Abstract
Although bone involvement is reported as uncommon in hepatocellular carcinoma (HCC), its incidence has significantly increased in the last decade due to the longer survival of HCC patients related to recent progresses made both in the diagnosis and treatment of the disease. A better understanding of the pathogenic mechanisms underlying the spread of bone metastases in HCC is important. The primary tumor and its corresponding metastases are different at the molecular marker expression or gene status levels and that these differences may affect the clinical outcome of anticancer therapy, particularly in molecularly targeted therapies for the treatment of cancer. No study has investigated the genetic heterogeneity between HCC and paired bone metastasis. In this study, we investigated the genetic heterogeneity in HCC and paired metastasis using a next generation sequencing (NGS) platform to illustrate the molecularly targeted therapy related genes mutations.
Keywords: Hepatocellular carcinoma, bone metastasis, genetic heterogeneity, next generation sequencing
Introduction
Liver cancer in men is the fifth most frequently diagnosed cancer worldwide but the second most frequent cause of cancer death. In women, it is the seventh most commonly diagnosed cancer and the sixth leading cause of cancer death. Half of these cases and deaths were estimated to occur in China [1]. Among primary liver cancers, hepatocellular carcinoma (HCC) represents the major histological subtype, accounting for 70% to 85% of the total liver cancer burden worldwide [2]. The primary risk factor for HCC is liver injury from diverse causes that leads to hepatic cirrhosis in most patients. An estimated 78% of HCC cases and 57% of cases of liver cirrhosis are caused by chronic infection with hepatitis B virus (HBV) or hepatitis C virus (HCV) [2,3]. HCC is the sixth most prevalent cancer worldwide and the third leading cause of cancer-related death, although its geographical distribution is heterogeneous with the highest incidence in sub-Saharan Africa and Eastern Asia [4]. Bone is an uncommon site of metastasis in HCC, with the incidence ranging from 3% to 20% [5]. Although bone involvement is reported as uncommon in HCC, its incidence has significantly increased in the last decade due to the longer survival of HCC patients related to recent progresses made both in the diagnosis and treatment of the disease [5-7].
A better understanding of the pathogenic mechanisms underlying the spread of bone metastases in HCC is important. Some retrospective studies have described the characteristics of bone metastasis from HCC [5,8-10]. However, few data are yet available about bone involvement in patients with HCC, and no agreement has yet been reached about the treatment strategy for extrahepatic HCC metastases. The nature and the characteristics of bone metastases in HCC have not been fully explored in literature, presumably because HCC skeletal involvement was rarely diagnosed.
Intratumor heterogeneity is a recognized characteristic of human tumors, and occurs on multiple levels, such as the genetic (detected by the method of mutation analysis), protein (detected by the method of immunohistochemical analysis) and macroscopic level in a wide range of tumors, such as breast, colorectal (CRC), non-small cell lung (NSCLC), prostate, ovarian, pancreatic, gastric, and brain cancer and renal clear cell carcinoma. In recent years, many studies have focused on the heterogeneity found in primary tumors and related metastases with the consideration that evaluation of metastatic rather than primary sites could be of clinical relevance. Numerous reports have evaluated the genetic heterogeneity in primary tumors and corresponding metastases in a range of solid tumors such as breast cancer [11], CRC [12] and NSCLC [13]. As discussed earlier, the primary tumor and its corresponding metastases are different at the molecular marker expression or gene status levels and that these differences may affect the clinical outcome of anticancer therapy, particularly in molecularly targeted therapies for the treatment of cancer [14,15]. Monaco et al. suggested that the EGFR and KRAS status of primary lung carcinomas might not predict the status in the corresponding metastases. Their observation may have important implications for molecular testing for EGFR-targeted therapies [16]. A retrospective study investigated the role of PTEN loss, AKT phosphorylation and KRAS mutations in primary colorectal tumors and their corresponding metastases on the activity of cetuximab plus irinotecan [17]. This study gave us direct evidence to reveal that the genetic heterogeneity in primary colorectal tumors and their corresponding metastases have different responses to molecularly targeted therapy.
However, no study has investigated the genetic heterogeneity between HCC and paired bone metastasis. Here, we hypothesize that there is genetic heterogeneity between HCC and paired bone metastasis, which might result in the therapeutic failure of molecularly targeted therapy for treatment of HCC bone metastasis. In this study, we investigated the genetic heterogeneity in HCC and paired metastasis using a next generation sequencing (NGS) platform to illustrate the molecularly targeted therapy related genes mutations.
Patients and methods
Patients and tumor tissue samples
The institutional ethical committee approved the current retrospective study. A written informed consent was obtained for both two patients. We reviewed the electronic medical records of consecutive patients in whom HCC and metachronous bone metastasis was newly diagnosed from January 2009 to October 2014 at the Department of Orthopedics, the First Affiliated Hospital, Zhejiang University School of Medicine (Table 1). The diagnosis of HCC was mainly based on recommendations of the American Association for the Study of Liver Diseases [18]. Both patients underwent blood investigations, which included complete blood count, liver function tests, and tests for viral markers of hepatitis B and C infection. Serum alpha-fetoprotein (AFP) was estimated using a particle enzyme immunoassay (Axsym System; Abbott Laboratories, Abbot Park, Illinois, USA; normal value <20 ng/ml). Upper gastrointestinal endoscopy was done in each case to detect the presence of esophageal varices. Patients with underlying cirrhosis were classified into Child’s A, B or C based on the Child-Pugh classification [19]. Staging of HCC was done based on the Barcelona Clinic Liver Cancer (BCLC) staging protocol [20]. Both patients were evaluated pre-operatively using abdominal computed tomographic (CT) scan, magnetic resonance imaging (MRI), or fluorine-13 fluorodeoxyglucose positron emission tomography/computed tomographic scan (18F-FDG PET/CT).
