Skip to main content
NCBI home page
International Journal of Clinical and Experimental Pathology logoLink to International Journal of Clinical and Experimental Pathology
. 2017 Nov 1;10(11):11251–11259.

miR-222 knockdown suppresses epithelial-to-mesenchymal transitionin human oral squamous cell carcinoma

Ying Ouyang 1,*, Fangfang Jiang 1,*, Binghui Zeng 1, Changbo Wei 1, Dongsheng Yu 1
PMCID: PMC6965878  PMID: 31966478

Abstract

Tumor metastasis is the main cause of death in patients with oral squamous cell carcinoma (OSCC). Epithelial-to-mesenchymal transition (EMT) is potentially associated with metastasis and histological grading in OSCC. Therefore, the discovery of new strategies to inhibit EMT is potentially valuable for the development of therapies for OSCC. In our previous study, we found that miR-222, which is up-regulated in OSCC, regulates the biological behavior of OSCC cells by targeting the p53-upregulated modulator of apoptosis (PUMA); however, the effect of miR-222 on TGF-β1-induced EMT in OSCC cells is unclear. In this study, OSCC cell lines CAL-27 and Tca-8113 were incubated with 5 ng/ml of TGF-β1 to inhibit the expression of E-cadherin, promote the expression of N-cadherin, vimentin, and α-SMA and stimulate achange in cell shape convert from a “cuboidal” epithelial structure into an elongated mesenchymal shape. We found that the expression of miR-222 was up-regulated during TGF-β1-induced EMT in OSCC cells. In addition, miR-222 knockdown reversed TGF-β1-induced EMT by targeting PUMA. Our findings indicate that miR-222 plays an important role in OSCC, potentially serving as a novel therapeutic target for the treatment of OSCC.

Keywords: miR-222, PUMA, EMT, TGF-β1, oral squamous cell carcinoma

Introduction

Oral cancer, a type of head and neck cancer of the oral cavity, is one of the most common cancers worldwide [1] and is recognized as a global public health threat. Smoking, alcohol use, and human papillomavirus (HPV) infection are the major risk factors for oral cancer, with smoking and alcohol consumption exerting synergistic effects [2]. In china, betel quid chewing contributes significantly to the risk of oral cancer [3]. Oral squamous cell carcinoma (OSCC), which represents more than 90% of oral cancers, is the most frequent of all cancers of the oral cavity [4]. Although local OSCC maybe effectively controlled by surgical excision and radiotherapy, once metastasis has occurred, no effective treatment is available and the mortality rate is significantly elevated [5]. Tumor metastasis is the main cause of death in patients with oral cancer. The invasion of tumor cells is a complex, multistage process.

Epithelial-mesenchymal transition (EMT) is a crucial event required for the dissemination of cells from epithelial tumors: in malignant epithelial cancers, epithelial cells lose their polarity and acquire a mesenchymal phenotype; this is followed by detachment from the basement membrane, which facilitates migration [6,7]. Multiple pleiotropic cytokines and several signaling pathways are involved in this process. In addition, the expression of epithelial markers E-cadherin is down-regulated and the expression of mesenchymal markers V-cadherin, vimentin, and α-SMAis up-regulated during EMT. EMT is potentially associated with metastasis and histological grading in OSCC [8]. The inhibition of EMT by over-expressing miR-204 and P120 ctn has been shown tosuppress the migration and invasion of cancer cells in OSCC [9,10]. Therefore, the development of strategies targeting EMT is necessary for successfully treating OSCC.

MicroRNAs (miRNAs) aresmall non-coding RNA molecules, containing approximately 22 nucleotides, that suppress gene expression bybinding directly to the mRNA 3’-UTR [11,12]. Previous studies have shown that miRNAs regulate the expression of various oncogenes and tumor suppressors that play important roles in metastasis and tumor progression in OSCC [13,14]. Recent research has shown that miR-221/222 promotes EMT in breast cancer andnon-small cell lung cancer [15,16]. In our previous study, we found that miR-222, which was up-regulated in OSCC, regulates the migration and invasion of OSCC cells by targeting p53-upregulated modulator of apoptosis (PUMA)[17]; however, the effect of miR-222 on EMT in OSCC cells is unclear. In this study, we aimed to clarify the effect of miR-222 on TGF-β1-induced EMT in OSCC cells, and to elucidate the underlying molecular mechanism.

