Abstract
Objective: This study aimed to analyze the hereditary spastic paraplegia (HSP)/spastic paraplegia 3A (SPG3A) genomic structure as well as the polymorphisms in SPG3G genomic structure by comparing with the normal subjects. Methods: A total of 66 sporadic cases with HSP were collected from April 2014 to September 2016. Genomic DNA extraction was performed, and all coding exons and junction region in the SPG3A gene were sequenced. Genetic mutations were identified and DNA sequence alignment was performed against 80 normal subjects without blood relationship. The polymorphism in SPG3A gene was analyzed. Results: The coding sequence of the SPG3A gene consisted of 14 exons and two polymorphisms were detected at exons 2 and 3 compared with the normal subjects; one polymorphism was detected at exons 3, 4 and 6, respectively. Conclusion: The two coding exons in the SPG3A gene in normal subjects were polymorphic and highly conservative. The intron consisted of 3 polymorphic coding sequences. Understanding the polymorphism and genetic mutations in the SPG3A gene will contribute to the diagnosis and treatment of HSP.
Keywords: Hereditary spastic paraplegia, gene, polymorphism, SPG3A
Introduction
Hereditary spastic paraplegia (HSP) is a group of inherited neurological disorders caused by axonal degeneration [1,2]. This disease usually affects the motor ability and the patients may need the wheelchair. SPG3A-related HSP may appear in childhood, and the symptoms are inconspicuous and progress slowly [3,4]. The autosomal dominant HSP is associated with the mutation at the SPG3 locus on 14q11-q21 chromosome [5,6]. In this study, we analyzed the genetic mutation and polymorphism in the SPG3A gene in HSP patients and normal subjects.
Materials and methods
Baseline data
A total of 66 sporadic cases with HSP were collected from April 2014 to September 2016. None of them had blood relationship with each other, and the diagnosis was jointly made by 3 neurologists with rich experience. In the meantime, 80 normal subjects without blood relationship were chosen as controls. The informed consent was obtained from all subjects before DNA analysis. Table 1 shows the comparison of baseline data between the two groups.
Table 1.
Comparison of baseline data and general biochemical indicators between the two groups
| Characteristics | Control group (n=80) | Research Group (n=66) | X2/t | P |
|---|---|---|---|---|
| Age (years) | 43.7±11.9 | 44.1±12.3 | 1.035 | 0.377 |
| Sex (male/female) | 43/37 | 35/31 | 0.713 | 0.409 |
| BMI (kg/m2) | 25.7±3.5 | 25.6±3.4 | 0.851 | 0.396 |
| TG (mmol/L) | 1.6±0.8 | 0.6±0.8 | 0.233 | 0.739 |
| TC (mmol/L) | 4.3±0.7 | 4.3±0.6 | 0.391 | 0.685 |
| LDL-C (mmol/L) | 2.5±0.6 | 2.6±0.7 | 1.149 | 0.351 |
| HDL-C (mmol/L) | 1.2±0.2 | 1.2±0.2 | 0.447 | 0.655 |
| SBP (mmHg) | 125.4±15.1 | 126.4±16.9 | 1.637 | 0.247 |
| DBP (mmHg) | 79.8±10.6 | 79.2±10.1 | 1.553 | 0.272 |
Methods
From all subjects 100 ml of peripheral venous blood was collected for genomic DNA extraction by using phenol-chloroform extraction. The SPG3A gene sequences were aligned between the two groups. Primers were designed using the software (ABI), and their sequences are shown in Table 2. The PCR reaction system had a volume of 25 µl, and Tag DNA polymerase and dNTPs were provided by Beijing Biosynthesis Biotechnology Co., Ltd. PCR procedures were as follows: preheating at 94°C for 2 min, denaturation at 94°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 1 min, 34 cycles. After PCR, 10 µl of the amplified product was taken and evaluated by 1.2% agarose gel electrophoresis. The remaining portion was first purified and then sequenced.
Table 2.
