Abstract
The 5-year survival rate of patients with metastatic osteosarcoma remains poor. Therefore, the molecular mechanisms underlying metastasis of osteosarcoma need to be investigated. Long non-coding RNA lncTCF7 promotes tumor metastasis in liver and lung cancers; however, its role in osteosarcoma remains unclear. In this study, we found that lncTCF7 expression was significantly higher in osteosarcoma tissues than that in adjacent normal osteosarcoma tissues and upregulated lncTCF7 expression was significantly correlated with tumor metastasis, higher TNM grade and lower survival rate. Additionally, we observed that lncTCF7 silencing significantly inhibited the migration and invasion of osteosarcoma cells, but showed no effects on the proliferation and apoptosis of these cells. lncTCF7 silencing markedly increased the expression of E-cadherin and decreased the expressions of N-cadherin, vimentin, matrix metalloproteinase-2 (MMP-2), and MMP-9, which exerted a potentiating effect on EMT. The result was suggested that lncTCF7 silencing inhibited tumor metastasis in osteosarcoma by possibly inhibiting EMT process. In conclusion, these observations indicated the potential of lncTCF7 as a biomarker of poor prognosis and promising target for treating osteosarcoma.
Keywords: Osteosarcoma, long non-coding RNA, lncTCF7, tumor metastasis, epithelial-mesenchymal transition
Introduction
Osteosarcoma, the most common primary malignant tumor of bone, is a major cause of cancer-related deaths in children and young adults worldwide [1,2]. To date, standard treatments including surgical resection, neoadjuvant chemotherapy, and radiotherapy have seen great improvement. However, osteosarcoma patients have low overall survival rate owing to tumor recurrence and metastasis [3,4]. Therefore, it is important to investigate the molecular mechanisms underlying invasion and metastasis of osteosarcoma cells, in order to develop novel therapeutic strategies for treating osteosarcoma patients.
Long non-coding RNAs (lncRNAs), a class of endogenous RNAs (>200 nucleotides in length), are dysregulated in various types of cancers and play critical roles in tumorigenesis and metastasis [5,6]. Increasing evidence has shown dysregulation of lncRNAs associated with tumor size, clinical stage, post-operative chemotherapy, recurrence, and poor prognosis in osteosarcoma [7-9]. The dysregulation of lncRNAs also affected proliferation, apoptosis, cell cycle, migration, and invasion of osteosarcoma cells [10-12].
The expression of lncTCF7 was dysregulated in human non-small-cell lung cancer, hepatocellular carcinoma, and liver cancer. The dysregulated lncTCF7 promoted invasiveness and aggre-ssiveness of these cancer cells [13-15]. However, the role of lncTCF7 in osteo-sarcoma remains unclear. In this study, we explored the expression of lncTCF7 in osteosarcoma tissues and the relationship between lncTCF7 and clinicopathologic characteristics of osteosarcoma patients. Further, we explored the expression and biological function of lncTCF7 in osteosarcoma cells and investigated the effect of lncTCF7 on EMT. Thus, we aimed at investigating a novel therapeutic target for treating osteosarcoma.
Materials and methods
Patients and tissue samples
A total of 104 tissue samples were obtained from osteosarcoma patients who were recruited from January 2013 to December 2016 in the Hunan University of Chinese Medicine, Luoyang Orthopedic Hospital of Henan Province, and No.91 central hospital of liberation army before receiving chemotherapy or radiation therapy. All participants signed informed consent forms. Diagnosis and clinicopathological characteristics were confirmed by two pathologists. Osteosarcoma tissues and adjacent normal osteosarcoma tissues (at least 5 cm away from the primary site) were obtained during radical resection and immediately stored at -80°C until used for total RNA extraction. All experiments were approved by the Ethics Committee of the Luoyang Orthopedic Hospital of Henan Province. After radical resection, all of the patients were followed up with 2-50 months.