Materials and methods

Cell culture and stimulation

The OSCC cell lines CAL-27 and Tca-8113 were cultured in DMEM supplemented with 10% FBS, penicillin (100 U/ml), and streptomycin (100 μg/ml) (Gibco, Carlsbad, CA, USA). All cells were maintained at 37°C in a humidified incubator with 5% CO2 atmosphere. For experiments, CAL-27 and Tca-8113 cells were cultured in serum-free media containing 0.1% bovine serum albumin for 24 h before treated with 5 ng/ml TGF-β1 (PeproTech, Rocky Hill, NJ, USA).

RNA isolation and quantitative real-time (qRT-PCR)

Tca-8113 and CAL-27 cells were harvested and lysed using Trizol reagent (Invitrogen, CA, USA). In order toanalyze miR-222 expression, reverse transcription PCR (RT-PCR) was performed using specific stem-loop reverse transcription primers; miR-222 first strand synthesis was performed using a First Strand Synthesis Kit (Takara, Dalian, China), and qPCR was performed using a Mir-X™ miRNAqRT-PCR SYBR® Kit (Takara, Dalian, China). U6 was used as an internal control. In order to quantify mRNA levels of E-cadherin, N-cadherin, vimentin, α-SMA, PUMA, and phosphatase and tensin homolog (PTEN), RT-PCR was performed using the PrimeScript RT Reagent Kit with cDNA Eraser (Takara, Dalian, China) and qPCR was performed using SYBR Premix Ex Taq (Ta-kara, Dalian, China), with 18s rRNA as an internal control. The primer sequences used for qRT-PCR are shown in Table 1. Gene expression was analyzed using the Applied Biosystems 7500 system (Applied Biosystems, Warrington, UK), measured in triplicate, quantified using the 2-ΔΔCT method, and normalized to that of a control.

Table 1.

Primer sequences for qRT-PCR

Primer Primer sequence (5’-3’)
E-cadherin Forward CCCACCACGTACAAGGGTC
E-cadherin Reverse CTGGGGTATTGGGGGCATC
N-cadherin Forward CTAATGGTCGGCGTATCTACT
N-cadherin Reverse CGTAAGATGGAGGAACATCA
Vimentin Forward CGCCAGATGCGTGAAATGG
Vimentin Reverse ACCAGAGGGAGTGAATCCAGA
α-SMA Forward GTGAAGCAGCTCCAGCTATG
α-SMA Reverse CGTCCCAGTTGGTGATGATG
18s rRNA Forward CCTGGATACCGCAGCTAGGA
18s rRNA Reverse GCGGCGCAATACGAATGCCCC
hsa-miR-222 Reverse Transcription CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGACCCAGTA
hsa-miR-222 Forward ACACTCCAGCTGGGAGCTACATCTGGCTACTG
hsa-miR-222 Reverse CTCAACTGGTGTCGTGGA
U6-Reverse Transcription AACGCTTCACGAATTTGCGT
U6 Forward CTCGCTTCGGCAGCACA
U6 Reverse AACGCTTCACGAATTTGCGT
Open in a new tab

Western blot

The protein levels of E-cadherin, N-cadherin, vimentin, α-SMA, PUMA, and PTEN were determined by western blot. Protein extracted from Tca-8113 and CAL-27 cells was centrifuged at 14,000 g for 20 min at 4°C. The protein concentration was determined using a Pierce BCA protein assay kit (Thermo Scientific, Rockford, IL, USA). Proteins were resolved by SDS-PAGE on a 10% gel and transferred to a PVDF membrane. Membranes were blocked with 5% non-fat milk in TBS for 3 hours and incubated with a 1:1,000 dilution of anti-E-cadherin, anti-N-cadherin, anti-vimentin, anti-α-SMA, anti-PUMA, and anti-PTEN (all obtained from Cell Signaling Technology, Beverly, MA, USA) at 4°C overnight, followed by incubation for 40 min with a 1:20,000 dilution of secondary antibody (BOSTER, Wuhan, Hubei, China). Proteins were visualized using ECL (Thermo Scientific Pierce ECL Plus, Thermo Scientific, Rockford, IL, USA). GAPDH was used as a loading control for comparison between samples.