Table 1.
Clinical characteristics of two hepatocellular carcinoma patients with metachronous bone metastasis received surgery
| Patient 1 | Patient 2 | |
|---|---|---|
| Gender (Male/Female) | Male | Male |
| Age (Years) | 39 | 58 |
| AFP level (ng/ml) | 8.4 | 27.1 |
| ALT (IU/L) | Not available | Not available |
| AST (IU/L) | Not available | Not available |
| HBV | Positive | Positive |
| HCV | Negative | Negative |
| BCLC staging (A/B/C) | Not available | A |
| Child’s score (A/B/C) | Not available | A |
| Hepatocellular carcinoma (number of masses) | 2 | 2 |
| Bone metastases | Metachronous | Metachronous |
| Overall survival (months) | 57.5 | 42.3 |
| Chemotherapy. (Yes/No) | Yes | Not available |
| Radiotherapy (Yes/No) | Yes | No |
| Molecularly targeted therapy (Yes/No) | Yes | No |
| Primary tumor ID | 10-13656-1 | 10-42240-1 |
| Metastatic tumor ID | 12-60901-3 | 13-39592-3 |
Abbreviations: HBV, hepatitis B virus infection. HCV, hepatitis C virus infection. AST, aspartate aminotransferase. ALT, aspartate aminotransferase. AFP, alpha-fetoprotein. BCLC staging, Barcelona clinic liver cancer staging.
DNA extraction
Formalin-fixed paraffin-embedded (FFPE) tissues were sectioned, and hematoxylin and eosin (H&E) stained slides were reviewed by one surgical pathologist (FL) to confirm the tumor content in each section. Ten serial sections (4 μm) were cut from selected tissue areas with tumor tissue were microdissected from those slides using the H&E slides as templates. The pathologic diagnosis of each case was confirmed on routine H&E slides. All samples sent for DNA extraction contained a minimum of 20% DNA derived from tumor cells. The tissues were deparaffinized with 1 mL xylene at 56°C for 10 min, washed with 1 mL 100% ethanol for 5 min at RT, and then dried at 37°C for 10 min. QIAamp DSP DNA FFPE tissue kit (Qiagen, Valencia, CA, USA) was used to extract the genomic DNA from FFPE samples. DNA concentration was determined by Qubit dsDNA HS assay kit on the Qubit Fluorometer according to the manufacturing protocol (Life Technologies, Carlsbad, CA, USA). DNA quality (A260/280 and A260/230) was measured by Nanodrop 2000 (Thermo Fisher Scientific, Waltham, MA, USA).
Library construction
Sequencing library was prepared by Illumina TruSeq DNA PCR-Free Sample Preparation Kit (Illumina, San Diego, CA, USA) according to the manufacturing protocol. In brief, genomic DNA sample was fragmented into 350 or 550 bp in AFA fiber snap-cap microTUBE using Covaris M220 (Covaris, Woburn, MA, USA). End repair and size selection were performed according to the fragment size, followed by 30 end adenylation. Finally, multiple indexing adapters were ligated to the ends of the DNA fragments. Library concentration was determined using Qubit according to the manufacturing protocol. For low DNA input samples, PCR-free library was further amplified with Illumina p5 (AATGATACGGCGACCACCGA) and p7 (CAAGCAGAAGACGGCATACGA) primers in NEB Next High-Fidelity 2XPCR Master Mix (NEB, Ipswich, MA, USA).
Hybrid capture and ultra-deep next generation sequencing
The 5’-biotinylated probe solution is provided as capture probes, the baits target 416 cancer-related genes. 1 μg of each DNA-fragment sequencing library is mixed with 5 μg of human Cot-1 DNA, 5 μg of salmon sperm DNA, and 1 unit adaptor-specific blocker DNA in hybridization buffer, heated for 10 minutes at 95°C, and held for 5 minutes at 65°C in the thermocycler. Within 5 minutes, the capture probes are added to the mixture, and the solution hybridization is performed for 16-18 hours at 65°C. After hybridization is complete, the captured targets are selected by pulling down the biotinylated probe/target hybrids using streptavidin-coated magnetic beads, and off-target library is removed by washing with wash buffer. The PCR master mix is added to directly amplify (6-8 cycles) the captured library from the washed beads. After amplification, the samples are purified by AMPure XP beads, quantified by qPCR (KAPA Biosystems, Boston, MA, USA) and sized on bioanalyzer 2100 (Agilent Technologies, Santa Clara, CA, USA). Libraries are normalized to 2.5 nM and pooled. Deep Sequencing is performed on Illumina HiSeq 4000 using PE75 V1 Kit. Cluster generation and sequencing is performed according to manufacturer’s protocol.
Sequence alignment and processing
Quality control (QC) was applied with Trimmomatic 1. High quality reads were mapped to the human genome (hg19, GRCh37 Genome Reference Consortium Human Reference 37) using modified BWA aligner 0.7.12 2 with BWA-MEM algorithm and default parameters to create SAM files. Picard 1.119 (http://picard.sourceforge.net/) was used to convert SAM files to compressed BAM files which were then sorted according to chromosome coordinates. The Genome Analysis Toolkit 3 (GATK, version 3.4-0) was modified and used to locally realign the BAMs files at intervals with indel mismatches and recalibrate base quality scores of reads in BAM files.
Validation of SNPs/Indels and CNVs
Single nucleotide variants (SNVs) and short insertions/deletions (indels) were identified using VarScan 2 2.3.9 4 with minimum variant allele frequency threshold set at 0.01 and p-value threshold for calling variants set at 0.05 to generate Variant Call Format (VCF) files. All SNVs/indels were annotated with ANNOVAR, and each SNV/indel was manually checked with the Integrative Genomics Viewer (IGV) 5. Copy number variations (CNVs) were identified using ADTEx 1.0.4 6.
