Abstract
Aim: To inquire into whether there is any relationship between MMP-2 rs2285053 and MMP-9 rs3918242 polymorphisms and the onset risk of cervical cancer (CC) and invasion and metastasis. Methods: Polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method was utilized to examine the frequency and distribution of MMP-2 rs2285053 and MMP-9 rs3918242 polymorphisms in 150 CC patients and 120 healthy individuals who were matched therewith in age and gender, and the CC risk and invasion and metastasis condition of individuals carrying different genotypes of the two single nucleotide polymorphisms (SNPs) were compared. The data were processed by SPSS 18.0 software. Results: The differences of genotype distribution frequencies of the two SNPs between the two groups were not apparent (P > 0.05), and no significant relevance was found between the two SNPs and the lymphatic metastasis of CC. The CC risk for those carrying CC/TT (rs2285053) and CT/TT (rs3918242), CC (rs2285053) and CC (rs3918242), and CC (rs2285053) and CT/TT (rs3918242) respectively was 0.135, 1.138, and 1.182 times as much as that for those carrying CT/TT (rs2285053) and CC (rs3918242) (95% CI=0.028-0.660; 95% CI=0.615-2.103; 95% CI=0.558-2.502), reflecting that the two SNPs had interactions there between. Conclusions: MMP-2 rs2285053 and MMP-9 rs3918242 polymorphisms may have correlations with CC susceptibility.
Keywords: MMP-2, MMP-9, cervical cancer, polymorphism
Introduction
Characterized by high incidence, easy metastasis and recurring, cervical cancer (CC) is a very common gynecologic malignant tumor; and the morbidity thereof ranks the second among female malignant tumors, and is at the first place among women genital tract malignancies in China [1,2]. The occurrence and development of CC is a rather complicated biological process, and etiology and pathogenesis thereof still remain unclear. Until now, many factors like virus infection, sexual activities, marital status, childbirth, economic and sanitary conditions, unbalanced diet have been observed to be relevant to the risk of CC [3-8]. In addition, the infection of human papillomavirus (HPV) has been verified to be the main cause of CC occurrence by a large number of studies [9,10]. Although many females are exposed to the same carcinogenic factors, only a few of them finally develop the disease, which shows that genetic factors are involved in the occurrence risk of CC and genetic susceptibility is related to the pathogenesis of CC.
MMP-2 and MMP-9 both belong to collagenase IV, and play important roles in tumor cell proliferation, angiogenesis and invasion and metastasis process. MMP-2 rs2285053, MMP-2 rs243865 and MMP-9 rs3918242 polymorphisms can affect the expression level of proteins by changing the transcriptional activity of genes, and this is associated with the onset of tumors [11,12]. It has been shown by reports that the three single nucleotide polymorphisms (SNPs) are correlated with the risk of a variety of malignancies such as lung cancer, breast cancer, gastric cancer, esophagus cancer, and colorectal cancer, but the relationship of the three SNPs with CC risk has not been reported yet [13-17]. This study applied polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method to detect and analyze MMP-2 rs2285053 and MMP-9 rs3918242 polymorphisms of 150 CC cases and 120 controls so as to find out whether any linkage existed between the two SNPs and the CC occurrence risk.
Materials and methods
Research subjects
The cases were 150 CC patients aged 22-75 and the controls were 120 healthy objects aged 20-79. The cases with a mean age of 49 were selected from Linyi People’s Hospital from September, 2010 to December, 2014 and were pathologically diagnosed with CC. The controls with an average age of 45.5 were randomly recruited from healthy individuals who got regular check-ups in the corresponding hospital. All the subjects agreed to provide 5 ml fresh peripheral blood. All the blood samples were preserved at -20°C for 6 h. The Linyi People’s Hospital medical ethics committee had given approval to our study.
Methods
Extraction of DNA
Phenol-chloroform method was adopted to extract the genomic DNA, which was then dissolved in TE buffer. After quantitative analysis of the mixture by ultraviolet spectrophotometer, the mixture was stored at -20°C for further using.
