Abstract
Blastocystis hominis (B. h) is a kind of intestinal parasitic protozoa with the characteristic of worldwide distribution, morphology diversity, and diarrhea induced, etc. The traditional morphological classify was difficult to distinguish the genetic difference of B. h in different population and different geological strains. Recently, based on the small subunit ribosomal DNA sequence of B. h, the sequenced-tagged site (STS) primers was design, and successfully and widely applied to the distinguish the genotype of B. h, and however several B. h strains did not distinguish. To address it, the elongation factor-1 alpha (EF-1α) gene of B. h was screened due to its conservation here, and its specific primers were designed to distinguish the genotype of B. h. After epidemiological survey, the infection rate of B. h in boys was 14.74%, and that of girls was 15.05%, and the total infection rate of B. h was 14.93%. In total of 53 infection students, with the using of 7 pairs STS primers, 31 strains was validated by polymerase chain reaction (PCR), including 4 strains of Type 1, 17 strains of Type 3, 4 strains of Type 4, 1 strains of Type 6, and 5 strains of Type 7, and did not found the Type 2, Type 5 and mixture genotype. In the 23 unknown genotype strains of B. h, 15 strains were identified by PCR using EF-1α primers, and had a higher homology in the DNA sequence (70%), and was evolutionarily closer to the EF-1α sequence of S and H strains of B. h. This study indicated that STS primers could identify the genotype of B. h, and EF-1α primers as a novel diagnosis primers could auxiliary identify the unknown genotype strain of B. h, and exhibited a wide application on the identification of the genotype strain of B. h, and provided a significant reference on the study of B. h in clinic.
Keywords: Blastocystis hominis, distinguish, sequenced-tagged site, elongation factor-1 alpha, primer
Introduction
Blastocystis hominis (B. h) is a single-celled intestinal parasite, and is very common in both humans and animals [1-3], and firstly named as B. h in 1912 by Brumpt, et al. Based on the morphological study of it, it was divided into the intestinal parasite class in 1967 by Zerdt, et al, and was finally divided into the Blastocysta in 1993 by Jinbo Jiang, et al [4,5]. It is one of the most common human parasites in the world and has a global distribution, especially in the developing country of the Southeast Asia and the South America [6-8]. In developing country, the infection rate was 30%-50%, and was much higher than that of the developed country (1.5%-10%) [9-11]. It is estimated that 25% of people are infected with this parasite [12-14]. For a long time, it was believed that B. h was harmless, and however of the 10 subspecies, 2 or 3 subspecies are known to cause complaints as recent study documented, including chronic intestinal symptoms and/or irritable bowel syndrome [15-17]. On the taxonomy, the traditional method based on the morphological structure of B. h does not clearly distinguish the genotype of B. h due to the diversity of it [18], and with the rapid developing of molecular technique, to determine the genetic difference and features of DNA in B. h exhibits a significant application value, especially several conserved genes, such as small subunit ribosomal DNA (SSU rDNA). In 1997, Clark, et al reported that the B. h had a genetic polymorphism, and exited at least 7 genotype after comparison of the SSU rDNA restriction fragment length polymorphism (RFLP) in different regions [19]. Yoshikawa, et al has design the sequenced-tagged site (STS) as a primer of polymerase chain reaction (PCR) based on the SSU rDNA specific fragment, and correctly distinguished the different genotype of B. h in different countries and regions, and still widely used to distinguish the genotype of B. h [20]. However, due to the diversity of B. h in different countries and regions, several genotype of B. h did not entirely identify just using the STS primers, and another primers based on a conserved gene fragment need to develop.
The elongation factor-1 alpha (EF-1α) is a highly conserved ubiquitous protein that is involved in translation and is desirable for use in phylogenetic studies on Blastocystis, an enigmatic intestinal parasite with a contentious taxonomic position [21]. Nakamura, et al has well documented that B. h did not belong to Eumycota based on the analysis of the EF-1α amino acid sequence of it [21]. Ho, et al has also documented that EF-1α gene also had genetic polymorphism, and constructed the phylogenetic relationship based on the DNA sequence and amino acid of 13 B. h strains [22]. All of the studies indicated that EF-1α as a conserved gene exhibited the importance on the classification of B. h. In this study, the EF-1α gene was chosen, and its PCR amplification primers was designed, and hoped to provide an auxiliary detection method of B. h genotype.
Materials and methods
Epidemiological survey and microscopic examination
A total of 1433 students who studied in the Guangxi Medical University were chosen as the object of this study, including 563 boys and 870 girls. All students were distributed the questionnaire to collect the general conditions, personal hygiene and environmental health, etc. After epidemiological survey, a total of 3-5 g faeces was collected, and treated with hydrochloric acid and diethyl ether according to acid ether centrifugal sedimentation method, and the nightsoil was smeared and analyzed by optical microscope.
B. h separation and culture in vitro
The above-validated positive faeces (2-3 g) was picked by bamboo stick, and placed in a 15 ml centrifuge tube, and added 10 ml of Locke’s to stir evenly, and removed the coarse particle. The turbid liquid was transferred to a new 15 ml centrifuge tube, and added 10 ml of Locke’s to naturally sediment 1-2 hrs, and then removed the supernatant. Repeated one time, and suck up 1 ml liquid nearby the nightsoil, and inoculated to Iscove’s Modified Dulbecco’s Media (IMDM) medium, and anaerobic cultured at 37°C for 48 hrs, and repeated one time. Then, centrifuged at 4,000 g for 2 min, and removed the supernatant, and added 10 ml of Locke’s to resuspended polypide, and centrifuged at 4,000 g for 2 min, repeated 3-4 times. Removed the supernatant, and added 4 ml of Locke’s to resuspended polypide, and centrifuged at 5,600 g for 3 min, repeated 3 times. Removed the supernatant, and added 1 ml of Locke’s to resuspended polypide, and counted using cell counting chamber.