Primer sequences for 14 exons in the SPG3A gene
| Number | Forward | Reverse |
|---|---|---|
| 1 | 5’-GAGGGTGTGACGCTGGTATC-3’ | 5’-AAGTGGAGGGCCAGAAGACC-3’ |
| 2 | 5’-CTGTGTCGGATGTTTGAGAG-3’ | 5’-TGGAATGGTTACACCACAGC-3’ |
| 3 | 5’-TCGAATTGGAGAGGGATAAG-3’ | 5’-AAGTGCAACTTCAAGGATCC-3’ |
| 4 | 5’-TGGTAACCCTAATGACCTAG-3’ | 5’-ATGATTCCCAATTTCTGTTG-3’ |
| 5 | 5’-GTAGGGAATGATGAAGTAAG-3’ | 5’-CTAATTGGGCCAATAGTTCC-3’ |
| 6 | 5’-GTTATACCTAGAGGGAAAAG-3’ | 5’-GACCCTAATTAATATACCTGG-3’ |
| 7 | 5’-GGCACCTTAAAGTCCTCATA-3’ | 5’-CACCAAATGATCCAACAGA-3’ |
| 8 | 5’-TTAGTAGCAGCCCTGTCGTG-3’ | 5’-CATCAGCCTCCTATCAGTGG-3’ |
| 9 | 5’-TGGAGGACTGGGAAGGATTC-3’ | 5’-TTCCTCGTACCTTTGCTCCC-3’ |
| 10 | 5’-GCATTTCAGGAAAGGGAAAC-3’ | 5’-ATTTCTGACAGCCAGAAATC-3’ |
| 11 | 5’-GAAATGTGAACTGCCTGTGG-3’ | 5’-AGTTGCATGAAGGATACTGG-3’ |
| 12 | 5’-GCAGGCTCCTGATTATTAAC-3’ | 5’-TCTAATGCAGTGGCTGGCAC-3’ |
| 13 | 5’-CTGCAGGAGTATCTGTTCTG-3’ | 5’-CACCAAAGATTGTTCTAATC-3’ |
| 14 | 5’-ATGCACACATTGAGGAGTTG-3’ | 5’-TACTCCGTTCTGATGGAAGC-3’ |
Statistical method
Data were processed by SPSS 20.0 software. The data were assessed by mean ± standard deviation (SD), count data by using chi-square test, t test measurement data. Pearson test was performed to detect the correlation between the gene mutation and the baseline data, and the correlation between the polymorphism of the gene α=0.05.
Results
SPG3A genomic structure
The gene associated with SPG3A HSP was localized. It was revealed that this coding sequence consisted of 14 exons, and the relevant acceptor splicing site was sequenced, as shown in Table 3.
Table 3.
Sequence of exon-intron junction in the SPG3A gene
| Number | Exon | Intron | ||||
|---|---|---|---|---|---|---|
|
| ||||||
| Length (bp) | Start stop position | Receptor sequence | Length (bp) | Start stop position | Donor sequence | |
| 1 | 202 | 126383-126584 | - | - | - | GTGAGTAGCAAATGAGAACT |
| 2 | 248 | 101064-101311 | GTCACTGCTCTGTTCAACAG | 25067 | 101312-126379 | GTATGCAGGAAGTACTTTAA |
| 3 | 135 | 98067-98201 | TAGACTTTATCATTTTATAG | 2862 | 98202-101063 | GTATGATGCTAACTTCCTAA |
| 4 | 105 | 97503-97607 | TTTACTCTTCTTGCCTAGTAG | 459 | 97608-98066 | GTATGAAATAAGCCCATTTT |
| 5 | 51 | 95241-95291 | AATTTTATTTCTTTATCAAG | 2211 | 95292-97502 | GTAACAATATTTATTTTCTT |
| 6 | 57 | 93509-93565 | GTGTGTAATTTTGTGACTAG | 1675 | 93566-95240 | GTGAGCGAGTGTTAAATGAT |
| 7 | 93 | 75729-75821 | CCTTTCTTATTATTTGACGAG | 17687 | 75822-93508 | GTTTGTTAGATATTTAGGTA |
| 8 | 139 | 74569-74707 | TTCAGAATGATTTACTGCAG | 1021 | 74708-75728 | GTTTGTGTCTTTAATGAAT |
| 9 | 128 | 68360-68487 | GGATTTGCTTTTACTTGTAG | 6081 | 68488-74568 | GTATCACTCTCATTTCTAGA |
| 10 | 57 | 67188-67244 | ATCTTTTCTTTTATTCTTAG | 1115 | 67245-68359 | GTATTTATTAATGAGGAGGC |
| 11 | 72 | 65839-65910 | ATTTTGTACTTTGTCCAAAG | 1277 | 65911-67187 | GTAAGAGTTAAATATTTTAA |
| 12 | 432 | 60629-61060 | TACTTCTCTATCTGATACAG | 4778 | 61061-65838 | GTAAGAACACCTTTAATTCA |
| 13 | 15 | 60124-60138 | TAATCTGCCTTTTGCCACAG | 490 | 60139-60628 | GTAAGTTAAATTTTAGACGAA |
| 14 | 444 | 57462-57905 | TTTTGATGCTTTTATTCTAG | 2218 | 57906-60123 | - |
Polymorphism analysis
Polymorphisms were detected at exons 2 and 3 and introns 3 and 4 and 6, as shown in Table 4.