Selection of SNPs
The rs2285053 and rs3918242 polymorphisms in the promoter region of MMP-2 and MMP-9 respectively were selected for detection and analysis after logging in the dbSNPs Database (http://www.ncbi.nlm.nih.gov/sites/entrez).
Genotyping
We carried out the genotyping of MMP-2 rs2285053 and MMP-9 rs3918242 polymorphisms with PCR-RFLP technique. Primer designing was performed utilizing Primer 5.0 software, and primer synthesizing was accomplished by Shanghai Sangon Biotech CO., Ltd (Table 1). The amplification target fragments were respectively of 300 bp and 435 bp. The amplification process was completed with MJPTC-200 type PCR amplification instrument. The 20 µl PCR reaction system contained genomic DNA (50 ng), forward primer (12.5 pmol/L), reverse primer (12.5 pmol/L), dNTP (0.1 mmol/L), 1×PCR buffer solution (50 mmol/L KCl, 10 mmol/L Tris-HCl and 0.1% Triton X-100), MgCl2 (1.8 mmol/L), and Taq enzyme (1.0 U). The following were steps included in the PCR reaction process: 5 min initial denaturation at 94°C; 34 cycles of 40 s denaturation at 94°C, annealing of the exon and the promoter at 61°C, and 30 s extension at 72°C; and 7 min final extension. The PCR productions were observed with 2% agarose gel electrophoresis (AGE). The PCR products of the two SNPs, 5 U of restriction endonuclease Hinf I and Sph I, 1.0 μl buffer solution, and double distilled water were mixed together to reach a total volume of 10 μl, and the 10 μl mixture was put at 37°C overnight for digestion of the PCR productions. The digestion results were detected using 3.0% agarose gel. Three fragments of 300 bp, 254 bp, and 46 bp respectively were obtained from the amplification products of rs2285053, and lengths of the three fragments obtained from the PCR products of rs3918242 polymorphism were respectively 435 bp, 247 bp, and 188 bp. 10% of the samples were randomly selected and we carried out the digestion process again with double blood method so as to verify the accuracy of the former digestion process, and the results obtained this time were completely the same as the former results.
Table 1.
Primer sequences of MMP-2 rs2285053 and MMP-9 rs3918242 polymorphisms
| SNP | Primer (5’→3’) | Length | Annealing temperature |
|---|---|---|---|
| MMP-2 rs2285053 | F: ATAGGGTAAACCTCCCCACATT | 300 bp | 56°C |
| R: GGTAAAATGAGGCTGAGACCTG | |||
| MMP-9 rs3918242 | F: GCCTGGCACATAGTAGGCCC | 435 bp | 60°C |
| R: TTCCTAGCCAGCCGGCATC |
Statistical methods
SPSS 18.0 software was adopted to process the data. Hardy-Weinberg equilibrium (HWE) examinations of the frequency distributions of the genotypes of the two SNPs in both the cases and the controls were conducted. χ2 test was employed to complete comparison of genotype and allele frequencies between two groups. We selected the nonconditioned Logistic regression method to calculate the odds ratios (ORs) with their 95% confidence intervals (95% CIs) that were used to represent the relative risk of CC. The effect modification model was applied to analyze interactions between MMP-2 rs2285053 and MMP-9 rs3918242. The level of significant differences was P < 0.05.
Results
General features of the research subjects
The CC patients had an age range of 22-75 and an average age of 49; and the age range and average age of the healthy controls were 20-79 and 45.5. The age differences of the two groups were found with no significance in statistics (P > 0.05).
HWE test
The genotypes of MMP-2 rs2285053 and MMP-9 rs3918242 in the case subjects and the control subjects were in conformity with HWE (P > 0.05), suggesting the significant representativeness of all subjects.