Data collection and follow-up
The clinical, laboratory, and radiologic records of the two patients were retrospectively reviewed (Table 1). Liver function tests were checked in the patients every three months in order to evaluate hepatic functional reserve. The results of two HCC patients with metachronous bone metastasis were analyzed. Follow-up cross-sectional imaging (contrast-enhanced CT or MRI) was performed one month after treatment. Further treatments were based on clinical evaluation, laboratory values and imaging response. Patients were followed-up every 3 months. The patients were followed up until death or until the date of last follow-up. Follow-up was finished on February 28, 2015.
Results
HCC primary tumor (sample number: 10-13656-1) detected gene mutations
We analyzed fifty molecularly targeted therapy related genes (Table 2) to illustrate the genetic heterogeneity in HCC and paired metastasis using a next generation sequencing (NGS) platform as described in Materials and Methods. HCC primary tumor (sample number: 10-13656-1) involves 15 mutant genes, 30 independent mutation sites, and an average mutation frequency of 11.1% (Table 3).
Table 2.
Fifty known cancer genes
| Gene name | ||||
|---|---|---|---|---|
| ABL1 | EGFR | GNAQ | KRAS | PTPN11 |
| AKT1 | ERBB2 | GNAS | MET | RB1 |
| ALK | ERBB4 | HNF1A | MLH1 | RET |
| APC | EZH2 | HRAS | MPL | SMAD4 |
| ATM | FBXW7 | IDH1 | NOTCH1 | SMARCB1 |
| BRAF | FGFR1 | IDH2 | NPM1 | SMO |
| CDH1 | FGFR2 | JAK2 | NRAS | SRC |
| CDKN2A | FGFR3 | JAK3 | PDGFRA | STK11 |
| CSF1R | FLT3 | KDR | PIK3CA | TP53 |
| CTNNB1 | GNA11 | KIT | PTEN | VHL |
Table 3.
Hepatocellular carcinoma primary tumor (sample number: 10-13656-1) detected gene mutations
| Gene symbol | Mutation site | Amino acid change | Sequencing Depth | Mutation frequency |
|---|---|---|---|---|
| STK11 | c.465-17G>A | 1430 | 7.55% | |
| FGFR3 | c.1974G>A | p.Leu658Leu | 1210 | 7.36% |
| FGFR3 | c.1977C>T | p.Pro659Pro | 1258 | 7.79% |
| FGFR3 | c.1974G>A | p.Leu658Leu | 1210 | 7.36% |
| FGFR3 | c.1977C>T | p.Pro659Pro | 1258 | 7.79% |
| GNA11 | c.736_737insA | 1071 | 6.72% | |
| GNA11 | c.735+7_735+8insA | 1071 | 6.72% | |
| TP53 | c.1018A>G | p.Met340Val | 2807 | 13.36% |
| VHL | c.464-25G>A | 3425 | 8.76% | |
| JAK3 | c.420+51_420+50insGG | 1414 | 5.37% | |
| JAK3 | c.420+42_420+41insA | 1390 | 5.32% | |
| JAK3 | c.415G>A | p.Ala139Thr | 2656 | 5.42% |
| KRAS | c.116C>T | p.Ser39Phe | 3491 | 8.42% |
| ALK | c.3628G>A | p.Glu1210Lys | 2187 | 22.04% |
| SRC | c.*92G>A | 1995 | 16.74% | |
| ERBB2 | c.2501G>A | p.Ser834Asn | 2652 | 5.51% |
| ERBB2 | c.2506C>T | p.Leu836Leu | 2579 | 5.62% |
| SMAD4 | c.455G>A | 9800 | 22.69% | |
| SMAD4 | c.454+5G>A | 9800 | 22.69% | |
| SMAD4 | c.955+19T>C | 5736 | 6.17% | |
| SMAD4 | c.1551C>T | p.Ser517Ser | 7742 | 15.37% |
| KIT | c.232_233delAA | p.Lys78fs | 1171 | 6.23% |
| KIT | c.1681G>A | p.Glu561Lys | 3557 | 5.17% |
| KDR | c.795G>A | p.Ser265Ser | 2876 | 8.48% |
| GNAS | c.2532T>C | p.Arg844Arg | 8144 | 7.81% |
| ATM | c.1803C>T | 5740 | 13.33% | |
| ATM | c.1803-8C>T | 5740 | 13.33% | |
| ATM | c.7328_7329insT | p.Arg2443_Glu2444fs | 7768 | 5.69% |
| ATM | c.7332_7333delGC | p.Glu2444fs | 7720 | 5.53% |
HCC bone metastasis (sample number: 12-60901-3) detected gene mutations
HCC bone metastasis (sample number: 12-60901-3) involves 18 mutant genes, 27 independent mutation sites, and an average mutation frequency of 12.34% (Table 4).
Table 4.