Cell culture and siRNA transfection
Human osteoblast (hFOB1.19) and osteosarcoma (MG-63 and Saos-2) cell lines were obtained from the Cell Bank of Shanghai Institutes for Biological Sciences (Shanghai, China). The hFOB1.19 cells were cultured in DMEM/F12: Ham’s F12 medium (1:1 v/v; Hyclone Laboratories Inc., Camarillo, CA, USA) supplemented with G418 (0.3 μg/mL) and fetal bovine serum (FBS, 10%). The MG-63 and Saos-2 cells were cultured in RPMI 1640 medium with FBS (10%; GIBCO BRL, Gaithersburg, MD, USA), supplemented with penicillin G (100 U/mL) and streptomycin (100 μg/mL) (Sigma-Aldrich Corp., St. Louis, MO, USA). Cells were maintained in 5% CO2 at 37°C in a humidified incubator. The siRNAs for lncTCF7 (si-lncTCF7) and negative control (si-NC) were synthesized by GenePharma Co., Ltd. (Shanghai, China). The cells were transfected using Lipofectamine 3000 (Invitrogen, Carlsbad, CA, USA), according to the manufacturer’s instructions. The siRNA sequences have been shown in Table 1.
Table 1.
SiRNA sequences and qRT-PCR primers
| Gene | Sequence (5’-3’) |
|---|---|
| si-lncTCF7-1 | AGCCAACATTGTTGGTTAT |
| si-lncTCF7-2 | CACCTAGGTGCTCACTGAA |
| si-NC | UUCUCCGAACGUGUCACGUTT |
| lncTCF7 forward | AGGAGTCCTTGGACCTGAGC |
| lncTCF7 reverse | AGTGGCTGGCATATAACCAACA |
| GAPDH forward | CCCATCACCATCTTCCAGGAG |
| GAPDH reverse | GTTGTCATGGATGACCTTGGC |
Quantitative real-time polymerase chain reation (qRT-PCR)
The expression level of lncTCF7 was measured using qRT-PCR. Firstly, total RNA was extracted using Trizol reagent (Invitrogen) according to the manufacturer’s instructions. Next, cDNA was synthesized using the PrimeScript RT Reagent Kit with gDNA Eraser (Takara, Dalian, Liaoning, China). qRT-PCR was performed using the SYBR Premix Ex Taq (Takara) via ABI 7500 Fast Real-Time PCR system (Foster City, CA, USA). The GAPDH was used as an endogenous control. The relative expression was calculated in terms of the fold change using the 2-ΔΔCt method. All experiments were performed in triplicates. The sequences of all primers are shown in Table 1. Each experiment was repeated three times.
Proliferation and apoptosis assays
The CCK-8 assay kit reagent (Beyotime, Shanghai, China) was used for measuring cell proliferation. The transfected cells (5 × 103 per well) were seeded in a 96-well plate in triplicates and incubated at 37°C. After culturing for 24, 48, and 72 hours, the CCK-8 reagent (10 μL) was added to each well and the plates were incubated at 37°C for 4 h. Absorbance at 450 nm was measured using the MK3 microplate reader (Thermo Fisher Scientific, Rockford, IL, USA). For measuring apoptosis, 1 × 105 transfected cells per well were seeded in 6-well plates and the plates were incubated at 37°C for 48 h. Next, the transfected cells were harvested, digested with trypsin, and centrifuged at 2,000 × g for 5 min. The cell pellet (5 × 103 cells) was resuspended in the binding buffer (500 μL) and incubated with Annexin V-FITC (5 μL) and PI (5 μL) for 15 min in dark. Apoptotic cell death was analyzed using flow cytometry (BD Biosciences, San Jose, CA, USA). Each experiment was repeated thrice.
Migration and invasion assays
The migration and invasion assays were performed using the Transwell chambers, as described previously [16]. For the cell migration assay, 5 × 104 transfected cells were resuspended in serum-free RPMI 1640 medium and seeded in the upper Transwell chamber (24-well insert, 8 mm pore size; Corning Costar, Cambridge, MA, USA). Next, RPMI 1640 medium (500 mL) containing FBS (10%) was added to the lower Transwell chamber. For the cell invasion assay, the Transwell chamber membrane was precoated with Matrigel (30 mL; BD Biosciences, Franklin Lakes, NJ, USA). Next, 1 × 105 transfected cells were seeded in the upper Transwell chamber, and DMEM (500 mL) containing FBS (10%) was added to the lower Transwell chamber. After culturing for 48 h, the cells in the lower chambers were fixed and counted in six independent microscopic fields per well, using an Olympus microscope (magnification, 200 ×; Olympus, Japan).