Table 4.
Polymorphisms in SPG3A gene
| Sequence | Gene locus | Polymorphic change | Frequency |
|---|---|---|---|
| Exon 2 | 74 | A-G | 0.12 |
| Exon 3 | 351 | A-G | 0.21 |
| Intron 3 | 19 | T-G | 0.22 |
| Intron 4 | 14 | A-C | 0.34 |
| Intron 6 | 7 | G-A | 0.08 |
Correlation analysis between genetic mutation and some baseline data
The baseline data were compared between the two groups, and no apparent correlation was detected between the disease and age, gender, BMI and blood pressure (Table 5). The results of correlation tests for polymorphic loci are given in Table 6.
Table 5.
Correlation analysis between genetic mutation and some baseline data
| Stratification | OR | 95% CI | P |
|---|---|---|---|
| Age | 0.797 | -0.447~0.935 | 0.406 |
| Sex | 1.366 | 0.338~7.531 | 0.392 |
| BMI | 1.293 | 0.931~4.035 | 0.114 |
| Hypertension | 0.968 | -3.001~1.403 | 0.765 |
Table 6.
Correlation test for polymorphic loci
| Sequence | OR | 95% CI | P |
|---|---|---|---|
| Exon 2 | 1.767 | 0.927~2.813 | 0.077 |
| Exon 3 | 1.082 | 0.626~1.871 | 0.074 |
| Intron 3 | 1.436 | 0.959~2.153 | 0.125 |
| Intron 4 | 1.687 | 0.089~2.629 | 0.785 |
| Intron 6 | 1.077 | 0.634~1.828 | 0.094 |
Discussion
HSP is characterized by hidden onset and slow progression, and its complexity is manifested as other concurrent symptoms. This feature can easily lead to misdiagnosis, and genetic testing is usually required to confirm the diagnosis [7-9]. HSP can be found across all ages, but it is relatively rare in the elderly people. There are only very limited reports on the onset above the age of 60 years old [10,11]. However, we know little about the pathogenesis of HSP, and non-genetic influence factors have not been identified yet. According to our study, there was no significant difference in age, gender and BMI between the two groups (P>0.05). Further correlation tests did not reveal apparent correlations between the baseline data and polymorphisms in HSP.
HSP is clinically divided into simple and complex type HSP. The former usually presents as progressive spasm and weakness in the lower limbs, with or without impairment of seismesthesia and functional disorders of bladder [12,13]; the latter is also combined with retinal degeneration, optic nerve atrophy, muscular atrophy, ataxia and mental retardation in addition to the above [14,15]. In terms of genetics, HSP is divided into autosomal dominant, autosomal recessive and sex-linked recessive types, all of which have genetic heterogeneity. So far over 20 HSP-related genotypes have been identified, and SPG4 and SPG6 are the most common, followed by SPG3A [16,17]. The genetic features of SPG3A are closely related to the loci on chromosome 14. The majority of the mutations are localized to exons 4, 7, 8 and 12, and the probability of mutation at exon 12 is the highest, accounting for about 35% [18,19]. SPG3A is expressed in the central nervous system, and the protein encoded contains a conservative functional region, with the formation of gamma-glutamyl transpeptidase (GGT) loci. Little is known about the functions of the protein encoded by the SPG3A gene. It is generally believed that this protein shares some similarities with SPG3A and the development of HSP is caused by the mutations in the SPG3A, which act via changing the activity of GGT. This hypothesis is supported by the fact that atlastin is highly homologous with GNRP-1 [20].