Analysis of genotype distributions of MMP-2 rs2285053 and MMP-9 rs3918242
The frequencies of CC, CT, C allele and T allele of MMP-2 rs2285053 in case and control groups were respectively, 77.3% vs. 22.7%, 68.3% vs. 31.7%, 88.7% vs. 11.3%, and 84.2% vs. 15.8% (Table 2), but no obvious differences in the genotype frequencies between cases and controls were found (P > 0.05). These results indicated that MMP-2 rs2285053 polymorphism has no significant association with CC susceptibility. The analysis results of the relevance between MMP-2 rs2285053 and lymphatic metastasis conditions showed that no distinct correlation existed there between (OR=0.539, 95% CI=0.173-1.684) (Table 3).
Table 2.
Frequencies of genotypes and alleles of the two polymorphisms
| Case n=150 | Control n=120 | P | OR (95% CI) | ||
|---|---|---|---|---|---|
| MMP-2 rs2285053 | CC | 116 (77.3) | 82 (68.3) | - | 1.00 |
| CT | 34 (22.7) | 38 (31.7) | 0.099 | 0.632 (0.368-1.088) | |
| TT | 0 | 0 | - | - | |
| C | 266 (88.7) | 202 (84.2) | - | 1.00 | |
| T | 34 (11.3) | 38 (15.8) | 0.129 | 0.679 (0.413-1.117) | |
| MMP-9 rs3918242 | CC | 116 (77.3) | 86 (71.7) | 0.324 | 0.741 (0.427-1.286) |
| CT | 30 (20.0) | 34 (28.3) | - | 1.00* | |
| TT | 4 (2.7) | 0 | - | - | |
| C | 262 (86.0) | 203 (85.8) | 0.611 | 0.866 (0.526-1.424) | |
| T | 38 (14.0) | 34 (14.2) | - | 1.00 | |
This was the calculation result for CT and TT genotypes of rs3918242 together.
Table 3.
Relationship between the two SNPs and lymphatic metastasis
| SNP | MMP-2 rs2285053 | MMP-9 rs3918242 | ||
|---|---|---|---|---|
| Genotype | CC | CT/TT | CC | CT/TT |
| Lymphatic metastasis | 23 | 4 | 24 | 3 |
| Non-lymphatic metastasis | 93 | 30 | 92 | 31 |
| P | 0.324 | 0.134 | ||
| OR (95% CI) | 0.539 (0.173-1.684) | 0.371 (0.104-1.317) | ||
As described in Table 3, the frequencies of the three genotypes (CC, CT, and TT) and alleles (C and T) of MMP-9 rs3918242 were respectively 77.3%, 20.0%, 2.7% and 86.0% and 14.0% in cases and 71.7%, 28.3%, 0%, and 85.8%, 14.2% in controls, and discrepancies in distributions of the genotypes and alleles between the CC patients and the healthy participators were not obvious (P > 0.05). In addition, the CC risk of those who carry CT and TT genotypes was 0.741 times as much as that of CC genotype carriers. All these showed that the MMP-9 rs3918242 polymorphism had no apparent linkage with the occurrence of CC. Furthermore, the association analysis of MMP-9 rs3918242 and lymphatic metastasis status showed that rs3918242 was not significantly correlated with lymphatic metastasis (OR=0.371, 95% CI=0.104-1.317).
Influences of interactions between the two SNPs on CC risk
We put the low frequency genotype TT and CT of MMP-9 rs3918242 together for analysis (Table 4). The TT/CT of MMP-2 rs2285053 together with CC of MMP-9 rs3918242 was set into the low activity group. The results revealed that the carriers of MMP-2 rs2285053 TT/CT and MMP-9 rs3918242 TT/CT, rs2285053 CC and rs3918242 CC, and rs2285053 CC and rs3918242 TT/CT respectively had 0.135, 1.138, and 1.182 times as much the CC risk as the carriers of MMP-2 rs2285053 TT/CT and MMP-9 rs3918242 CC. Therefore, interactions existing between the two SNPs may have an influence on CC occurrence, and the carriers of MMP-2 rs2285053 TT/CT and MMP-9 rs3918242 TT/CT may have lower risk of CC.