Western blotting
Western blotting was performed to analyze the expression of MMP-2, MMP-9, E-cadherin, N-cadherin, and vimentin, as described previously [16]. Briefly, total protein was extracted using RIPA buffer (Takara), estimated using the BCA Protein Assay kit (Thermo Fisher Scientific), separated on 10% SDS-PAGE, and transferred onto nitrocellulose membranes. The mebranes were incubated with specific primary antibodies against MMP-2 (1:1000), MMP-9 (1:900), E-cadherin (1:10000), N-cadherin (1:500), and vimentin (1:600) respectively. Next, the membranes were incubated with HRP-conjugated goat anti-rabbit IgG H&L secondary antibody (1:10000; Southern Biotech, Birmingham, AL, USA) for 40 min. Protein bands were visualized using ECL (Thermo Fisher Scientific). Protein expression was normalized relative to GAPDH expression. All primary antibodies were purchased from Abcam (Cambridge, MA, USA).
Statistical analysis
All data were expressed as mean ± standard deviation (SD) and analyzed using the SPSS 19.0 software (IBM, Chicago, IL). The differences of lncTCF7 expression between osteosarcoma tissues and adjacent normal osteosarcoma tissues were evaluated using independent t-tests. Survival rates were estimated using the Kaplan-Meier method. The differences in lncTCF7 expression between hFOB1.19, MG-63, and Saos-2 cells were evaluated using one-way analysis of variance (ANOVA), followed by the LSD post-hoc test. The differences between si-NC and si-lncTCF7 treatments were evaluated using independent t-tests. P<0.05 was considered to be statistically significant.
Results
Expression of lncTCF7 is up-regulated and lncTCF7 is a prognostic marker in osteosarcoma
qRT-PCR results indicated that lncTCF7 expression in osteosarcoma tissues was significantly higher than that in adjacent normal osteosacoma tissues (P<0.01, Figure 1A). Osteosarcoma patients whose ratio (lncTCF7 expression in osteosarcoma tissues/that in adjacent normal osteosarcoma tissues) higher than 1 [log2(1)>0] accounted for 94.23% (98/104, Figure 1B). Additionally, the expression of lncTCF7 was significantly correlated with tumor metastasis and TNM grade, in contrast, there was no significant correlation between lncTCF7 expression and age, gender, tumor location, tumor size, tumor differentiation (Table 2). Furthermore, to evaluate the prognostic value of lncTCF7 in patients with osteosarcoma, we collected survival period data from all 104 patients included in this study. Osteosarcoma patients were divided into the low expression group (lncTCF7 expression <22.92) and the high expression group (lncTCF7 expression ≥22.92) according to median lncTCF7 expression value (22.92). At the time of the last follow-up (3-48 months after surgery), the numbers of alive patients in the low and the high expression groups were 42 (80.76%) and 33 (63.46%), respectively. The survival rates for each group were estimated using the Kaplan-Meier method and results are shown in Figure 1C. Osteosarcoma patients of the high group had a significantly lower survival rate than the patients of the low group (log rank X2=7.471, P=0.006).
Figure 1.

Expression of lncTCF7 is up-regulated and lncTCF7 is a prognostic marker in osteosarcoma. A: The Expression of lncTCF7 was significantly higher in osteosarcoma tissues than that in adjacent normal osteosarcoma tissues. B: The number of osteosarcoma patients vs. the ratio (lncTCF7 expression in osteosarcoma tissues/in adjacent normal osteosarcoma tissues). C: High lncTCF7 expression group had a significantly lower survival rate than those of the low expression group.
Table 2.
Association of lncTCF7 expression with clinical parameters in osteosarcoma patients (mean ± SD)
| Characteristics | Number (104) | Expression (log2) | t | P |
|---|---|---|---|---|
| Age | 0.996 | 0.321 | ||
| <20 | 70 | 4.31±1.044 | ||
| ≥20 | 34 | 4.53±1.002 | ||
| Gender | 0.069 | 0.945 | ||
| Male | 54 | 4.34±1.093 | ||
| Female | 50 | 4.36±0.970 | ||
| Location | 1.065 | 0.289 | ||
| Femur/Tibia | 67 | 4.25±1.021 | ||
| Elsewhere | 37 | 4.48±1.042 | ||
| Tumor size | 0.900 | 0.370 | ||
| <5 cm | 63 | 4.30±1.032 | ||
| ≥5 cm | 41 | 4.48±1.010 | ||
| Metastasis | 5.442 | <0.001* | ||
| Yes | 29 | 5.15±0.586 | ||
| No | 75 | 4.07±0.999 | ||
| Differentiation | 1.317 | 0.191 | ||
| Well + moderate | 78 | 4.29±0.993 | ||
| Poor | 26 | 4.60±1.095 | ||
| TNM stage | 2.173 | 0.032* | ||
| I+II | 68 | 4.29±0.993 | ||
| III+IV | 36 | 4.60±1.095 |
P<0.05.