Genomic DNA extraction of B. h
The above-separated B. h genomic DNA was extracted according to the manufacturers’ instructions of the blood/cell/tissue genomic DNA extraction kit (TIANGEN BIOTECH (BEIJING) CO. LTD). The B. h polypide was washed with double distilled water, and added 200 μl of GA buffer (pre-added 8 μl of Rnase A) to shaking at room temperature, and stewing for 5 min. Then, added 20 μl of proteinase K and 200 μl of GB buffer to reverse blending, and incubated at 70°C water bath. Added 220 μl of absolute ethyl alcohol to reverse blending, and then transferred to the CB3 column, and centrifuged at 12,000 rpm for 30 s, removed the elution. Added 500 μl of GD buffer, and centrifuged at 12,000 rpm for 30 s, removed the elution. Added 700 μl of PW buffer, and stewing at room temperature for 30 s, and removed the elution, repeated one time, and added 50 μl of TE buffer, and stewing for 2-5 min, and centrifuged at 12,000 rpm for 2 min. The elution was collected, and the concentration and the purity were detected by ultraviolet spectrophotometer.
Identification of B. h different strains using STS primers by polymerase chain reaction (PCR)
The above-extracted B. h genomic DNA (100 ng) was used as a template to perform PCR assay using STS primers as shown in Table 2. The reaction mixture, including 25 µL Taq Mix, 1 µL forward primer, 1 µL reverse primer, 2 µL genomic DNA, and 21 µL ddH2O, was prepared and the PCR was performed according to the following program: one cycle of 94°C for 5 min; 30 cycles of 94°C for 30 s, 54°C for 30 s, and 72°C for 30 s. After PCR, products were identified by 1% agarose gel electrophoresis, and images were gathered by Gel Imaging (Bio-Rad, USA).
Table 2.
STS primers used in this study
| Subtypes | STS primer | Product size (bp) | Sequences of primers | GenBank |
|---|---|---|---|---|
| 1 | SB83 | 351 | 5’-GAAGGACTCTCTGACGATGA-3’/5’-GTCCAAATGAAAGGCAGC-3’ | AF166086 |
| 2 | SB155 | 650 | 5’-ATCAGCCTACAATCTCCTC-3’/5’-ATCGCCACTTCTCCAAT-3’ | AF166087 |
| 3 | SB227 | 526 | 5’-AGGATTTGGTGTTTGGAGA-3’/5’-TTAGAAGTGAAGGAGATGGAAG-3’ | AF166088 |
| 4 | SB332 | 338 | 5’-GCATCCAGACTACTATCAACATT-3’/5’-CCATTTTCAGACAACCACTTA-3’ | AF166091 |
| 5 | SB340 | 704 | 5’-TGTTCTTGTGTCTTCTCAGCTC-3’/5’-TTCTTTCACACTCCCGTCAT-3’ | AY048752 |
| 6 | SB336 | 317 | 5’-GTGGGTAGAGGAAGGAAAACA-3’/5’-AGAACAAGTCGATGAAGTGAGAT-3’ | AY048751 |
| 7 | SB337 | 487 | 5’-GTCTTTCCCTGTCTATTCTGCA-3’/5’-AATTCGGTCTGCTTCTTCTG-3’ | AY048750 |
Identification of B. h different strains using EF-α primer by PCR
A total of 23 strains of unknown genotype B. h was chosen, including 11 strains of B. h of which did not identify using STS primers as above-mentioned, and 12 strains of unknown genotype B. h of which were come from the coastal region of the south of Guilin. As the above-mentioned, a total of 100 ng genomic DNA of B. h was used as a template to perform PCR assay using EF-α primers: 5’-TCTCTGGTACAAGGGACCCACTCTG-3’/5’-AATGTGAGCAGTGTGGCAATCC-3’. The reaction mixture, including 25 µL Taq Mix, 1 µL forward primer, 1 µL reverse primer, 2 µL genomic DNA, and 21 µL ddH2O, was prepared and the PCR was performed according to the following program: one cycle of 94°C for 5 min; 30 cycles of 94°C for 30 s, 54°C for 30 s, and 72°C for 30 s. After PCR, products were identified by 1% agarose gel electrophoresis, and images were gathered by Gel Imaging (Bio-rad, USA). Subsequently, the DNA bands were cut, and extracted by Gel Extraction Kit (OMEGA, Japan), and then performed direct sequencing.
Multiple sequences alignment using Cluster W/X and phylogenetic analysis
The above-validated EF-α DNA sequences of B. h were performed multiple sequences alignment to the DNA sequence of B. h different strains using Cluster W/X software, including C stain, E (G) strain, S stain and H strain. After then, the phylogenetic tree was imaged using the function of “Phylogeny” in the MEGA 7.0.21 software (http://www.megasoftware.net/download_form).
Statistical analysis
All data expressed as the mean ± standard deviation (SD). Statistical analysis was performed with one-way ANOVA using SPSS software (version 21.0, http://spss.en.softonic.com/; Chicago, IL, USA), and Student’s t-tests were performed in a group of two sample, and P < 0.05 and P < 0.01 were considered to indicate significant differences and highly significant differences, respectively.
Results
Epidemiological survey and microscopic examination
As exhibiting of Table 1, the B. h infection rate of boys was 14.74%, and the B. h infection rate of girls was 15.05%, and the total infection rate of B. h was 14.93%. After separation of B. h in faeces with the 3 generation anaerobic culture in vitro, the medium was orange red and translucent and floccule sediment was observed in the bottom of tube. After microscopic examination, B. h protozoon was well breed, and was appeared gemmipary (Figure 1).
Table 1.