Plasmid construction and transfection

A control (miR-NC) and miR-222 inhibitor were purchased from Jima Biotech (Suzhou, China).Cells were plated at 50% confluence and transfected with 300 nM miR-NC, or miR-222 inhibitorusing Lipofectamine™ RNAiMAX (Invitrogen, Carlsbad, CA, USA) according to the recommended protocol. After transfection,cells were stimulated with 5 ng/ml TGF-β1 and used for subsequent analysis.

Migration and invasion assay

Cell migration and invasion were assessed using a transwell migration assay. For migration assay, CAL-27 and Tca-8113 cells were harvested and 5×104 cells, in 200 µL of 0.1% serum medium, were placed into the upper chamber of an insert (pore size, 8 µm) (BD-Biosciences, San Diego, CA, USA). The lower chamber was filled with 10% FBS medium (600 µL). For invasion assays, 5×104 cells were seeded into anupper chamber pre-coated with Matrigel (BD Biosciences, San Diego, CA, USA), and the lower chamber was filled with 10% FBS medium (600 µL). Cells were incubated for 24 h and then removed from the upper chamber with a cotton swab. Next, the cells in the lower chamber were fixed with 4% paraformaldehyde and stained with 0.1% crystal violet solution in 20% ethanol. Migrationand invasion of cells were observed using a LEICA microscope at 200× magnification, in five independent fields for each well, and the average counts were calculated.

Statistical analysis

All statistical analyses were performed using SPSS 19.0 software (IBM Inc., USA). Continuous variables are presented as means ± standard deviation (SD). A t-test was used to compare the differences between groups; P<0.05 were considered to represent statistically significant differences.

Results

TGF-β1-induces EMT in OSCC cells

OSCC cells CAL-27 and Tca-8113 were incubated with 5 ng/ml of TGF-β1 to examine whether TGF-β1 stimulates EMT. Stimulation by TGF-β1 resulted in a change of cell shape from a “cuboidal” epithelial structure into an elongated mesenchymal shape, as time progressed (Figure 1). EMT was a developmental process in which epithelial cells acquire migratory characteristics. qRT-PCR and Western blot results (Figure 2) showed that TGF-β1 stimulation down-regulated the expression of epithelial markers E-cadherin and up-regulated the expression of mesenchymal markers N-cadherin, vimentin, and α-SMA significantly (P<0.05). TGF-β1-induced EMT ina time-dependent manner in OSCC cell lines.

Figure 1.

Figure 1

Open in a new tab

Alternations of cell shape during TGF-β1-induced EMT in CAL-27 and Tca-8133 cells after stimulated with TGF-β1. Cell shape was monitored by phase contrast microscope during EMT, which was induced by treatment of 5 ng/ml TGF-β1 in OSCC cell lines CAL-27 and Tca-8113 (200×).

Figure 2.

Figure 2

Open in a new tab

Expressions of the EMT-associated proteins in Tca-8113 and CAL-27 OSCC cell exposed to TGF-β1 treatment. A: After stimulated with TGF-β1 for 24 h, the expression of E-cadherin, N-cadherin, vimentin, and α-SMA were analyzed by qRT-PCR. The results are presented as means ± SD. *P<0.05. B: After stimulated with TGF-β1 for 24 h, the expressions of E-cadherin, N-cadherin, vimentin, α-SMA and GAPDH were detected by western blot.

TGF-β1 promotes miR-222 expression and inhibits PUMA expression

Emerging evidence revealed that miR-222 played critical regulatory roles in cell metastasis and development; therefore, we studied the expression levels of miR-222 during TGF-β1-induced EMT in OSCC cells using qRT-PCR. The results showed that TGF-β1 stimulation resulted in asignificantincrease in the expression of miR-222 in CAL-27 and Tca-8113 cells (P<0.05), and the effect was found to be time-dependent (Figure 3A). PUMA and PTEN represent potential targets of miR-222 in OSCC cells; accordingly, we determined the expression levels of the respective genes and encoded proteinsin CAL-27 and Tca-8113 cell lines by qRT-PCR and Western blot (Figure 3A and 3B). The results showed that the expression level of PUMA was significantly decreased in CAL-27 and Tca-8113 cells (P<0.05); however, no differences in the expression level of PTEN were observed. The results showed that, during TGF-β1-induced EMT, miR-222 expression was significantly up-regulated and PUMA expression was significantly down-regulated.