Hepatocellular carcinoma bone metastasis (sample number: 12-60901-3) detected gene mutations
| Gene symbol | Mutation site | Amino acid change | Sequencing Depth | Mutation frequency |
|---|---|---|---|---|
| HRAS | c.-15G>A | 5301 | 37.94% | |
| HRAS | c.-21G>A | 5329 | 37.27% | |
| STK11 | c.816C>T | p.Tyr272Tyr | 8705 | 40.69% |
| FGFR3 | c.1190T>C | p.Leu397Pro | 1541 | 12.07% |
| GNA11 | c.889+49G>T | 2138 | 72.83% | |
| GNA11 | c.889+61_889+62insCA | 2183 | 9.89% | |
| TP53 | c.1101G>A | 4077 | 14.62% | |
| TP53 | c.1100+7G>A | 4077 | 14.62% | |
| VHL | c.346C>T | p.Leu116Phe | 6318 | 6.38% |
| VHL | c.426T>C | p.Val142Val | 6382 | 6.71% |
| JAK3 | c.415G>A | p.Ala139Thr | 2656 | 5.42% |
| FLT3 | c.2053+87delC | 1674 | 6.57% | |
| ERBB2 | c.2308G>A | 9077 | 12.49% | |
| ERBB2 | c.2307+1G>A | 9077 | 12.49% | |
| SMAD4 | c.1591C>T | p.Arg531Trp | 13368 | 5.22% |
| KDR | c.3984G>A | p.Lys1328Lys | 8372 | 5.22% |
| CDH1 | c.1021T>C | p.Tyr341His | 8831 | 6.87% |
| CDH1 | c.1047C>T | p.Asp349Asp | 8666 | 7.74% |
| GNAQ | c.953C>T | p.Pro318Leu | 11157 | 6.63% |
| AKT1 | c.75C>T | p.Arg25Arg | 3671 | 15.94% |
| APC | c.2684C>T | p.Ser895Leu | 14562 | 5.60% |
| APC | c.4073C>T | p.Ala1358Val | 16662 | 6.74% |
| APC | c.4081C>T | p.Pro1361Ser | 16706 | 6.60% |
| HNF1A | c.737T>C | p.Val246Ala | 5033 | 5.03% |
| SMO | c.566G>A | p.Ser189Asn | 3754 | 10.07% |
| NOTCH1 | c.5120C>T | p.Ala1707Val | 7070 | 21.19% |
| NOTCH1 | c.4715G>A | p.Gly1572Asp | 4258 | 13.69% |
Genes mutations detected in HCC primary tumor (sample number: 10-13656-1) and its paired bone metastasis (sample number: 12-60901-3)
HCC primary tumor (sample number: 10-13656-1) and paired bone metastasis (sample number: 12-60901-3) identified 15 common mutant genes. Ten unique mutations in the primary cancer were identified. We found 7 unique mutations in metastatic cancer, including 2 genes, which are different from mutations in the primary mutation. Five new mutations were only found in metastatic site (Table 5).
Table 5.
Genes mutations detected in hepatocellular carcinoma primary tumor (sample number: 10-13656-1) and its paired bone metastasis (sample number: 12-60901-3)
| Number | Mutant genes in HCC primary tumor and bone metastasis | Mutant genes in HCC primary tumor | Mutant genes in HCC bone metastasis |
|---|---|---|---|
| 1 | ABL1 | ALK | AKT1 |
| 2 | ATM | APC | |
| 3 | CTNNB1 | FGFR3 | CDH1 |
| 4 | EGFR | GNAS | HNF1A |
| 5 | ERBB2 | KDR | NOTCH1 |
| 6 | ERBB4 | KIT | SMAD4* |
| 7 | FLT3 | KRAS | VHL* |
| 8 | GNA11 | SMAD4 | |
| 9 | GNAQ | SRC | |
| 10 | HRAS | STK11 | |
| 11 | JAK3 | VHL | |
| 12 | NPM1 | ||
| 13 | NRAS | ||
| 14 | SMO | ||
| 15 | TP53 |
The same mutant genes with different mutation sites in hepatocellular carcinoma primary tumor and bone metastasis.
HCC primary tumor (sample number: 10-42240-1) detected gene mutations
HCC primary tumor (sample number: 10-42240-1) involves 19 mutant genes, 32 independent mutation sites, and an average mutation frequency of 13.81% (Table 6).
Table 6.
Hepatocellular carcinoma primary tumor (sample number: 10-42240-1) detected gene mutations
| Gene symbol | Mutation site | Amino acid change | Sequencing Depth | Mutation frequency |
|---|---|---|---|---|
| TP53 | c.504C>A | p.His168Gln | 2566 | 5.85 |
| TP53 | c.501_502insG | p.Gln167_His168fs | 8.38 | |
| VHL | c.484T>C | p.Cys162Arg | 3256 | 5.04 |
| ERBB2 | c.2310A>G | 2302 | 8.95 | |
| ERBB2 | c.2310A>G | p.Glu770Glu | 2302 | 8.95 |
| ERBB2 | c.2498T>C | p.Met833Thr | 2937 | 11.68 |
| FGFR1 | c.839-15T>C | 1877 | 9.59 | |
| PDGFRA | c.2003G>A | p.Gly668Asp | 2752 | 6.29 |
| PDGFRA | c.2003G>A | 2752 | 6.29 | |
| EGFR | c.286G>A | p.Val96Met | 4311 | 11.53 |
| EGFR | c.2184+63delC | 1260 | 14.29 | |
| KIT | c.2597T>C | 2263 | 9.68 | |
| KIT | c.2596+2T>C | 2263 | 9.68 | |
| KDR | c.3496G>A | p.Ala1166Thr | 2746 | 10.31 |
| KDR | c.2962G>A | p.Glu988Lys | 2143 | 27.2 |
| GNAQ | c.650T>C | p.Ile217Thr | 10582 | 7.4 |
| GNAQ | c.496C>T | p.Arg166Cys | 2698 | 13.86 |
| ATM | c.5918+37T>C | 2371 | 18.52 | |
| ATM | c.7328G>A | p.Arg2443Gln | 7559 | 14.14 |
| APC | c.2674G>A | p.Glu892Lys | 8094 | 10.49 |
| PTPN11 | c.1448C>T | 4161 | 12.62 | |
| PTPN11 | c.1448-8C>T | 4161 | 12.62 | |
| MET | c.2986C>T | p.Pro996Ser | 28255 | 17.48 |
| FGFR2 | c.880G>A | p.Val294Met | 4164 | 17.65 |
| SMO | c.654G>A | p.Gln218Gln | 4469 | 6.58 |
| SMO | c.1264+41A>G | 2321 | 69.19 | |
| SMO | c.1599C>T | p.Ser533Ser | 4612 | 22.61 |
| ABL1 | c.1010T>C | p.Met337Thr | 5156 | 6.92 |
| ABL1 | c.1143-44A>T | 1067 | 6.28 | |
| PIK3CA | c.2719G>A | p.Ala907Thr | 5771 | 8.14 |
| ERBB4 | c.884-23A>T | 1163 | 5.93 | |
| ERBB4 | c.764G>A | p.Ser255Asn | 4417 | 28.59 |
HCC bone metastasis (sample number: 13-39592-3) detected gene mutations
HCC bone metastasis (sample number: 1339592-3) involves 10 mutant genes, 32 independent mutation sites, and an average mutation frequency of 9.19% (Table 7).