B. h infection rate
| Grade | Examination | Infection | Infection rate (%) |
|---|---|---|---|
| Boys | 563 | 83 | 14.74 |
| Girls | 870 | 131 | 15.05 |
| Total | 1433 | 214 | 14.93 |
Figure 1.
Microscopic examination of B. h strain. The image indicated that B. h protozoon was well breed, and was appeared gemmipary.
Five genotypes of B. h were identified using STS primers
As PCR results exhibiting of Figure 2, in 53 samples, five genotypes of B. h were identified using 7 pairs STS primers (Table 2), including 4 strains of Type 1, 17 strains of Type 3, 4 strains of Type 4, 1 strains of Type 6, and 5 strains of Type 7, and did not found the Type 2, Type 5 and mixture genotypes, and appeared several obvious DNA bands, such as the 351 bp band of Type 1 in sample 27, 35, 44 and 46, the 526 bp band of Type 3 in sample 4, 8, 10, 13, 18, 19, 20, 21, 24, 25, 30, 31, 14, 32, 33, 36, 39 and 40, the 338 bp band of Type 4 in sample 16, 41, 42 and 43, the 317 bp band of Type 6 in sample 22, and the 487 bp band of Type 7 in sample 26, 29, 38, 47 and 48. In addition, a total of 22 strains of B. h had no any DNA bands, and belonged to the unknown genotypes B. h.
Figure 2.
Identification of the PCR products of STS in 53 samples by agarose gel electrophoresis. The image indicated that the feature STS DNA bands were amplified by PCR.
A total of 15 strains of B. h appeared characteristic DNA bands using EF-α primer
As PCR results exhibiting of Figure 3, in 23 samples of which was identified as unknown genotype, 15 strains appeared distinctive DNA bands using EF-α primers, such as sample 6, 7, 9, 11, 15, 28, 34, 37, 51, S2, S4, S5, S9, S11 and S12, and 8 strains did not appeared any DNA bands, and the DNA sequence was exhibited in Table 3 after sequencing.
Figure 3.
Identification of the PCR products of EF-1α in 23 samples by agarose gel electrophoresis. The image indicated that the feature EF-1α DNA bands were amplified by PCR.
Table 3.
DNA sequence of EF-1α in different strains of B. h after sequencing
| Number | DNA sequence | Note |
|---|---|---|
| 6 | > 6 | |
| CATGGAAACGGGAAAGTGCTCCGGTACTGCATTTGACAGCCAACTCGTGGGATGGTCTTCAGTTAAGGACCGGCTGCGGCAATTCCAGCACCATGCCTGCTCTCTGTAACCTTCATTTAACTTACTCTTCCCAGTCATCATCTTTAAATGTTTAATTCATACACACAGTATACCCCTAAACACCAAAAGATTCAACACCTTTTTGAAAATATTGATGTAAATTTAAATGATTTTAAGTTAAACTTGAGGATGGACATTTATAAGCGTCATCGTTATAATACTATAATAACCAATCATTCTATAAAGGAGCGATCATAATTGGATCTACACTTTTTAATCGGCCCTTTGGTCGGTGCTGTTATCGGTCTTATCACCAACGGGATTGCCACACTGCTCACATTA | ||
| 7 | > 7 | |
| GGCATGAGTTCTCAGTTAGGACCCTCGGTCCGCCCGATCGAGAAGCCGCTCCGCCTGCCCCTGCAGGACGTGTACAAGATCGGCGGTATCGGTACGGTGCCCGTGGGCCGCGTCGAGACCGGCGTCATGAAGCCCGGCGACGTCGTCTTCTTCGCCCCGTCCAACGTGACCACCGAGGTCAAGTCCATCGAGATGCACCACGAGCAGCTCGCTGAGGCCGTCCCCGGCGACAACGTTGGCTTCAACGTCAAGAACGTGTCCGTCAAGGACATCCGCCGTGGTAACGTGTGCTCCAACTCCAAGAACGACCCCGCCCGCGAGGCCGAGGACTTCACCGCCCAGGTCATCATCCTGAACCACCCCGGCCAGATCAGACGGCTACGCCCCCGTCCTGGATGCTCACATAAA | ||
| 9 | > 9 | |