Figure 3.

Figure 3

Open in a new tab

The expressions of miR-222, PUMA and PTEN in Tca-8113 and CAL-27 exposed to TGF-β1 treatment. A: After stimulated with TGF-β1 for 24 h, the expression of miR-222, PUMA, and PTEN was studied by qRT-PCR; the results are presented as means ± SD; *P<0.05. B: After stimulated with TGF-β1 for 48 h, the expression of PUMA and PTEN was detected by western blot.

miR-222 inhibitor reverses TGF-β1-induced EMT by targeting PUMA

In order to elucidate the role of miR-222 during TGF-β1-induced EMT, CAL-27 and Tca-8113 cells were transfected with miR-222 inhibitor and stimulated with TGF-β1. The transfected miR-222 inhibitor was found to effectively decrease the expression of miR-222 (P<0.05, Figure 4A) and increase PUMA expression (P<0.05, Figure 4A and 4B). The results showed that miR-222 maybe negatively correlated with PUMA expression in OSCC cell lines and indicated that the transfection of miR-222 inhibitor effectively increased the expression of E-cadherin and decreased the expression of N-cadherin, vimentin, and α-SMA (P<0.05, Figure 4C). Stimulation with TGF-β1 resulted in a change of cell shape from a “cuboidal” epithelial structure into an elongated mesenchymal shape. However, with the transfection of miR-222 inhibitor, the change of cell shape was effectively suppressed (Figure 4D).

Figure 4.

Figure 4

Open in a new tab

miR-222 inhibitor inhibited PUMA expression and EMT in Tca-8113 and CAL-27 exposed to TGF-β1 treatment. A: After transfection, Tca-8113 and CAL-27 cells were stimulated with 5 ng/ml TGF-β1 for 24 h and the expression of miR-222 and PUMA was detected using qRT-PCR. Results were presented as means ± SD. *P<0.05 vs control group. B: After transfection, Tca-8113 and CAL-27 cells were stimulated with 5 ng/ml TGF-β1 for 48 h and the expression of PUMA was studied using western blot. C: After transfection, Tca-8113 and CAL-27 cells were stimulated with 5 ng/ml TGF-β1 for 48 h and the expression of E-cadherin, N-cadherin, vimentin, and α-SMA was detected by western blot. D: After transfection, Tca-8113 and CAL-27 cells were stimulated with 5 ng/ml TGF-β1 for 24 h and cell shape was analyzed in Tca8113 and CAL-27 cells (200×).

miR-222 inhibitor inhibits the migration and invasion of OSCC cells

After transfection, CAL-27 and Tca-8113 cells were stimulated with 5 ng/ml TGF-β1 for 48 h and were examined migration and invasion of cells. The transwell assay showed that the migration and invasion of cells were significantly inhibited in miR-222 inhibitor transfected cells compared with the control group (P<0.05) (Figure 5).

Figure 5.

Figure 5

Open in a new tab

miR-222 inhibitor inhibited migration and invasion of Tca-8113 and CAL-27 cellsexposed to TGF-β1 treatment. A: After transfection, Tca-8113 cells were stimulated with 5 ng/ml TGF-β1 for 48 h and were examined migration and invasion. miR-222 inhibitor inhibited the migration and invasion of Tca-8113. B: After transfection, CAL-27 cells were stimulated with 5 ng/ml TGF-β1 for 48 h and were examined migration and invasion. miR-222 inhibitor inhibited the migration and invasion of CAL-27. Results were presented as means ± SD. *P<0.05 vs control group.

Discussion

In this study, we found that OSCC cells incubated with 5 ng/ml of TGF-β1 could down-regulate the expression of epithelial markers E-cadherin and up-regulate the expression of mesenchymal markers N-cadherin, vimentin, and α-SMA significantly. We also found that stimulation by TGF-β1 resulted in a change of cell shape from a “cuboidal” epithelial structure into an elongated mesenchymal shape, and induced EMT in OSCC cells. The TGF-β signaling pathway regulated various target genes to govern multiple biological processes during tumor progression.TGF-β activates both Smad-dependent and Smad-independent pathways to function as a potent extracellular inducer of EMT [18,19]. In OSCC, TGF-β1-induces EMT and promotes metastasis and bone invasion [20,21], which were similar to those of our study.

