]
- 21.Richter JD, Sonenberg N. Regulation of cap-dependent translation by eIF4E inhibitory proteins. Nature 433: 477–480, 2005. doi: 10.1038/nature03205. [DOI] [PubMed] [Google Scholar]
- 22.Rosenwald IB, Kaspar R, Rousseau D, Gehrke L, Leboulch P, Chen JJ, Schmidt EV, Sonenberg N, London IM. Eukaryotic translation initiation factor 4E regulates expression of cyclin D1 at transcriptional and post-transcriptional levels. J Biol Chem 270: 21176–21180, 1995. doi: 10.1074/jbc.270.36.21176. [DOI] [PubMed] [Google Scholar]
- 23.Rosenwald IB, Lazaris-Karatzas A, Sonenberg N, Schmidt EV. Elevated levels of cyclin D1 protein in response to increased expression of eukaryotic initiation factor 4E. Mol Cell Biol 13: 7358–7363, 1993. doi: 10.1128/MCB.13.12.7358. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Rousseau D, Kaspar R, Rosenwald I, Gehrke L, Sonenberg N. Translation initiation of ornithine decarboxylase and nucleocytoplasmic transport of cyclin D1 mRNA are increased in cells overexpressing eukaryotic initiation factor 4E. Proc Natl Acad Sci USA 93: 1065–1070, 1996. doi: 10.1073/pnas.93.3.1065. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Thoreen CC, Chantranupong L, Keys HR, Wang T, Gray NS, Sabatini DM. A unifying model for mTORC1-mediated regulation of mRNA translation. Nature 485: 109–113, 2012. doi: 10.1038/nature11083. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Topisirovic I, Ruiz-Gutierrez M, Borden KLB. Phosphorylation of the eukaryotic translation initiation factor eIF4E contributes to its transformation and mRNA transport activities. Cancer Res 64: 8639–8642, 2004. doi: 10.1158/0008-5472.CAN-04-2677. [DOI] [PubMed] [Google Scholar]
- 27.Topisirovic I, Siddiqui N, Lapointe VL, Trost M, Thibault P, Bangeranye C, Piñol-Roma S, Borden KL. Molecular dissection of the eukaryotic initiation factor 4E (eIF4E) export-competent RNP. EMBO J 28: 1087–1098, 2009. doi: 10.1038/emboj.2009.53. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Wen Y, Alimov AP, McCarthy JJ. Ribosome biogenesis is necessary for skeletal muscle hypertrophy. Exerc Sport Sci Rev 44: 110–115, 2016. doi: 10.1249/JES.0000000000000082. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Wen Y, Murach KA, Vechetti IJ Jr, Fry CS, Vickery C, Peterson CA, McCarthy JJ, Campbell KS. MyoVision: software for automated high-content analysis of skeletal muscle immunohistochemistry. J Appl Physiol (1985) 124: 40–51, 2018. doi: 10.1152/japplphysiol.00762.2017. [DOI] [PMC free article] [PubMed] [Google Scholar]