The coding sequence of the SPG3A gene which consists of 14 exons is considered to be highly conservative. By DNA sequence alignment with normal subjects we detected two polymorphisms at exons 2 and 3 and one polymorphism at introns 3, 4 and 6, respectively. The frequency of exon 2 mutation was 0.12 and that of exon 3 mutation was 0.21; the frequency of intron 3, 4 and 6 mutations was 0.22, 0.34 and 0.08, respectively. Understanding the mutated loci in the SPG3A gene and their relative frequencies will benefit the genetic analysis of HSP, which is significant for HSP related study.
Acknowledgements
This research was supported by the National Natural Science Foundation of China (81560201) and Doctor Foundation of Guizhou Provincial people’s hospital (GZSYBS [2015] 03).
Disclosure of conflict of interest
None.
References
- 1.Finsterer J, Löscher W, Quasthoff S, Wanschitz J, Auergrumbach M, Stevanin G. Hereditary spastic paraplegias with autosomal dominant, recessive, X-linked, or maternal trait of inheritance. J Neurol Sci. 2012;318:1–18. doi: 10.1016/j.jns.2012.03.025. [DOI] [PubMed] [Google Scholar]
- 2.McCorquodale DS 3rd, Ozomaro U, Huang J, Montenegro G, Kushman A, Citrigno L, Price J, Speziani F, Pericakvance MA, Züchner S. Mutation screening of spastin, atlastin, and REEP1 in hereditary spastic paraplegia. Clin Genet. 2011;79:523–530. doi: 10.1111/j.1399-0004.2010.01501.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Schlipf NA, Beetz C, Stevanin G, Erichsen AK, Forlani S, Karle K, Klebe S, Klimpe S, Durr A, Otto S. A total of 220 patients with autosomal dominant spastic paraplegia do not display mutations in the SLC33A1 gene (SPG42) Eur J Hum Genet. 2010;18:1065–1067. doi: 10.1038/ejhg.2010.68. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Hirabayashi Y, Nomura KH, Nomura K. The acetyl-CoA transporter family SLC33. Mol Aspects Med. 2004;34:586–589. doi: 10.1016/j.mam.2012.05.009. [DOI] [PubMed] [Google Scholar]
- 5.Huppke P, Brendel C, Kalscheuer V, Korenke GC, Marquardt I, Freisinger P, Christodoulou J, Hillebrand M, Pitelet G, Wilson C, Gruber-Sedlmayr U, Ullmann R, Haas S, Elpeleg O, Nürnberg G, Nürnberg P, Dad S, Møller LB, Kaler SG, Gärtner J. Mutations in SLC33A1 cause a lethal autosomal-recessive disorder with congenital cataracts, hearing loss, and low serum copper and ceruloplasmin. Am J Hum Genet. 2012;90:61–68. doi: 10.1016/j.ajhg.2011.11.030. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Yabe I, Sasaki H, Tashiro K, Matsuura T, Takegami T, Satoh T. Spastin gene mutation in Japanese with hereditary spastic paraplegia. J Med Genet. 2002;39:e46. doi: 10.1136/jmg.39.8.e46. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Park SY, Ki CS, Kim HJ, Kim JW, Sung DH, Kim BJ, Lee WY. Mutation analysis of SPG4 and SPG3A genes and its implication in molecular diagnosis of korean patients with hereditary spastic paraplegia. Arch Neurol. 2005;62:1118–1121. doi: 10.1001/archneur.62.7.1118. [DOI] [PubMed] [Google Scholar]
- 8.Clarimón J, Bertranpetit J, Boada M, Tàrraga L, Comas D. HSP70-2 (HSPA1B) is associated with noncognitive symptoms in late-onset Alzheimer’s disease. J Geriatr Psychiatry Neurol. 2003;16:146–150. doi: 10.1177/0891988703256051. [DOI] [PubMed] [Google Scholar]