Recent research has shown that miR-222 promotes EMT in cancer cells [15]. The expression of miR-222 is elevated in gastric cancer and prostate cancer, as well as in other types of cancer [22,23]. High expression of miR-222 is correlated with shorter metastasis-free survival, lower 5-year survival rates, and lower overall survival [22]. The knockdown of miR-222 inhibits cell growth and invasion, and increases radiosensitivity [24]. In previous study, we found that the expression of miR-222 is elevated in OSCC tissues [17]. In this study, we detected that the expression of miR-222 is up-regulate during TGF-β1-induced EMT in OSCC cells. The present findings, which were similar to those of our previous study, indicate that miR-222 may play an important role in TGF-β1-induced EMT in OSCC cells.

miR-222 plays an important role in the occurrence and development cancers by directly binding to its target mRNA 3’-UTR to regulate gene expression. Numerous target genes of miR-222, such as PTEN (in gastric cancer and prostate cancer) [23,24], p27 (in breast cancer) [25], and ARID1A (in cervical cancer) [26] have been identified. miR-222 overexpression enhances proliferation and invasion, decreases apoptosis, and reduces sensitiz ation to cisplatin by targeting PUMA in OSCC [17,27]. We additionally studied the expression of PTEN and PUMA, both of which were target genes of miR-222 in OSCC. The tumor suppressor PTEN regulates cell proliferation, migration, and angiogenesis via phosphatidylinositol phosphatase, which in turn regulates the activation of AKT via PI3K [28]. PUMA was newly discovered as a target for activation by p53 to promote cell apoptosis through binding to and neutralizing pro-survival members of the Bcl-2 family [29]. In this study, we found that TGF-β1-induced EMT in OSCC cells was accompanied by the down-regulation ofthe expression of PUMA; however, that of PTEN was not found to change. When miR-222 expression was inhibited during TGF-β1-induced EMT, the expression of PUMA was up-regulated. These results show miR-222 might target PUMA during TGF-β1-induced EMT and the present findings were similar to those ofour previous study In addition, we found that the inhibition of miR-222 resulted in significant down-regulation of the expression of N-cadherin, vimentin, and α-SMA and up-regulation of the expression of E-cadherin, preventing the change of cell shape from a “cuboidal” epithelial structure into an elongated mesenchymal shape, reversing TGF-β1-induced EMT, and inhibit the migration and invasion of OSCC cells.

In conclusion, miR-222 knockdown suppresses TGF-β1-induced EMT andour findings strongly indicated that miR-222 plays an important role in OSCC, and may serve as a novel therapeutic target for the treatment of this cancer.

Acknowledgements

This study was supported by the National Natural Sciences Foundation of China (No. 81272554 and 81472526), the Guangdong Sciences and Technology Project (No. 2016 A020216007).

Disclosure of conflict of interest

None.