| GGGGTACCAGCGTGATTCGCTGTATCCTCGGAGAGCTGATCGCCCACAAGCGCCGCCAGTGCTTCCGCCGCCGCAACCTTCATCTCCTCGTTAATATCACTGGCCCGCACATCAAAGGCTCCGCGGAAGATGCCGGGGAAGGCCAGCACATTGTTGATCTGGTTGGGATAATCACTGCGGCCAGTGGAAATGACCTTGGCACCGCCCGCTTTAGCCGCATCCGGGAAAATTTCCGGTGTTGGATTGCCACACGGCTCACATAAACGTATTCCCTTCATTCCCATCTCTGGATTCAACGGAGATAACATGTTGGAGCGCTCTGCGCATGTTGGAGCTCTCTGCGAACATGCCCTGGTACAAGGGACCCACTCTGATTGAAGCTCT | ||
| 11 | > 11 | |
| ATCCCAACCAGATCAACAATGTGCTGGCCTTCCCCGGCATCTTCCGCGGAGCCTTTGATGTGCGGGCCAGTGATATTAACGAGGAGATGAAGGTTGCGGCGGCGGAAGCACTGGCGGCGCTTGTGGGCGATCAGCTCTCCGAGGATTACATCATCCCCGCTGCTTTTGATCCCAGAGTGGGTCCCTTGGTACCAAAAAAGCTGAGGCCGTCCCCGGCGACAACGTTGGCTTCAACGTCAAGAACGTGTCCGTCAAGGACATCCGCCGTGGTAACGTGTGCTCCAACTCCAAGAACGACCCCGCCCGCGAGGCCGAGGACTTCACCGCCCAGGTGAACCACCCCGGCCAGATCAGCAACGGCTACGCCCCCGTCCTGGATTGCCACCTGGCCTCACATAA | ||
| 28 | > 28 | |
| CATGGAAACGGGAAAGTGCTCCGGTACTGCATTTGACAGCCAACTCGTGGGATGGTCTTCAGTTAAGGACCGGCTGCGGCAATTCCAGCACCATGCCTGCTCTCTGTAACCTTCATTTAACTTACTCTTCCCAGTCATCATCTTTAAATGTTTAATTCATACACACAGTATACCCCTAAACACCAAAAGATTCAACACCTTTTTGAAAATATTGATGTAAATTTAAATGATTTTAAGTTAAACTTGAGGATGGACATTTATAAGCGTCATCGTTATAATACTATAATAACCAATCATTCTATAAAGGAGCGATCATAATTGGATCTACACTTTTTAATCGGCCCTTTGGTCGGTGCTGTTCACATTACCCGGCCAGATCAGCAACGCCACCTGGCCTCACATTAACCACCTGGCCTTA | ||
| 34 | > 34 | |
| TGATATATGATATTAAAAGACGTTGCTGCCGCGGCATGGAAACGGGAAAGTGCTCCGGTACTGCATTTGACAGCCAACTCGTGGGATGGTCTTCAGTTAAGGACCGGCTGCGGCAATTCCAGCACCATGCCTGCTCTCTGTAACCTTCATTTAACTTACTCTTCCCAGTCATCATCTTTAAATGTTTAATTCATACACACAGTATACCTCATTCTATAAAGGAGCGATCATAATTGGATCTACACTTTTTAATCGGCCCTTTGGTCGGTGCTGTTATCGGTCTTATCACCAACGGGATTGCCACACTGCTCACATTATGTTGGAGCGCTCTGCGATTACGCAACATGTGTAATATGTGATTATGTGCTTGTATGCTCTACCTGATCAGCAACGCCACCTGGCCTCACATGC | ||
| 37 | > 37 | |
| TCGGGGTCATCTGGAATCCTGCCGGGTAAACAATTCTTGAAGCCCTGAATACGGACCTTGTCTGCGACGCCATCAACACCGCTATGCGCGAGCTGTTTTTACAGATCGTTTATGGCCGTACTCAGACAGCTTTCTCTGAAGATGGTCTTCCGGTCGGTGCTGGCCTTGAAGACCTGGGTAAAGGCTTGAGAAGCCAGGTTGGTACTATGTACGGTACACTGGCCAAAGGCCCGCGTTACCTGGAAATGGCAGAAGGTTACGTCACAAAAGTCGCTTTAAACGAAAAAGACGAAATCATCGGTTACGCTTGGAATCGGAAAGGGTATTCAGCCCATTTGTGATGAAAATGCGTGCTGGGCTTATACACTCGGCGCCAGCACTGGTCATCAAACGCGGTGCAAAAATGACGGCTGACG | ||
| 51 | > 51 | |
| GCGGTTGGCCGTCGTCAGCTAGGACCCCCGGTCCGCCCGATCGAGAAGCCGCTCCGCCTGCCCCTGCAGGACGTGTACAAGATCGGCGGTATCGGCACGGTGCCCGTGGGCCGCGTCGAGACCGGCGTCATGAAGCCCGGCGACGTCGTCTTCTTCGCCCCGTCCAACGTGACCACCGAGGTCAAGTCCATCGAGATGCACCACGAGCAGCTCGCTGAGGCCGTCCCCGGCGACAACGTTGGCTTCAACGTCAAGAACGTGTCCGTCAAGGACATCCGCCGTGGTAACGTGTGCTCCAACTCCAAGAACGACCCCGCCCGCGAGGCCGAGGACTTCACCGCCCAGGTCATCATCCTGAACCACCCCGGCCAGATCAGCAACGGCTACGCCCACTGCCTCACAATAAA | ||
| S2 | > S2 | |
| CATGGAATTGACAGCCAACTCGTGGGATGGTCTTCAAGAACGGTCAGACTCGTGAGCACGCTCTTCTTGCCAACACTATGGGAGTGAAGCAGATTATCTGCTGCGTGAACAAGATGGATGACAAGTCCGTGAACTCGTCCGAGGCTCGTTACAAGGAGATCAAGGCTGAGATGCCAGCTTCTTGACCACAGTCGGTTACCAGAAGGTGGAGGAGCGTATTCCCTTCATTCCCATCTCTGGATTCAACGGAGATAACATGTTGGAGCGCTCTGCGATAAAGGAGCGATCATAATTGGATCTACACTTTTTAATCGGCCCTTTGGTCGGTGCTGTTATCGGACACTGCTCACATTATCGGCCCTTTGGTCGGTGCTGTTATCGGACACTGCTCACATTA | ||
| S4 | > S4 | |
| GCGTACGCAGCGTACGCTATGTATCCATCGGAGAGCTGATCGCCCACAAGCGCCGCCAGTGCTTCCGCCGCCGCAACCTTCATCTCCTCGTTAATATCACTGGCCCGCACATCAAAGGCTCCGCGGAAGATGCCGGGGAAGGCCAGCACATTGTTGATCTGGTTGGGATAATCACTGCGGCCAGTGGAAATGACCTTGGCACCGCCCGCTTTAGCCGCATCCGGGAAAATTTCCGGTGTTGGATTGCCACACTGCTCACATTAACGTATTCCCTTCATTCCCATCTCTGGATTCAACGGAGATAACATGTTGGAGCGCTCTGCCGTTACGCTTTCGTACAGCTTGGCAAAATGATGGAAAACATCAAAAAGGGCATGGACCCGACGCCAGCACTGGTCATGCTGACG | ||