Table 7.
Hepatocellular carcinoma bone metastasis (sample number: 13-39592-3) detected gene mutations
| Gene symbol | Mutation site | Amino acid change | Sequencing Depth | Mutation frequency |
|---|---|---|---|---|
| PDGFRA | c.1958C>T | p.Pro653Leu | 1415 | 9.47 |
| PDGFRA | c.1960_1961insT | p.His654_Leu655fs | 10.22 | |
| PDGFRA | c.1962T>C | p.His654His | 1432 | 10.27 |
| PDGFRA | c.1966A>C | p.Asn656His | 1433 | 9.84 |
| EGFR | c.391G>A | p.Gly131Arg | 3743 | 7.59 |
| EGFR | c.2539A>G | p.Thr847Ala | 2582 | 6.51 |
| KIT | c.222_223insA | p.Thr74_Asn75fs | 7.08 | |
| KIT | c.223A>T | p.Asn75Tyr | 1080 | 9.35 |
| KIT | c.226_227insA | p.Glu76_Asn77fs | 8.87 | |
| KIT | c.229A>C | p.Asn77His | 1108 | 8.66 |
| KIT | c.230A>G | p.Asn77Ser | 1103 | 9.16 |
| KIT | c.1740C>T | p.His580His | 7062 | 9.8 |
| KDR | c.3405G>A | 2008 | 17.53 | |
| KDR | c.3405-1G>A | 17.53 | ||
| KDR | c.795G>A | p.Ser265Ser | 1445 | 8.37 |
| GNAQ | c.477-30G>A | 8.26 | ||
| GNAQ | c.477-42G>A | 8.58 | ||
| PTEN | c.926_927insCC | p.Ala309_Asp310fs | 7.36 | |
| PTEN | c.928G>C | p.Asp310His | 8209 | 7.53 |
| PTEN | c.931A>C | p.Asn311His | 12188 | 5.03 |
| APC | c.2697C>T | p.Thr899Thr | 6481 | 7.36 |
| MET | c.3757T>C | p.Tyr1253His | 15747 | 10.48 |
| MET | c.3790C>T | p.Pro1264Ser | 15146 | 7.16 |
| MET | c.3793G>A | p.Val1265Met | 15509 | 12.41 |
| FBXW7 | c.1443C>T | p.Ala481Ala | 3967 | 5.14 |
| FBXW7 | c.843_844insA | p.Ile281_Ser282fs | 8.29 | |
| FBXW7 | c.828_832delTCAAC | p.Phe276fs | 1710 | 6.08 |
| FBXW7 | c.826T>G | p.Phe276Val | 1718 | 8.56 |
| ERBB4 | c.2825C>T | p.Pro942Leu | 1901 | 6 |
| ERBB4 | c.1091G>A | p.Gly364Glu | 6467 | 21.97 |
| ERBB4 | c.884-20T>C | 5.51 | ||
| ERBB4 | c.831C>T | p.His277His | 7092 | 12.11 |
| 163787 | 9.19 |
Genes mutations detected in HCC primary tumor (sample number: 10-42240-1) and its paired bone metastasis (sample number: 13-39592-3)
HCC primary tumor (sample number: 10-42240-1) and paired bone metastasis (sample number: 13-39592-3) identified 21 common mutant genes. Twelve unique mutations in the primary cancer were identified. We found 6 unique mutations in metastatic cancer, including 4 genes, which are different from mutations in the primary mutation. Two new mutations were only found in metastatic site (Table 8).
Table 8.
Genes mutations detected in hepatocellular carcinoma primary tumor (sample number: 10-42240-1) and its paired bone metastasis (sample number: 13-39592-3)
| Number | Mutant genes in HCC primary tumor and bone metastasis | Mutant genes in HCC primary tumor | Mutant genes in HCC bone metastasis |
|---|---|---|---|
| 1 | HRAS | GNA11 | EGFR* |
| 2 | SMARCB1 | VHL | KIT* |
| 3 | KRAS | ERBB2 | KDR* |
| 4 | FLT3 | FGFR1 | MET* |
| 5 | CTNNB1 | RET | FBXW7 |
| 6 | GNAQ | EGFR | DEAR |
| 7 | PTEN | KIT | |
| 8 | ATM | KDR | |
| 9 | APC | PTPN11 | |
| 10 | NRAS | MET | |
| 11 | SMO | FGFR2 | |
| 12 | NPM1 | ABL1 | |
| 13 | PIK3CA | ||
| 14 | ERBB4 | ||
| 15 | TP53 | ||
| 16 | JAK3 | ||
| 17 | FLT3 | ||
| 18 | PDGFRA | ||
| 19 | ATM | ||
| 20 | APC | ||
| 21 | NOTCH1 |
The same mutant genes with different mutation sites in hepatocellular carcinoma primary tumor and bone metastasis.