References

  • 1.Torre LA, Bray F, Siegel RL, Ferlay J, Lortet-Tieulent J, Jemal A. Global cancer statistics, 2012. CA Cancer J Clin. 2015;65:87–108. doi: 10.3322/caac.21262. [DOI] [PubMed] [Google Scholar]
  • 2.Galeone C, Edefonti V, Parpinel M, Leoncini E, Matsuo K, Talamini R, Olshan AF, Zevallos JP, Winn DM, Jayaprakash V, Moysich K, Zhang ZF, Morgenstern H, Levi F, Bosetti C, Kelsey K, Mc-Clean M, Schantz S, Yu GP, Boffetta P, Lee YC, Hashibe M, La Vecchia C, Boccia S. Folate intake and the risk of oral cavity and pharyngeal cancer: a pooled analysis within the International Head and Neck Cancer Epidemiology Consortium. Int J Cancer. 2015;136:904–914. doi: 10.1002/ijc.29044. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Wen CP, Tsai MK, Chung WS, Hsu HL, Chang YC, Chan HT, Chiang PH, Cheng TY, Tsai SP. Cancer risks from betel quid chewing beyond oral cancer: a multiple-site carcinogen when acting with smoking. Cancer Causes Control. 2010;21:1427–1435. doi: 10.1007/s10552-010-9570-1. [DOI] [PubMed] [Google Scholar]
  • 4.Zini A, Czerninski R, Sgan-Cohen HD. Oral cancer over four decades: epidemiology, trends, histology, and survival by anatomical sites. J Oral Pathol Med. 2010;39:299–305. doi: 10.1111/j.1600-0714.2009.00845.x. [DOI] [PubMed] [Google Scholar]
  • 5.Gupta S, Kong W, Peng Y, Miao Q, Mackillop WJ. Temporal trends in the incidence and survival of cancers of the upper aerodigestive tract in Ontario and the United States. Int J Cancer. 2009;125:2159–2165. doi: 10.1002/ijc.24533. [DOI] [PubMed] [Google Scholar]
  • 6.Shi D, Jiang K, Fu Y, Fang R, Liu XI, Chen J. Overexpression of SPARC correlates with poor prognosis in patients with cervical carcinoma and regulates cancer cell epithelial-mesenchymal transition. Oncol Lett. 2016;11:3251–3258. doi: 10.3892/ol.2016.4399. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Ren H, Du P, Ge Z, Jin Y, Ding D, Liu X, Zou Q. TWIST1 and BMI1 in cancer metastasis and chemoresistance. J Cancer. 2016;7:1074–1080. doi: 10.7150/jca.14031. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Angadi PV, Patil PV, Angadi V, Mane D, Shekar S, Hallikerimath S, Kale AD, Kardesai SG. Immunoexpression of epithelial mesenchymal transition proteins E-cadherin, beta-catenin, and N-cadherin in oral squamous cell carcinoma. Int J Surg Pathol. 2016;15:10668969–16654763. doi: 10.1177/1066896916654763. [DOI] [PubMed] [Google Scholar]
  • 9.Zhong C, Zuo Z, Ji Q, Feng D. P120ctn may participate in epithelial-mesenchymal transition in OSCC. Indian J Cancer. 2016;53:20–24. doi: 10.4103/0019-509X.180821. [DOI] [PubMed] [Google Scholar]
  • 10.Yu CC, Chen PN, Peng CY, Yu CH, Chou MY. Suppression of miR-204 enables oral squamous cell carcinomas to promote cancer stemness, EMT traits, and lymph node metastasis. Oncotarget. 2016;7:20180–92. doi: 10.18632/oncotarget.7745. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Ambros V. The functions of animal microRNAs. Nature. 2004;431:350–355. doi: 10.1038/nature02871. [DOI] [PubMed] [Google Scholar]
  • 12.Liz J, Esteller M. lncRNAs and microRNAs with a role in cancer development. Biochim Biophys Acta. 2016;1:169–176. doi: 10.1016/j.bbagrm.2015.06.015. [DOI] [PubMed] [Google Scholar]
  • 13.Peng HY, Jiang SS, Hsiao JR, Hsiao M, Hsu YM, Wu GH, Chang WM, Chang JY, Jin SC, Shiah SG. IL-8 induces miR-424-5p expression and modulates SOCS2/STAT5 signaling pathway in oral squamous cell carcinoma. Mol Oncol. 2016;22:30001–30001. doi: 10.1016/j.molonc.2016.03.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Zeng Q, Tao X, Huang F, Wu T, Wang J, Jiang X, Kuang Z, Cheng B. Overexpression of miR-155 promotes the proliferation and invasion of oral squamous carcinoma cells by regulating BCL6/cyclin D2. Int J Mol Med. 2016;37:1274–1280. doi: 10.3892/ijmm.2016.2529. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Hwang MS, Yu N, Stinson SY, Yue P, Newman RJ, Allan BB, Dornan D. miR-221/222 targets adiponectin receptor 1 to promote the epithelial-to-mesenchymal transition in breast cancer. PLoS One. 2013;8:e66502. doi: 10.1371/journal.pone.0066502. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Yamashita R, Sato M, Kakumu T, Hase T, Yogo N, Maruyama E, Sekido Y, Kondo M, Hasegawa Y. Growth inhibitory effects of miR-221 and miR-222 in non-small cell lung cancer cells. Cancer Med. 2015;4:551–564. doi: 10.1002/cam4.412. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Jiang F, Zhao W, Zhou L, Zhang L, Liu Z, Yu D. miR-222 regulates the cell biological behavior of oral squamous cell carcinoma by targeting PUMA. Oncol Rep. 2014;31:1255–1262. doi: 10.3892/or.2014.2985. [DOI] [PubMed] [Google Scholar]
  • 18.Xu J, Lamouille S, Derynck R. TGF-beta-induced epithelial to mesenchymal transition. Cell Res. 2009;19:156–172. doi: 10.1038/cr.2009.5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Zavadil J, Bottinger EP. TGF-beta and epithelial-to-mesenchymal transitions. Oncogene. 2005;24:5764–5774. doi: 10.1038/sj.onc.1208927. [DOI] [PubMed] [Google Scholar]
  • 20.Chen IC, Chiang WF, Huang HH, Chen PF, Shen YY, Chiang HC. Role of SIRT1 in regulation of epithelial-to-mesenchymal transition in oral squamous cell carcinoma metastasis. Mol Cancer. 2014;13:1476–4598. doi: 10.1186/1476-4598-13-254. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Quan J, Elhousiny M, Johnson NW, Gao J. Transforming growth factor-beta1 treatment of oral cancer induces epithelial-mesenchymal transition and promotes bone invasion via enhanced activity of osteoclasts. Clin Exp Metastasis. 2013;30:659–670. doi: 10.1007/s10585-013-9570-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Kim BH, Hong SW, Kim A, Choi SH, Yoon SO. Prognostic implications for high expression of oncogenic microRNAs in advanced gastric carcinoma. J Surg Oncol. 2013;107:505–510. doi: 10.1002/jso.23271. [DOI] [PubMed] [Google Scholar]
  • 23.Song C, Chen H, Wang T, Zhang W, Ru G, Lang J. Expression profile analysis of microRNAs in prostate cancer by next-generation sequencing. Prostate. 2015;75:500–516. doi: 10.1002/pros.22936. [DOI] [PubMed] [Google Scholar]
  • 24.Chun-Zhi Z, Lei H, An-Ling Z, Yan-Chao F, Xiao Y, Guang-Xiu W, Zhi-Fan J, Pei-Yu P, Qing-Yu Z, Chun-Sheng K. MicroRNA-221 and microRNA-222 regulate gastric carcinoma cell proliferation and radioresistance by targeting PTEN. BMC Cancer. 2010;10:367. doi: 10.1186/1471-2407-10-367. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Wang DD, Li J, Sha HH, Chen X, Yang SJ, Shen HY, Zhong SL, Zhao JH, Tang JH. miR-222 confers the resistance of breast cancer cells to Adriamycin through suppression of p27kip1 expression. Gene. 2016;590:44–50. doi: 10.1016/j.gene.2016.06.013. [DOI] [PubMed] [Google Scholar]
  • 26.Yang Y, Zhao X, Li HX. MiR-221 and miR-222 simultaneously target ARID1A and enhance proliferation and invasion of cervical cancer cells. Eur Rev Med Pharmacol Sci. 2016;20:1509–1515. [PubMed] [Google Scholar]
  • 27.Jiang F, Zhao W, Zhou L, Liu Z, Li W, Yu D. MiR-222 targeted PUMA to improve sensitization of UM1 cells to cisplatin. Int J Mol Sci. 2014;15:22128–22141. doi: 10.3390/ijms151222128. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Jiang BH, Liu LZ. PI3K/PTEN signaling in angiogenesis and tumorigenesis. Adv Cancer Res. 2009;102:19–65. doi: 10.1016/S0065-230X(09)02002-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Nakano K, Vousden KH. PUMA, a novel proapoptotic gene, is induced by p53. Mol Cell. 2001;7:683–694. doi: 10.1016/s1097-2765(01)00214-3. [DOI] [PubMed] [Google Scholar]

Articles from International Journal of Clinical and Experimental Pathology are provided here courtesy of e-Century Publishing Corporation

RESOURCES