| S7 | > S7 | |
| CGGTTGGCGCCCGATCGAGAAGCCGCTCCGCCTGAACTTCGGTCAGACTCGTGAGCACGCTCTTCTTGCCAACACTCTGGGAGTGAAGCTCGTGATATACTGCGTGAACAAGATGGATGACAAGTCCGTGAACTACTCCGAGGCTCGTTACAAGGAGATCAAGGCTGAGATGCCAGCTTCTTGACCAAGGTCGGTTACCAGAAGGTGGAGCATCGTATTCCCTTCATTCCCATCTCTGGATTCAACGGAGATAACATGTTGGAGCGCTCTGGGTCCAAGAACGACCCCGCCCGCGAGGCCGAGGACTTCACCGCCCAGGTCATCATCCTGAACCACCCCGGCCATCAGCAACACCCCGTAAAACCCCGGCCATCAGCAACACCCCGTGAA | ||
| S11 | >S11 | |
| CATGGAAACGGGAAAGTGCTCCGGTACTGCATTTGACAGCCAACTCGTGGGATGGTCTTCAGTTAAGGACCGGCTGCGGCAATTCCAGCACCATGCCTGCTCTCTGTAACCTTCATTTAACTTACTCTTCCCAGTCATCATCTTTAAATGTTTAATTCATACACACAGTATACCCCTAAACACCAAAAGATTCAACACCTTTTTGAAAATATTGATGTAAATTTAAATGATTTTAAGTTAAACTTGAGGATGGACATTTATAAGCGTCATCGTTATAATACTATAATAACCAATCATTCTATAAAGGAGCGATCATAATTGGATCTACACTTTTTAATCGGCCCTTTGGTCGGTGCTGTTATCGGTCTTATCACCAACGGGATTGCCACACTGCTCACATTA | ||
| S12 | >S12 | |
| ATCCCAACCAGATCAACAATGTGCTGGCCTTCCCCGGCATCTTCCGCGGAGCCTTTGATGTGCGGGCCAGTGATATTAACGAGGAGATGAAGGTTGCGGCGGCGGAAGCACTGGCGGCGCTTGTGGGCGATCAGCTCTCCGAGGATTACATCATCCCCGCTGCTTTTGATCCCAGAGTGGGTCCCTTGGTACCAAAAAAGCTGAGGCCGTCCCCGGCGACAACGTTGGCTTCAACGTCAAGAACGTGTCCGTCAAGGACATCCGCCGTGGTAACGTGTGCTCCAACTCCAAGAACGACCCCGCCCGCGAGGCCGAGGACTTCACCGCCCAGGTGAACCACCCCGGCCAGATCAGCAACGGCTACGCCCCCGTCCTGGATTGCCACCTGGA |
EF-α had a higher homology in 13 strains of B. h, and highly conserved
After multiple sequence alignment (Figure 4), the 13 DNA sequences of B. h strains had a higher homology (70%). Evolutionarily, the EF-α DNA sequence of 13 samples was closer to that of the S and H strains of B. h (Table 4) as phylogenetic analysis (Figure 5).
Figure 4.
Multiple sequence alignment of the 13 DNA sequences of B. h strains. The images indicated that the 13 DNA sequences of B. h strains had a higher homology (70%).
Table 4.
DNA sequence of EF-1α in different strain of B. h
| Strain | DNA sequence of EF-1α | GeneBank |
|---|---|---|
| C | > C strain | |
| GCCGATGTTGCCATTCTGATCATTGCTGCCGGAACTGGAGAGTTCGAGGCTGGTTACGGAAAGAACGGTCAGACTCGTGAGCACGCTCTTCTTGCCAACACTCTGGGAGTGAAGCAGATGATCTGCTGCGTGAACAAGATGGATGACAAGTCCGTGAACTACTCCGAGGCTCGTTACAAGGAGATCAAGGCTGAGATGACCAGCTTCTTGACCAAGGTCGGTTACCAGAAGGTGGAGGAGCGTATTCCCTTCATTCCCATCTCTGGATTCAACGGAGATAACATGTTGGAGCGCTCTGCGAACATGCCCTGGTACAAGGGACCCACTCTGATTGAAGCTCTGGACAACATTCATCCTCCTAAGCGCCCTGTGGATAAGCCTCTGCGTCTTCCTCTGCAGGATGTGTACAAGATCGGAGGTATTGGTACAGTGCCTGTGGGCCGTGTGGAGACCGGTATCCTGAAGCCCGGTATGACCGTGACCTTCGCTCCCGTGGGTGTGACCACTGAAGTCAAGTCCGTGGAAATGCACCACGAGTCGATTCCTCAGGCTCTGCCCGGAGACAACGTCGGTTTCAACGTGAAGAACGTGTCTGTGAAGGACATTCACCGTGGAAACGTGTGCGGAGATGCCAAGAACGATCCTCCTTGCAGAGTGGAGTCGTTCACCGCTCAGGTCATTGTGATGAACCACCCCTCGGGTATTCGTCCTGGTTACTGCCCTGTGATGGATTGCCACACTGCTCACATTGCCTGCAAGTTCGAGAAGATCATGTCCGAGATGGATAAGCGTACCGGAAAGGTCCTGCGTGAGAACCCCGATATCGTCAAGAACGGAAAGTCCATGATGGCCGAGCTGGTGCCTTCCAAG | AF091355.2 | |
| E(G) | > E (G) strain | |