Table 4.
Interactions of the two SNPs on CC risk
| Genotype | Case | Control | OR (95% CI) | |
|---|---|---|---|---|
|
| ||||
| MMP-2 rs2285053 | MMP-9 rs3918242 | |||
| CT/TT | CC | 32 (17.5) | 26 (21.7) | 1.00 |
| CT/TT | CT/TT | 2 (5.0) | 12 (10.0) | 0.135 (0.028-0.660) |
| CC | CC | 84 (57.5) | 60 (50.0) | 1.138 (0.615-2.103) |
| CC | CT/TT | 32 (20.0) | 22 (18.3) | 1.182 (0.558-2.502) |
Discussion
Located on chromosome 16q21, the MMP-2 gene consists of 13 exons and 12 introns, and structural genes thereof have a total length of 27 kb [18]. It is currently believed that adjustments of the expression and function of MMP-2 occurs in various different levels such as transcription, secretion, the activation of prozymogen, combinations on the cell surface, as well as interactions with MMPs inhibitors from tumor cells or host cells. MMP-2 protein has the function of degrading collagen IV of the basilar membrane and many kinds of important bioactive molecules [19]. Early studies on the relationship of MMP-2 with tumors mostly remain on the protein level. Investigations performed by Nomura and Mori et al. have proved that there exists a linkage between the expression level of MMP-2 protein and gastric cancer risk [20,21]. Zhou et al. have found that the rs2285053 polymorphism in the promotor region of MMP-2 gene can block the combination with Sp1 transcription factors and decrease the activity of the promotor [22]. Additionally, those who have the C-C haplotype made up by MMP-2 rs243865 and rs2285053 polymorphisms have higher risk of lung cancer than those having the T-T haplotype. Rollin et al. have discovered that there are no significant differences in the genotype frequency of MMP-2 rs243865 and rs2285053 polymorphisms between non-small cellular lung cancer (NSCLC) patients and healthy controls, patients who carry the T allele of MMP-2 rs2285053 can live longer than those patients who carry the CC genotype of rs2285053 after the onset of NSCLC, and those CC genotype NSCLC patients have 2.6 times higher the relative risk for mortality [14].
MMP-9 can degrade not only collagenase IV but also some cell growth factors like IL-lβ, IGFBP-3, P substance, MCP-3, and VEGF. Animal experiments demonstrate that MMP-9 has an association with the occurrence of tumors [23]. Also, MMP-9 has also been found to be related to the infiltrating and metastasis of many tumors in some case-control studies. An SNP in MMP-9 that has been frequently studied is the rs3918242 polymorphism. Matsumura et al. find that no significant differences in genotype distributions of MMP-9 rs3918242 exist between the gastric cancer patients and the controls, but there is an obvious relevance between the SNP and the infiltration, clinical stages, and lymphatic metastasis of gastric cancer (P < 0.05), and thus predict that the T allele of the SNP may have a correlation with the infiltration of gastric cancer [13].
According to our study, frequencies of genotypes and alleles of MMP-2 rs2285053 and MMP-9 rs3918242 in the case group were similar to those in the control group (P > 0.05), showing that there existed no obvious linkage between the two SNPs and CC susceptibility. After we divided the 150 patients into two groups according to lymphatic metastasis conditions, we found that the two SNPs also had no significant correlation with lymphatic metastasis (P > 0.05). However, our study was only a preliminary investigation on the correlation of MMP-2 rs2285053 and MMP-9 rs3918242 with CC risk and invasion metastasis because of its restricted sample sizes, and people should enlarge the sample sizes in further studies about this topic.
Although no apparent relationship between the two SNPs and CC was found, we discovered that interactions existed between the two SNPs after we combined the genotypes of the two SNPs for analysis. Possible reasons may be that synergy effects exist between the two SNPs due to the fact that the both MMP-2 and MMP-9 are collagenase IV, or the fact that the substrates of MMP-2 and MMP-9 are partially the same and can both induce the releasing of VEGF.