Genes mutations detected in HCC primary tumor (sample number: 10-13656-1; 10-42240-1) and its paired bone metastasis (sample number: 12-60901-3; 13-39592-3)
Of the two HCC primary tumor (sample number 1013656-1; 10-42240-1) identified 18 non common genes; the sample 10-13656-1 has 6 non common genes, and the sample 10-42240-1 number has 12 non common genes (Table 9). After analyzing two pairs of HCC primary tumor (sample number 10-13656-1; 1042240-1) and bone metastases (sample number: 12-60901-3; 13-39592-3), we found 13 unique mutations in bone metastases, including 7 genes, which were only different from the mutation sites of primary mutations. Five new mutations were only found in metastatic sites (Table 9). This suggests that the importance of genetic mutations after metastasis is declining. If additional sample analysis is added, it will increase the persuasiveness.
Table 9.
Genes mutations detected in hepatocellular carcinoma primary tumor (sample number: 10-13656-1; 10-42240-1) and its paired bone metastasis (sample number: 12-60901-3; 13-39592-3)
| Number | Mutant genes in HCC primary tumor and bone metastasis | Mutant genes in HCC primary tumor | Mutant genes in HCC bone metastasis |
|---|---|---|---|
| 1 | ABL1: del | ALK | DEAR |
| 2 | ATM: del or ins | APC | EGFR* |
| 3 | CTNNB1: mis | ATM | FBXW7 |
| 4 | EGFR: mis or del | FGFR1 | KDR* |
| 5 | ERBB2: mis | FGFR2 | KIT* |
| 6 | ERBB4: del or ins | FGFR3 | MET* |
| 7 | FLT3: del | GNAS | AKT1 |
| 8 | GNA11: sillent | MET | APC |
| 9 | GNAQ: del or ins | NOTCH1 | CDH1 |
| 10 | HRAS: mis | PDGFRA | HNF1A |
| 11 | JAK3: mis | PIK3CA | NOTCH1* |
| 12 | KDR: ins or mis | PTEN | SMAD4* |
| 13 | KIT: del | PTPN11 | VHL* |
| 14 | KRAS: mis or ins or del | RET | |
| 15 | NPM1: del or ins | SMAD4 | |
| 16 | NRAS: sillent | SMARCB1 | |
| 17 | SMO: mis | SRC | |
| 18 | TP53: mis or ins | STK11 |
The same mutant genes with different mutation sites in hepatocellular carcinoma (HCC) primary tumor and bone metastasis.
Discussion
HCC is the fifth most common cancer in men worldwide [4]. The bone is well known to be the third most frequent site of metastases by all tumors, after the lungs and lymph nodes, and HCC bone colonization has been reported in approximately 20% of patients affected by this tumor [5,21,22]. Recently, the progress in both diagnostic modalities and therapeutic procedures, such as surgical resection, radiofrequency ablation, and transcatheter arterial chemoembolization in association with treatments using small molecules as multikinase inhibitors, has prolonged the survival in HCC patients which led to a concurrent worsening of the tumor progression within the skeleton and the formation of bone metastases [5-7,21]. To date, few data are yet available about bone involvement in patients with HCC, and the nature and the characteristics of bone metastases in HCC have not been fully explored. In recent years, numerous reports have evaluated the genetic heterogeneity in primary tumors and corresponding metastases in a range of solid tumors such as breast cancer, CRC and NSCLC. However, no study has investigated the genetic heterogeneity between HCC and paired bone metastasis. We hypothesize that there would be genetic heterogeneity between HCC and paired bone metastasis.
Recent advances in genomics technologies are now providing new opportunities for the analysis of tumor DNA and circulating tumor DNA (ctDNA). The technique of next-generation sequencing (NGS) has been directly applied to tumor DNA and ctDNA analysis, to provide an unprecedented, genome-wide view of somatic chromosomal alterations and copy number aberrations [23,24]. NGS of ctDNA has been demonstrated to be an effective non-invasive tool for monitoring tumor burden, evolution, therapeutic responses and resistance to therapy [25-30].
This is the first study to investigate the genetic heterogeneity between HCC and paired bone metastasis. In this study, we investigated the genetic heterogeneity in HCC and paired metastasis using a next generation sequencing (NGS) platform to illustrate the molecularly targeted therapy related genes mutations. In this study, after analyzing two pairs of HCC and paired bone metastases, we found a total of 18 mutants involved, mainly due to frameshift and missense mutations. These include important driver mutations in cancer cells, known as cancer driven genes such as EGFR, ALK, KRAS, and PI3KCA. If further samples are added, there will be more evidence for the differential analysis of gene mutation status in hepatocellular carcinoma primary tumor and bone metastases. The different mutations of the functional genes in HCC and paired bone metastasis might result in the therapeutic failure of molecularly targeted therapy for treatment of HCC bone metastasis, which should be demonstrated in our following work.
Conclusion
Our study revealed the different gene mutation status in HCC and paired bone metastases. However, whether the different mutations of the functional genes in HCC and paired metastasis would result in the therapeutic failure of molecularly targeted therapy for treatment of HCC bone metastasis should be demonstrated further.
Acknowledgements
This work was supported by National Natural Science Foundation of China (Grants No. 81772537; 81374014), Zhejiang Provincial Science and Technology Projects (grants no. 2015C33264, 2017C33212 and 2017C33213), and Zhejiang Provincial Medical and Healthy Science and Technology Projects (Grants No. 2013KYA228 and 2016KYA180).
Disclosure of conflict of interest
None.