| GCCGATGTTGCCATTCTGATCATTGCTGCCGGAACTGGAGAGTTCGAGGCTGGTTACGGAAAGAACGGTCAGACTCGTGAGCACGCTCTTCTTGCCAACACTCTGGGAGTGAAGCAGATGATCTGCTGCGTGAACAAGATGGATGACAAGTCCGTGAACTACTCCGAGGCTCGTTACAAGGAGATCAAGGCTGAGATGACCAGCTTCTTGACCAAGGTCGGTTACCAGAAGGTGGAGGAGCGTATTCCCTTCATTCCCATCTCTGGATTCAACGGAGATAACATGTTGGAGCGCTCTGCTAACATGCCCTGGTACAAGGGACCCACTCTGATTGAAGCTCTGGACAACATTCATCCTCCTAAGCGCCCTGTGGATAAGCCTCTGCGTCTTCCTCTGCAGGATGTGTACAAGATCGGAGGTATTGGTACAGTGCCTGTGGGCCGTGTGGAGACCGGTATCCTGAAGCCCGGTATGACCGTGACCTTCGCTCCCGTGGGTGTGACCACTGAAGTCAAGTCCGTGGAAATGCACCACGAGTCGATTCCTCAGGCTCTGCCCGGAGACAACGTCGGTTTCAACGTGAAGAACGTGTCTGTGAAGGACATTCACCGTGGAAACGTGTGCGGAGATGCCAAGAACGATCCTCCTTGCAGAGTGGAGTCGTTCACCGCTCAGGTCATTGTGATGAACCACCCCTCGGGTATTCGTCCTGGTTACTGCCCTGTGATGGATTGCCACACTGCTCACATTGCCTGCAAGTTCGAGAAGATCATGTCCGAGATGGATAAGCGTACCGGAAAGGTCCTGCGTGAGAACCCCGATATCGTCAAGAACGGAAAGTCCATGATGGCCGAGCTGGTGCCTTCCAAG | AF091356.1 | |
| S | > S strain | |
| ATTCAACATGGGTAAGGAAAAGCCTCATATTAACCTGGTCGTCATTGGTCACGTCGTTGCCGGCAAGTCGACCACCACTGGTCACCTGATCTACGCTTGCGGTGGTATCGATAAGCGTACGATTGAGCGTTTTGAGGAAGGAGGCCAACGTATTGGTAAGGGCTCCTTCAAGTACGCGTGGGTGCTGGCCAAGATGAAGGCCGAGCGTGAGCGCGGTATCACCATCGATATTTCCCTGTGGAAGTTCGAGACGAGGAAGGACTTCTTCACCATCATCGATGCACCCGGTCACCGTGACTTCATAAAGAACATGATCACGGGTACCTCCCAGGCTGATGTGGCCATTCTGGTCATTGCCTCCGGCGCTGGTGAGTTCGAGGCCGGTTACTCGAAGAACGGTCAGACTCGCGAGCACGCTCTTCTTGCCAACACCCTGGGTGTGAAGCAGATGATCGTGTGCTGCAACAAGATGGATGACAAGTCCGTGAACTACTCCGAGGCTCGTTACAAGGAGATCAAGAACGAGATGACCTCCTTCCTGACGAAGGTCGGTTACGCGAAGGTGGAGGAGCGCATTCCTTTCATTCCCATCTCCGGGTTCAACGGTGATAACATGATTGAGCACTCCGCCAACATGCCTTGGTACAAGGGACCCACTCTGCTGGAGGCTCTGGACAACGTGCATCCTCCCAAGAGACCCGTGGACAAGCCGCTGCGTCTGCCCCTGCAGGATGTGTACAAGATTGGCGGTATTGGTACTGTGCCTGTGGGCCGTGTGGAGACGGGTGTGCTGAAGCCCGGCATGACCGTGACGTTCGCCCCCGTGAACGTGTCGACTGAAGTGAAGTCTGTGGAAATGCACCACGAGTCCATTCCTCAGGCCCTTCCCGGCGACAACGTGGGCTTCAACGTGAACAACGTGTCCGTGGAGGACATTCACCGCGGCAACGTGTGCGGTGACGCCAAGAACGATCCTCCTTGCAAGACCGAGTCCGACGCTCAGGTGATCGTGATGAACCACCCCTCGGGTATTCGTCCCGGCTACTGCCCTGTCGTGGATTGCCACACTGCTCACATTGCTTGCAAGTTCGAGAAGATCATGTCCGAGATGGACAAGCGTACTGGCAAGGTCCTCCGTGAGAACCCCGATATCGTGAAGAACGGCAAGTCCATGATGGCTCAGCTGGTTCCTTCCAAGCCCATGTGCGTGGAGACCTTCTCTGACTATCCTCCTCTTGGTCGTTTCGCTGTCCGTGATATGAGACAGACTGTCGCTGTCGGTATCATCAAGAGCACTGTCCGTGCCAAGTAAGTTGCGTCGGTGGT | D64080.1 | |
| H | > H strain | |
| GCTGATGTGGCCATTCTGGTCATCGCCTCCGGCGCTGGTGAGTTCGAGGCCGGTTACTCCAAGAACGGTCAGACTCGTGAGCACGCTCTTCTGGCTAACACCCTGGGTGTGAAGCAGATGATCGTGTGCTGCAACAAGATGGATGACAAGTCCGTGAACTACTCCGAGGCTCGTTACAAGGAGATCAAGAACGAGATGACCTCCTTCCTGACGAAAGTCGGTTACGCGAAGGTGGAGGAGCGCATTCCTTTCATTCCCATCTCCGGCTTCAACGGTGATAACATGATTGAGCACTCCGCCAACATGCCTTGGTACAAGGGACCCACTCTGCTGGAGGCTCTGGACAACGTGCATCCTCCCAAGAGACCCGTGGACAAGCCGCTGCGTCTGCCCCTGCAGGATGTGTACAAGATTGGCGGTATTGGTACTGTGCCTGTGGGCCGTGTGGAGACGGGTGTGCTGAAGCCCGGCATGACCGTGACGTTCGCCCCCGTGAACGTGTCGACTGAAGTGAAGTCTGTGGAAATGCACCACGAGTCCATTCCTCAGGCCCTTCCTGGCGACAACGTGGGCTTCAACGTGAAGAACGTGTCCGTGAAGGACATTCACCGCGGCAACGTGTGCGGTGACGCCAAGAACGATCCTCCTTGCAAGACGGAGTCCTTCGACGCTCAGGTGATCGTGATGAACCACCCCTCGGGTATTCGTCCCGGCTACTGCCTGTCGTGGATTGCCACACTGCTCACATTGCTTGCAAGTTCGAGAAGATCATGTCCGAGATGGACAAGCGTACCGGCAAGGTCCTCCGTGAGAACCCCGATATCGTGAAGAACGGCAAGTCCATGATGGCCATGCTGGTTCCTTCCAAG | AF090737.1 |
Figure 5.