- 9.Pratt WB, Gestwicki JE, Osawa Y, Lieberman AP. Targeting Hsp90/Hsp70-based protein quality control for treatment of adult onset neurodegenerative diseases. Annu Rev Pharmacol Toxicol. 2015;55:353–371. doi: 10.1146/annurev-pharmtox-010814-124332. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Yoon G, Baskin B, Tarnopolsky M, Boycott KM, Geraghty MT, Sell E, Goobie S, Meschino W, Banwell B, Ray PN. Autosomal recessive hereditary spastic paraplegia-clinical and genetic characteristics of a well-defined cohort. Neurogenetics. 2013;14:181–188. doi: 10.1007/s10048-013-0366-9. [DOI] [PubMed] [Google Scholar]
- 11.Tang B, Zhao G, Xia K, Pan Q, Luo W, Shen L, Long Z, Dai H, Zi X, Jiang H. Three novel mutations of the spastin gene in Chinese patients with hereditary spastic paraplegia. Arch Neurol. 2004;61:49–55. doi: 10.1001/archneur.61.1.49. [DOI] [PubMed] [Google Scholar]
- 12.Lu X, Cen Z, Xie F, Ouyang Z, Zhang B, Zhao G, Luo W. Genetic analysis of SPG4 and SPG3A genes in a cohort of Chinese patients with hereditary spastic paraplegia. J Neurol Sci. 2014;347:368–371. doi: 10.1016/j.jns.2014.10.017. [DOI] [PubMed] [Google Scholar]
- 13.Stevanin G, Ruberg M, Brice A. Recent advances in the genetics of spastic paraplegias. Curr Neurol Neurosci Rep. 2008;8:198–210. doi: 10.1007/s11910-008-0032-z. [DOI] [PubMed] [Google Scholar]
- 14.Macedosouza LI, Kok F, Santos S, Licinio L, Lezirovitz K, Nascimento RM, Bueno C, Martyn M, Leão EK, Zatz M. Reevaluation of a large family defines a new locus for X-linked recessive pure spastic paraplegia (SPG34) on chromosome Xq25. Neurogenetics. 2008;9:225–226. doi: 10.1007/s10048-008-0130-8. [DOI] [PubMed] [Google Scholar]
- 15.Dick KJ, Al-Mjeni R, Baskir W, Koul R, Simpson MA, Patton MA, Raeburn S, Crosby AH. A novel locus for an autosomal recessive hereditary spastic paraplegia (SPG35) maps to 16q21-q23. Neurology. 2008;71:248–252. doi: 10.1212/01.wnl.0000319610.29522.8a. [DOI] [PubMed] [Google Scholar]
- 16.Orlacchio A, Patrono C, Gaudiello F, Rocchi C, Moschella V, Floris R, Bernardi G, Kawarai T. Silver syndrome variant of hereditary spastic paraplegia: a locus to 4p and allelism with SPG4. Neurology. 2008;70:1959–1966. doi: 10.1212/01.wnl.0000294330.27058.61. [DOI] [PubMed] [Google Scholar]
- 17.Rainier S, Bui M, Mark E, Thomas D, Tokarz D, Ming L, Delaney C, Richardson RJ, Albers JW, Matsunami N, Stevens J, Coon H, Leppert M, Fink JK. Neuropathy target esterase gene mutations cause motor neuron disease. Am J Hum Genet. 2008;82:780–785. doi: 10.1016/j.ajhg.2007.12.018. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Lin P, Li J, Liu Q, Mao F, Qiu R, Hu H, Song Y, Yang Y, Gao G. A missense mutation in SLC33A1, which encodes the acetyl-CoA transporter, causes autosomal-dominant spastic paraplegia (SPG42) Am J Hum Genet. 2008;83:752–759. doi: 10.1016/j.ajhg.2008.11.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Dursun U, Koroglu C, Kocasoy OE, Ugur SA, Tolun A. Autosomal recessive spastic paraplegia (SPG45) with mental retardation maps to 10q24.3-q25.1. Neurogenetics. 2009;10:325–331. doi: 10.1007/s10048-009-0191-3. [DOI] [PubMed] [Google Scholar]
- 20.Liu TH, Dong XL, Pan CX, Du GY, Wu YF, Yang JG, Chen P, Lu C, Pan MH. A newly discovered member of the Atlastin family, BmAtlastin-n, has an antiviral effect against BmNPV inBombyx mori. Sci Rep. 2016;6:28946. doi: 10.1038/srep28946. [DOI] [PMC free article] [PubMed] [Google Scholar]