In summary, our study demonstrated that no significant linkage existed between MMP-2 rs2285053 and MMP-9 rs3918242 polymorphisms and CC risk, but there were interactions between the two SNPs. Future studies should further explore correlations between the two SNPs and pathological grading, clinical stages, survival period, and drug reactions of CC on the basis of enlarged sample sizes.
Disclosure of conflict of interest
None.
References
- 1.Scheurer ME, Tortolero-Luna G, Adler-Storthz K. Human papillomavirus infection: biology, epidemiology, and prevention. Int J Gynecol Cancer. 2005;15:727–746. doi: 10.1111/j.1525-1438.2005.00246.x. [DOI] [PubMed] [Google Scholar]
- 2.Munoz N, Bosch FX, de Sanjose S, Herrero R, Castellsague X, Shah KV, Snijders PJ, Meijer CJ. Epidemiologic classification of human papillomavirus types associated with cervical cancer. N Engl J Med. 2003;348:518–527. doi: 10.1056/NEJMoa021641. [DOI] [PubMed] [Google Scholar]
- 3.Villa LL. Human papillomaviruses and cervical cancer. Adv Cancer Res. 1997;71:321–341. doi: 10.1016/s0065-230x(08)60102-5. [DOI] [PubMed] [Google Scholar]
- 4.Danaei G, Vander Hoorn S, Lopez AD, Murray CJ, Ezzati M. Causes of cancer in the world: comparative risk assessment of nine behavioural and environmental risk factors. Lancet. 2005;366:1784–1793. doi: 10.1016/S0140-6736(05)67725-2. [DOI] [PubMed] [Google Scholar]
- 5.Cuzick J, Terry G, Ho L, Monaghan J, Lopes A, Clarkson P, Duncan I. Association between high-risk HPV types, HLA DRB1* and DQB1* alleles and cervical cancer in British women. Br J Cancer. 2000;82:1348–1352. doi: 10.1054/bjoc.1999.1103. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Altekruse SF, Lacey JV Jr, Brinton LA, Gravitt PE, Silverberg SG, Barnes WA Jr, Greenberg MD, Hadjimichael OC, McGowan L, Mortel R, Schwartz PE, Hildesheim A. Comparison of human papillomavirus genotypes, sexual, and reproductive risk factors of cervical adenocarcinoma and squamous cell carcinoma: Northeastern United States. Am J Obstet Gynecol. 2003;188:657–663. doi: 10.1067/mob.2003.132. [DOI] [PubMed] [Google Scholar]
- 7.Shyu JS, Chen CJ, Chiu CC, Huang SC, Harn HJ. Correlation of human papillomavirus 16 and 18 with cervical neoplasia in histological typing and clinical stage in Taiwan: an in-situ polymerase chain reaction approach. J Surg Oncol. 2001;78:101–109. doi: 10.1002/jso.1128. [DOI] [PubMed] [Google Scholar]
- 8.Couto E, Hemminki K. Heritable and environmental components in cervical tumors. Int J Cancer. 2006;119:2699–2701. doi: 10.1002/ijc.22226. [DOI] [PubMed] [Google Scholar]
- 9.Walboomers JM, Jacobs MV, Manos MM, Bosch FX, Kummer JA, Shah KV, Snijders PJ, Peto J, Meijer CJ, Munoz N. Human papillomavirus is a necessary cause of invasive cervical cancer worldwide. J Pathol. 1999;189:12–19. doi: 10.1002/(SICI)1096-9896(199909)189:1<12::AID-PATH431>3.0.CO;2-F. [DOI] [PubMed] [Google Scholar]
- 10.Schwartz SM, Daling JR, Shera KA, Madeleine MM, McKnight B, Galloway DA, Porter PL, McDougall JK. Human papillomavirus and prognosis of invasive cervical cancer: a population-based study. J. Clin. Oncol. 2001;19:1906–1915. doi: 10.1200/JCO.2001.19.7.1906. [DOI] [PubMed] [Google Scholar]