Phylogenetic analysis of the 13 DNA sequences of B. h strains after sequencing and 4 strains of B. h strains. The images indicated that the EF-α DNA sequence of 13 samples was closer to that of the S and H strains of B. h.
Discussion
This study demonstrated that B. h had a higher infection rate in the students of Guangxi Medical University, and firstly identified 5 genotype of B. h using STS primers, including Type 1, 3, 4, 6, 7, and did not found Type 2, 5, and any mixture genotypes. Based on it, in 23 strains unknown genotype B. h, 13 strains was identified by PCR using EF-1α primers, and exhibited a closed evolutionary relationship to the EF-1α sequence of the S and H strains of B. h, and exhibited a significant application value on the phylogenetic analysis of B. h.
B. h is a single-celled intestinal parasite and widely distributed all over the world [23-26], and existed multiple stages in its life cycle with the morphological diversity [17,27,28], and therefore did not clearly distinguish its genetic difference in different population and different regions just based on the morphological structure of B. h, and a novel approach need to design. Based on the rapid developing of molecular technology, the genotype classification according to the genetic difference of gene or protein has been raised much more attention. With the STS primers used in the PCR in 1997 by Clark, et al, several genotypes of B. h were found [19]. In this study, seven features primers of STS were designed to distinguish the genotype of B. h in 53 samples, and 31 strains of B. h were amplified the features DNA bands, and belonged to 5 genotypes, including Type 1, 3, 4, 6, 7, and did not found Type 2, 5, and any mixture genotypes, and wherein the Type 3 was the most and included 17 strains of B. h. However, it was still 22 strains genotype did not distinguish, and we hypothesized that another genetic population may be existed in it if used a novel amplified primers.
The elongation factor-1 alpha (EF-1α) is a highly conserved ubiquitous protein that is involved in translation and is desirable for use in phylogenetic studies on Blastocystis, an enigmatic intestinal parasite with a contentious taxonomic position [21]. Therefore, the EF-1α full length fragment was chosen, and designed a pair of EF-1α primers to amplify the 421 bp length features bands. After PCR amplification using EF-1α primers in 23 strains unknown genotype of B. h, the 421 bp features bands was amplified in 13 strains, and these sequences had a higher homology (70%). In addition, after phylogenetic analysis, these DNA sequences of EF-1α was closer to that of the S and H strains of B. h, and indicated that the EF-1α primers could be used another phylogeny biomarker.
Acknowledgements
This research project was sponsored by supported by the National Natural Science Foundation of China (Grant No. 81360256) and the Guangxi Youth Science Foundation of China (Grant No. 2015GXNSFBA139137).
Disclosure of conflict of interest
None.
References
- 1.Won EJ, Kim SH, Kee SJ, Shin JH, Suh SP, Chai JY, Ryang DW, Shin MG. Multiplex real-time PCR assay targeting eight parasites customized to the Korean population: potential use for detection in diarrheal stool samples from gastroenteritis patients. PLoS One. 2016;11:e0166957. doi: 10.1371/journal.pone.0166957. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Speich B, Croll D, Furst T, Utzinger J, Keiser J. Effect of sanitation and water treatment on intestinal protozoa infection: a systematic review and meta-analysis. Lancet Infect Dis. 2016;16:87–99. doi: 10.1016/S1473-3099(15)00349-7. [DOI] [PubMed] [Google Scholar]
- 3.Macin S, Kaya F, Cagdas D, Hizarcioglu-Gulsen H, Saltik-Temizel IN, Tezcan I, Demir H, Erguven S, Akyon Y. Detection of parasites in children with chronic diarrhea. Pediatr Int. 2016;58:531–533. doi: 10.1111/ped.12959. [DOI] [PubMed] [Google Scholar]
- 4.Zierdt CH. Taxonomic status of Blastocystis hominis: reply. Parasitol Today. 1993;9:18. doi: 10.1016/0169-4758(93)90157-b. [DOI] [PubMed] [Google Scholar]
- 5.Jiang JB, He JG. Taxonomic status of Blastocystis hominis. Parasitol Today. 1993;9:2–3. doi: 10.1016/0169-4758(93)90148-9. [DOI] [PubMed] [Google Scholar]
- 6.Potaturkina-Nesterova NI, Il’ina NA, Bugero NV, Nesterov AS. Characteristics of factors of protozoa blastocystis hominis persistence. Bull Exp Biol Med. 2016;161:804–805. doi: 10.1007/s10517-016-3515-y. [DOI] [PubMed] [Google Scholar]
- 7.Duda A, Kosik-Bogacka D, Lanocha N, Szymanski S. [Blastocystis hominis- parasites or commensals?] . Ann Acad Med Stetin. 2014;60:23–28. [PubMed] [Google Scholar]