LncTCF7 expression is upregulated in osteosarcoma cell lines and is downregulated upon si-lncTCF7 transfection
After cultured 24 hours, the expression of lncTCF7 in normal osteoblasts cell hFOB1.19 and osteosarcoma cell lines MG-63 and Saos-2 was measured by qRT-PCR. It was observed that lncTCF7 expression was obviously higher in the osteosarcoma cell lines (MG-63 and Saos-2 cells) than that in the hFOB1.1 osteoblast cells (P<0.05, Figure 2A). To study the biological function of lncTCF7, si-lncTCF7-1 and si-lncTCF7-2 were transfected in the MG-63 and Saos-2 cells to knockdown the expression of lncTCF7. At 48-h post-transfection, qRT-PCR results confirmed that si-lncTCF7=-1- and si-lncTCF7-2-transfected MG-63 and Saos-2 cells showed lower expression of lncTCF7 than the si-NC-transfected cells. It was also observed that si-lncTCF7-2 showed higher lncTCF7 knockdown efficiency than si-lncTCF7-1 (P<0.05, Figure 2B). Thus, si-lncTCF7-2 (henceforth referred to as si-lncTCF7) was used for further experiments.
Figure 2.

LncTCF7 expression is upregulated in osteosarcoma cell lines and is downregulated upon si-lncTCF7 transfection. A: qRT-PCR analysis showing the expression of lncTCF7 in osteoblast cells and osteosarcoma cell lines (MG-63 and Saos-2) after culturing the cells for 24 h. B: qRT-PCR analysis showing the expression of lncTCF7 in MG-63 and Saos-2 cells transfected with si-lncTCF7-1, si-lncTCF7-2, or si-NC (48-h post-transfection). ***, P<0.001.
LncTCF7 silencing shows no effect on cell proliferation and apoptosis
After transfection, cell proliferation and apoptosis were analyzed using the CCK-8 assay and flow cytometric analysis, respectively. The CCK-8 assay results showed that the proliferation of MG-63 and Saos-2 cells (24, 48, and 72-h post-transfection) did not decrease significantly in the si-lncTCF7 group compared to the si-NC group at the same time intervals (P>0.05, Figure 3A). Similarly, flow cytometric analysis showed that the apoptosis of MG-63 and Saos-2 cells did not differ significantly between the si-lncTCF7 and si-NC groups 48-h post-transfection (P>0.05, Figure 3B and 3C).
Figure 3.

LncTCF7 silencing shows no significant effect on proliferation and apoptosis in the MG-63 and Saos-2 cells. A: Proliferation of MG-63 and Saos-2 cells in si-NC and si-lncTCF7 groups were determined using the CCK-8 assay post-transfection. B: The apoptosis of MG-63 and Saos-2 cells in the si-NC and si-lncTCF7 groups were determined using flow cytometry, 48-h post-transfection. Data are represented as mean ± SD. C: Representative images showing apoptosis in MG-63 and Saos-2 cells.
LncTCF7 silencing inhibits cell migration and invasion
Cell migration and invasion were assessed using the Transwell chamber, 48-h post-transfection. The results showed that lncTCF7 silencing drastically decreased migration and invasion of the MG-63 cells (P<0.05, Figure 4A). Similar results were observed for the Saos-2 cells (P<0.05, Figure 4B).
Figure 4.

LncTCF7 silencing inhibits the migration and invasion of (A) MG-63, and (B) Saos-2 cells. Data are represented as mean ± SD. ***, P<0.001, compared with si-NC.
LncTCF7 silencing inhibits the EMT process
The expressions of E-cadherin, N-cadherin, and vimentin were measured using western blot analysis to evaluate the effect of lncTCF7 silencing on EMT process. As shown in Figure 5, the expression of E-cadherin was obviously higher in the si-lncTCF7 group than those in si-NC group. In contrast, the expressions of N-cadherin and vimentin were obviously lower in the si-lncTCF7 group compared to the si-NC group. As expected, the expressions of MMP-2 and MMP-9 were considerably lower in the si-lncTCF7 group compared to the si-NC group.
Figure 5.