References
- 1.Torre LA, Bray F, Siegel RL, Ferlay J, Lortet-Tieulent J, Jemal A. Global cancer statistics, 2012. CA Cancer J Clin. 2015;65:87–108. doi: 10.3322/caac.21262. [DOI] [PubMed] [Google Scholar]
- 2.Perz JF, Armstrong GL, Farrington LA, Hutin YJ, Bell BP. The contributions of hepatitis B virus and hepatitis C virus infections to cirrhosis and primary liver cancer worldwide. J Hepatol. 2006;45:529–538. doi: 10.1016/j.jhep.2006.05.013. [DOI] [PubMed] [Google Scholar]
- 3.Chu CM, Liaw YF. Hepatitis B virus-related cirrhosis: natural history and treatment. Semin Liver Dis. 2006;26:142–152. doi: 10.1055/s-2006-939752. [DOI] [PubMed] [Google Scholar]
- 4.El-Serag HB. Epidemiology of viral hepatitis and hepatocellular carcinoma. Gastroenterology. 2012;142:1264–1273. e1261. doi: 10.1053/j.gastro.2011.12.061. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Fukutomi M, Yokota M, Chuman H, Harada H, Zaitsu Y, Funakoshi A, Wakasugi H, Iguchi H. Increased incidence of bone metastases in hepatocellular carcinoma. Eur J Gastroenterol Hepatol. 2001;13:1083–1088. doi: 10.1097/00042737-200109000-00015. [DOI] [PubMed] [Google Scholar]
- 6.Si MS, Amersi F, Golish SR, Ortiz JA, Zaky J, Finklestein D, Busuttil RW, Imagawa DK. Prevalence of metastases in hepatocellular carcinoma: risk factors and impact on survival. Am Surg. 2003;69:879–885. [PubMed] [Google Scholar]
- 7.Cho HS, Oh JH, Han I, Kim HS. Survival of patients with skeletal metastases from hepatocellular carcinoma after surgical management. J Bone Joint Surg Br. 2009;91:1505–1512. doi: 10.1302/0301-620X.91B11.21864. [DOI] [PubMed] [Google Scholar]
- 8.Ahmad Z, Nisa AU, Uddin Z, Azad NS. Unusual metastases of hepatocellular carcinoma (hcc) to bone and soft tissues of lower limb. J Coll Physicians Surg Pak. 2007;17:222–223. [PubMed] [Google Scholar]
- 9.Kim S, Chun M, Wang H, Cho S, Oh YT, Kang SH, Yang J. Bone metastasis from primary hepatocellular carcinoma: characteristics of soft tissue formation. Cancer Res Treat. 2007;39:104–108. doi: 10.4143/crt.2007.39.3.104. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Santini D, Pantano F, Riccardi F, Di Costanzo GG, Addeo R, Guida FM, Ceruso MS, Barni S, Bertocchi P, Marinelli S, Marchetti P, Russo A, Scartozzi M, Faloppi L, Santoni M, Cascinu S, Maiello E, Silvestris F, Tucci M, Ibrahim T, Masi G, Gnoni A, Comandone A, Fazio N, Conti A, Imarisio I, Pisconti S, Giommoni E, Cinieri S, Catalano V, Palmieri VO, Infante G, Aieta M, Trogu A, Gadaleta CD, Brunetti AE, Lorusso V, Silvestris N. Natural history of malignant bone disease in hepatocellular carcinoma: final results of a multicenter bone metastasis survey. PLoS One. 2014;9:e105268. doi: 10.1371/journal.pone.0105268. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Gong Y, Booser DJ, Sneige N. Comparison of HER-2 status determined by fluorescence in situ hybridization in primary and metastatic breast carcinoma. Cancer. 2005;103:1763–1769. doi: 10.1002/cncr.20987. [DOI] [PubMed] [Google Scholar]
- 12.Scartozzi M, Bearzi I, Berardi R, Mandolesi A, Fabris G, Cascinu S. Epidermal growth factor receptor (EGFR) status in primary colorectal tumors does not correlate with EGFR expression in related metastatic sites: implications for treatment with EGFR-targeted monoclonal antibodies. J. Clin. Oncol. 2004;22:4772–4778. doi: 10.1200/JCO.2004.00.117. [DOI] [PubMed] [Google Scholar]
- 13.Sasatomi E, Finkelstein SD, Woods JD, Bakker A, Swalsky PA, Luketich JD, Fernando HC, Yousem SA. Comparison of accumulated allele loss between primary tumor and lymph node metastasis in stage II non-small cell lung carcinoma: implications for the timing of lymph node metastasis and prognostic value. Cancer Res. 2002;62:2681–2689. [PubMed] [Google Scholar]
- 14.Lan H, Jin K, Xie B, Han N, Cui B, Cao F, Teng L. Heterogeneity between primary colon carcinoma and paired lymphatic and hepatic metastases. Mol Med Rep. 2012;6:1057–1068. doi: 10.3892/mmr.2012.1051. [DOI] [PubMed] [Google Scholar]
- 15.Jin K, Lan H, Cao F, Han N, Xu Z, Li G, He K, Teng L. Differential response to EGFR- and VEGF-targeted therapies in patient-derived tumor tissue xenograft models of colon carcinoma and related metastases. Int J Oncol. 2012;41:583–588. doi: 10.3892/ijo.2012.1469. [DOI] [PubMed] [Google Scholar]
- 16.Monaco SE, Nikiforova MN, Cieply K, Teot LA, Khalbuss WE, Dacic S. A comparison of EGFR and KRAS status in primary lung carcinoma and matched metastases. Hum Pathol. 2010;41:94–102. doi: 10.1016/j.humpath.2009.06.019. [DOI] [PubMed] [Google Scholar]