- 8.Verma R, Delfanian K. Blastocystis hominis associated acute urticaria. Am J Med Sci. 2013;346:80–81. doi: 10.1097/MAJ.0b013e3182801478. [DOI] [PubMed] [Google Scholar]
- 9.Jimenez OM, Carbonell AE, Garcia OM, Rodriguez LW, Triana FP, Fabian LG. [Blastocystis hominis in symptomatic celiac patients] . Acta Gastroenterol Latinoam. 2012;42:175–181. [PubMed] [Google Scholar]
- 10.Zuel-Fakkar NM, Abdel Hameed DM, Hassanin OM. Study of Blastocystis hominis isolates in urticaria: a case-control study. Clin Exp Dermatol. 2011;36:908–910. doi: 10.1111/j.1365-2230.2011.04127.x. [DOI] [PubMed] [Google Scholar]
- 11.Yakoob J, Abbas Z, Beg MA, Naz S, Awan S, Hamid S, Jafri W. In vitro sensitivity of Blastocystis hominis to garlic, ginger, white cumin, and black pepper used in diet. Parasitol Res. 2011;109:379–385. doi: 10.1007/s00436-011-2265-z. [DOI] [PubMed] [Google Scholar]
- 12.Trabelsi S, Ali IB, Khaled S. [Clinical and epidemiological characteristics of blastocystis hominis] . Tunis Med. 2010;88:190–192. [PubMed] [Google Scholar]
- 13.Elwakil HS, Talaat RM. Genetic analysis of Blastocystis hominis isolated from symptomatic and asymptomatic human hosts in Egypt. J Egypt Soc Parasitol. 2009;39:99–109. [PubMed] [Google Scholar]
- 14.Suresh K, Venilla GD, Tan TC, Rohela M. In vivo encystation of Blastocystis hominis. Parasitol Res. 2009;104:1373–1380. doi: 10.1007/s00436-009-1340-1. [DOI] [PubMed] [Google Scholar]
- 15.Ustun S, Turgay N. [Blastocystis hominis and bowel diseases] . Turkiye Parazitol Derg. 2006;30:72–76. [PubMed] [Google Scholar]
- 16.Sio SW, Puthia MK, Lee AS, Lu J, Tan KS. Protease activity of Blastocystis hominis. Parasitol Res. 2006;99:126–130. doi: 10.1007/s00436-006-0131-1. [DOI] [PubMed] [Google Scholar]
- 17.Nascimento SA, Moitinho Mda L. Blastocystis hominis and other intestinal parasites in a community of Pitanga city, Parana state, Brazil. Rev Inst Med Trop Sao Paulo. 2005;47:213–217. doi: 10.1590/s0036-46652005000400007. [DOI] [PubMed] [Google Scholar]
- 18.Zhan TZ, Liu T, Shi HH, He SS, Yan H, Liu DY. [PCR-based genotype classification of Blastocystis hominis isolates from college students of Guangxi] . Zhongguo Ji Sheng Chong Xue Yu Ji Sheng Chong Bing Za Zhi. 2014;32:209–211. [PubMed] [Google Scholar]
- 19.Clark CG. Extensive genetic diversity in Blastocystis hominis. Mol Biochem Parasitol. 1997;87:79–83. doi: 10.1016/s0166-6851(97)00046-7. [DOI] [PubMed] [Google Scholar]
- 20.Yoshikawa H, Nagano I, Wu Z, Yap EH, Singh M, Takahashi Y. Genomic polymorphism among Blastocystis hominis strains and development of subtype-specific diagnostic primers. Mol Cell Probes. 1998;12:153–159. doi: 10.1006/mcpr.1998.0161. [DOI] [PubMed] [Google Scholar]
- 21.Nakamura Y, Hashimoto T, Yoshikawa H, Kamaishi T, Nakamura F, Okamoto K, Hasegawa M. Phylogenetic position of Blastocystis hominis that contains cytochrome-free mitochondria, inferred from the protein phylogeny of elongation factor 1 alpha. Mol Biochem Parasitol. 1996;77:241–245. doi: 10.1016/0166-6851(96)02600-x. [DOI] [PubMed] [Google Scholar]
- 22.Ho LC, Singh M, Suresh K, Ng GC, Yap EH. A study of the karyotypic patterns of Blastocystis hominis by pulsed-field gradient electrophoresis. Parasitol Res. 1994;80:620–622. doi: 10.1007/BF00933012. [DOI] [PubMed] [Google Scholar]
- 23.Zhang HW, Li W, Yan QY, He LJ, Su YP. [Impact of blastocystis hominis infection on ultrastructure of intestinal mucosa in mice] . Zhongguo Ji Sheng Chong Xue Yu Ji Sheng Chong Bing Za Zhi. 2006;24:187–191. [PubMed] [Google Scholar]
- 24.Gupta R, Parsi K. Chronic urticaria due to Blastocystis hominis. Australas J Dermatol. 2006;47:117–119. doi: 10.1111/j.1440-0960.2006.00244.x. [DOI] [PubMed] [Google Scholar]
- 25.Windsor JJ, Bamber AI, Macfarlane L. Detection of Dientamoeba fragilis and Blastocystis hominis using a simple staining method. Br J Biomed Sci. 2006;63:27–28. doi: 10.1080/09674845.2006.11978087. [DOI] [PubMed] [Google Scholar]
- 26.Yaicharoen R, Sripochang S, Sermsart B, Pidetcha P. Prevalence of Blastocystis hominis infection in asymptomatic individuals from Bangkok, Thailand. Southeast Asian J Trop Med Public Health. 2005;36(Suppl 4):17–20. [PubMed] [Google Scholar]
- 27.Andiran N, Acikgoz ZC, Turkay S, Andiran F. Blastocystis hominis--an emerging and imitating cause of acute abdomen in children. J Pediatr Surg. 2006;41:1489–1491. doi: 10.1016/j.jpedsurg.2006.04.037. [DOI] [PubMed] [Google Scholar]
- 28.Khan ZA, Alkhalife IS. Prevalence of Blastocystis hominis among “healthy” food handlers in Dammam, Saudi Arabia. J Egypt Soc Parasitol. 2005;35:395–401. [PubMed] [Google Scholar]