LncTCF7 silencing increased E-cadherin expression and decreased N-cadherin, vimentin, MMP-2, and MMP-9 expressions.
Discussion
The 5-year survival rate of metastatic osteosarcoma patients remains poor [17]. Therefore, understanding the molecular mechanisms underlying metastasis in osteosarcoma cells will be useful in developing novel therapeutic targets for treating metastatic osteosarcoma. In the present study, we found that lncTCF7 expression was enhanced in osteosarcoma tissues and upregulated lncTCF7 expression was significantly correlated with tumor metastasis, higher TNM grade, and lower survival rate. Furthermore, lncTCF7 silencing obviously inhibited the migration, invasion, and EMT in osteosarcoma cells but showed no effect on the proliferation and apoptosis. These results suggested lncTCF7 to be a biomarker of poor prognosis and a novel therapeutic target for treating metastatic osteosarcoma patients.
Previous studies have indicated that lncTCF7 expression was significantly increased in tumor tissues and lncTCF7 promotes migration and invasion of the liver and lung cancer cells [13,15,18]. In this study, we found that lncTCF7 expression was significantly higher in osteosarcoma tissues than that in adjacent normal osteosarcoma tissues. Its expression was significantly correlated with tumor metastasis and TNM grade but had no significant correlation with age, gender, tumor location, tumor size, tumor differentiation. High lncTCF7 expression group had a significantly lower survival rate than those of the low expression group. Our results indicated that lncTCF7 acts as a biomarker of poor prognosis.
We also found that lncTCF7 expression were significantly higher in osteosarcoma cells than that in human osteoblast (hFOB1.19), similar with the result of lncTCF7 expression in osteosarcoma tissues and adjacent normal osteosarcoma tissues. lncTCF7 silencing obviously inhibited the migration and invasion of MG-63 and Saos-2 osteosarcoma cells, decreased the expressions of MMP-2 and MMP-9; however, it showed no effect on the proliferation and apoptosis in these cells. The results consistent with the clinical results which showed lncTCF7 expression was significantly correlated with tumor metastasis and TNM grade but had no significant correlation with tumor size. Our present study demonstrated that lncTCF7 promote osteosarcoma metastasis, which was similar with the results of previously studies in liver and lung cancer cells [13,15,18].
EMT plays a key role in regulating the invasion and metastasis of cancer cells. During EMT process, the expression of epithelial markers (such as, E-cadherin and other cell junction proteins) were inhibited and the expression of me-senchymal markers (such as, N-cadherin and vimentin) were enhanced [19]. A previous study demonstrated that lncTCF7 activated EMT in hepatocellular carcinoma cells [12]. In this study, we found that lncTCF7 silencing markedly increased E-cadherin expression, and decreased N-ca-dherin and vimentin expressions in osteosarcoma cells. The result was suggested that lncTCF7 silencing inhibited tumor metastasis in osteosarcoma by possibly inhibiting EMT process.
Overall, our results indicated that lncTCF7 acts as a biomarker of poor prognosis and a novel therapeutic target for treating metastatic osteosarcoma patients. However, the molecular mechanisms underlying the regulati on of EMT by lncTCF7 in metastatic osteosarcoma need to be investigated further.
Acknowledgements
The authors thank the sponsor: The Cultivation Project of Chinese Medicine Clinical Leading Talents of Henan Province (HNZYLJ201301009). We thank the members of our laboratories for their insight and technical support.
Disclosure of conflict of interest
None.