- 17.Loupakis F, Pollina L, Stasi I, Ruzzo A, Scartozzi M, Santini D, Masi G, Graziano F, Cremolini C, Rulli E, Canestrari E, Funel N, Schiavon G, Petrini I, Magnani M, Tonini G, Campani D, Floriani I, Cascinu S, Falcone A. PTEN expression and KRAS mutations on primary tumors and metastases in the prediction of benefit from cetuximab plus irinotecan for patients with metastatic colorectal cancer. J. Clin. Oncol. 2009;27:2622–2629. doi: 10.1200/JCO.2008.20.2796. [DOI] [PubMed] [Google Scholar]
- 18.Bruix J, Sherman M Practice Guidelines Committee, American Association for the Study of Liver Diseases. Management of hepatocellular carcinoma. Hepatology. 2005;42:1208–1236. doi: 10.1002/hep.20933. [DOI] [PubMed] [Google Scholar]
- 19.Pugh RN, Murray-Lyon IM, Dawson JL, Pietroni MC, Williams R. Transection of the oesophagus for bleeding oesophageal varices. Br J Surg. 1973;60:646–649. doi: 10.1002/bjs.1800600817. [DOI] [PubMed] [Google Scholar]
- 20.Cillo U, Vitale A, Grigoletto F, Farinati F, Brolese A, Zanus G, Neri D, Boccagni P, Srsen N, D’Amico F, Ciarleglio FA, Bridda A, D’Amico DF. Prospective validation of the Barcelona Clinic Liver Cancer staging system. J Hepatol. 2006;44:723–731. doi: 10.1016/j.jhep.2005.12.015. [DOI] [PubMed] [Google Scholar]
- 21.Uchino K, Tateishi R, Shiina S, Kanda M, Masuzaki R, Kondo Y, Goto T, Omata M, Yoshida H, Koike K. Hepatocellular carcinoma with extrahepatic metastasis: clinical features and prognostic factors. Cancer. 2011;117:4475–4483. doi: 10.1002/cncr.25960. [DOI] [PubMed] [Google Scholar]
- 22.Natsuizaka M, Omura T, Akaike T, Kuwata Y, Yamazaki K, Sato T, Karino Y, Toyota J, Suga T, Asaka M. Clinical features of hepatocellular carcinoma with extrahepatic metastases. J Gastroenterol Hepatol. 2005;20:1781–1787. doi: 10.1111/j.1440-1746.2005.03919.x. [DOI] [PubMed] [Google Scholar]
- 23.Leary RJ, Sausen M, Kinde I, Papadopoulos N, Carpten JD, Craig D, O’Shaughnessy J, Kinzler KW, Parmigiani G, Vogelstein B, Diaz LA Jr, Velculescu VE. Detection of chromosomal alterations in the circulation of cancer patients with whole-genome sequencing. Sci Transl Med. 2012;4:162ra154. doi: 10.1126/scitranslmed.3004742. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Heitzer E, Ulz P, Belic J, Gutschi S, Quehenberger F, Fischereder K, Benezeder T, Auer M, Pischler C, Mannweiler S, Pichler M, Eisner F, Haeusler M, Riethdorf S, Pantel K, Samonigg H, Hoefler G, Augustin H, Geigl JB, Speicher MR. Tumor-associated copy number changes in the circulation of patients with prostate cancer identified through whole-genome sequencing. Genome Med. 2013;5:30. doi: 10.1186/gm434. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Diehl F, Li M, Dressman D, He Y, Shen D, Szabo S, Diaz LA Jr, Goodman SN, David KA, Juhl H, Kinzler KW, Vogelstein B. Detection and quantification of mutations in the plasma of patients with colorectal tumors. Proc Natl Acad Sci U S A. 2005;102:16368–16373. doi: 10.1073/pnas.0507904102. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Diehl F, Schmidt K, Choti MA, Romans K, Goodman S, Li M, Thornton K, Agrawal N, Sokoll L, Szabo SA, Kinzler KW, Vogelstein B, Diaz LA Jr. Circulating mutant DNA to assess tumor dynamics. Nat Med. 2008;14:985–990. doi: 10.1038/nm.1789. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Forshew T, Murtaza M, Parkinson C, Gale D, Tsui DW, Kaper F, Dawson SJ, Piskorz AM, Jimenez-Linan M, Bentley D, Hadfield J, May AP, Caldas C, Brenton JD, Rosenfeld N. Noninvasive identification and monitoring of cancer mutations by targeted deep sequencing of plasma DNA. Sci Transl Med. 2012;4:136ra168. doi: 10.1126/scitranslmed.3003726. [DOI] [PubMed] [Google Scholar]
- 28.Misale S, Yaeger R, Hobor S, Scala E, Janakiraman M, Liska D, Valtorta E, Schiavo R, Buscarino M, Siravegna G, Bencardino K, Cercek A, Chen CT, Veronese S, Zanon C, Sartore-Bianchi A, Gambacorta M, Gallicchio M, Vakiani E, Boscaro V, Medico E, Weiser M, Siena S, Di Nicolantonio F, Solit D, Bardelli A. Emergence of KRAS mutations and acquired resistance to anti-EGFR therapy in colorectal cancer. Nature. 2012;486:532–536. doi: 10.1038/nature11156. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Dawson SJ, Tsui DW, Murtaza M, Biggs H, Rueda OM, Chin SF, Dunning MJ, Gale D, Forshew T, Mahler-Araujo B, Rajan S, Humphray S, Becq J, Halsall D, Wallis M, Bentley D, Caldas C, Rosenfeld N. Analysis of circulating tumor DNA to monitor metastatic breast cancer. N Engl J Med. 2013;368:1199–1209. doi: 10.1056/NEJMoa1213261. [DOI] [PubMed] [Google Scholar]
- 30.Murtaza M, Dawson SJ, Tsui DW, Gale D, Forshew T, Piskorz AM, Parkinson C, Chin SF, Kingsbury Z, Wong AS, Marass F, Humphray S, Hadfield J, Bentley D, Chin TM, Brenton JD, Caldas C, Rosenfeld N. Non-invasive analysis of acquired resistance to cancer therapy by sequencing of plasma DNA. Nature. 2013;497:108–112. doi: 10.1038/nature12065. [DOI] [PubMed] [Google Scholar]