References
- 1.Geller DS, Gorlick R. Osteosarcoma: a review of diagnosis, management, and treatment strategies. Clin Adv Hematol Oncol. 2010;8:705–718. [PubMed] [Google Scholar]
- 2.Kager L, Tamamyan G, Bielack S. Novel insights and therapeutic interventions for pediatric osteosarcoma. Future Oncol. 2017;13:357–368. doi: 10.2217/fon-2016-0261. [DOI] [PubMed] [Google Scholar]
- 3.Jaffe N, Puri A, Gelderblom H. Osteosarcoma: evolution of treatment paradigms. Sarcoma. 2013;2013:203531. doi: 10.1155/2013/203531. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Kansara M, Teng MW, Smyth MJ, Thomas DM. Translational biology of osteosarcoma. Nat Rev Cancer. 2014;14:722–735. doi: 10.1038/nrc3838. [DOI] [PubMed] [Google Scholar]
- 5.Lv Z, Xu Q, Yuan Y. A systematic review and meta-analysis of the association between long non-coding RNA polymorphisms and cancer risk. Mutat Res. 2017;771:1–14. doi: 10.1016/j.mrrev.2016.10.002. [DOI] [PubMed] [Google Scholar]
- 6.Chen X, Lun L, Hou H, Tian R, Zhang H, Zhang Y. The value of lncRNA HULC as a prognostic factor for survival of cancer outcome: a meta-analysis. Cell Physiol Biochem. 2017;41:1424–1434. doi: 10.1159/000468005. [DOI] [PubMed] [Google Scholar]
- 7.Zhang Y, Dai Q, Zeng F, Liu H. MALAT1 promotes the proliferation and metastasis of osteosarcoma cells by activating the Rac1/JNK pathway via targeting MiR-509. Oncol Res. 2017 doi: 10.3727/096504017X14957939026111. [Epub ahead of print] [DOI] [PubMed] [Google Scholar]
- 8.Gao KT, Lian D. Long non-coding RNA MALAT1 is an independent prognostic factor of osteosarcoma. Eur Rev Med Pharmacol Sci. 2016;20:3561–3565. [PubMed] [Google Scholar]
- 9.Zhao J, Li L, Peng L. MAPK1 up-regulates the expression of MALAT1 to promote the proliferation of cardiomyocytes through PI3K/AKT signaling pathway. Int J Clin Exp Pathol. 2015;8:15947–15953. [PMC free article] [PubMed] [Google Scholar]
- 10.Chen R, Wang G, Zheng Y, Hua Y, Cai Z. Long non-coding RNAs in osteosarcoma. Oncotarget. 2017;8:20462–20475. doi: 10.18632/oncotarget.14726. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Zheng H, Min J. Role of long noncoding RNA HOTAIR in the growth and apoptosis of osteosarcoma cell MG-63. Biomed Res Int. 2016;2016:5757641. doi: 10.1155/2016/5757641. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Zhang CL, Zhu KP, Shen GQ, Zhu ZS. A long non-coding RNA contributes to doxorubicin resistance of osteosarcoma. Tumour Biol. 2016;37:2737–2748. doi: 10.1007/s13277-015-4130-7. [DOI] [PubMed] [Google Scholar]
- 13.Wu J, Wang D. Long noncoding RNA TCF7 promotes invasiveness and self-renewal of human non-small cell lung cancer cells. Hum Cell. 2017;30:23–29. doi: 10.1007/s13577-016-0147-5. [DOI] [PubMed] [Google Scholar]
- 14.Wu J, Zhang J, Shen B, Yin K, Xu J, Gao W, Zhang L. Long noncoding RNA lncTCF7, induced by IL-6/STAT3 transactivation, promotes hepatocellular carcinoma aggressiveness through epithelial-mesenchymal transition. J Exp Clin Cancer Res. 2015;34:116. doi: 10.1186/s13046-015-0229-3. [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
- 15.Wang Y, He L, Du Y, Zhu P, Huang G, Luo J, Yan X, Ye B, Li C, Xia P, Zhang G, Tian Y, Chen R, Fan Z. The long noncoding RNA lncTCF7 promotes self-renewal of human liver cancer stem cells through activation of Wnt signaling. Cell Stem Cell. 2015;16:413–425. doi: 10.1016/j.stem.2015.03.003. [DOI] [PubMed] [Google Scholar]
- 16.Zhou SJ, Liu FY, Zhang AH, Liang HF, Wang Y, Ma R, Jiang YH, Sun NF. MicroRNA-199b-5p attenuates TGF-beta1-induced epithelialmesenchymal transition in hepatocellular carcinoma. Br J Cancer. 2017;117:233–244. doi: 10.1038/bjc.2017.164. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Benjamin RS. Osteosarcoma: better treatment through better trial design. Lancet Oncol. 2015;16:12–13. doi: 10.1016/S1470-2045(14)71186-6. [DOI] [PubMed] [Google Scholar]
- 18.Weidle UH, Birzele F, Kollmorgen G, Ruger R. Long non-coding RNAs and their role in metastasis. Cancer Genomics Proteomics. 2017;14:143–160. doi: 10.21873/cgp.20027. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Banyard J, Bielenberg DR. The role of EMT and MET in cancer dissemination. Connect Tissue Res. 2015;56:403–413. doi: 10.3109/03008207.2015.1060970. [DOI] [PMC free article] [PubMed] [Google Scholar]