- 11.Yu C, Pan K, Xing D, Liang G, Tan W, Zhang L, Lin D. Correlation between a single nucleotide polymorphism in the matrix metalloproteinase-2 promoter and risk of lung cancer. Cancer Res. 2002;62:6430–6433. [PubMed] [Google Scholar]
- 12.Zhang B, Ye S, Herrmann SM, Eriksson P, de Maat M, Evans A, Arveiler D, Luc G, Cambien F, Hamsten A, Watkins H, Henney AM. Functional polymorphism in the regulatory region of gelatinase B gene in relation to severity of coronary atherosclerosis. Circulation. 1999;99:1788–1794. doi: 10.1161/01.cir.99.14.1788. [DOI] [PubMed] [Google Scholar]
- 13.Matsumura S, Oue N, Nakayama H, Kitadai Y, Yoshida K, Yamaguchi Y, Imai K, Nakachi K, Matsusaki K, Chayama K, Yasui W. A single nucleotide polymorphism in the MMP-9 promoter affects tumor progression and invasive phenotype of gastric cancer. J Cancer Res Clin Oncol. 2005;131:19–25. doi: 10.1007/s00432-004-0621-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Rollin J, Regina S, Vourc’h P, Iochmann S, Blechet C, Reverdiau P, Gruel Y. Influence of MMP-2 and MMP-9 promoter polymorphisms on gene expression and clinical outcome of non-small cell lung cancer. Lung Cancer. 2007;56:273–280. doi: 10.1016/j.lungcan.2006.11.021. [DOI] [PubMed] [Google Scholar]
- 15.Mendes O, Kim HT, Stoica G. Expression of MMP2, MMP9 and MMP3 in breast cancer brain metastasis in a rat model. Clin Exp Metastasis. 2005;22:237–246. doi: 10.1007/s10585-005-8115-6. [DOI] [PubMed] [Google Scholar]
- 16.Yu C, Zhou Y, Miao X, Xiong P, Tan W, Lin D. Functional haplotypes in the promoter of matrix metalloproteinase-2 predict risk of the occurrence and metastasis of esophageal cancer. Cancer Res. 2004;64:7622–7628. doi: 10.1158/0008-5472.CAN-04-1521. [DOI] [PubMed] [Google Scholar]
- 17.Roeb E, Dietrich CG, Winograd R, Arndt M, Breuer B, Fass J, Schumpelick V, Matern S. Activity and cellular origin of gelatinases in patients with colon and rectal carcinoma differential activity of matrix metalloproteinase-9. Cancer. 2001;92:2680–2691. doi: 10.1002/1097-0142(20011115)92:10<2680::aid-cncr1622>3.0.co;2-7. [DOI] [PubMed] [Google Scholar]
- 18.Holla LI, Fassmann A, Vasku A, Goldbergova M, Beranek M, Znojil V, Vanek J, Vacha J. Genetic variations in the human gelatinase A (matrix metalloproteinase-2) promoter are not associated with susceptibility to, and severity of, chronic periodontitis. J Periodontol. 2005;76:1056–1060. doi: 10.1902/jop.2005.76.7.1056. [DOI] [PubMed] [Google Scholar]
- 19.Price SJ, Greaves DR, Watkins H. Identification of novel, functional genetic variants in the human matrix metalloproteinase-2 gene: role of Sp1 in allele-specific transcriptional regulation. J Biol Chem. 2001;276:7549–7558. doi: 10.1074/jbc.M010242200. [DOI] [PubMed] [Google Scholar]
- 20.Mori M, Mimori K, Shiraishi T, Fujie T, Baba K, Kusumoto H, Haraguchi M, Ueo H, Akiyoshi T. Analysis of MT1-MMP and MMP2 expression in human gastric cancers. Int J Cancer. 1997;74:316–321. doi: 10.1002/(sici)1097-0215(19970620)74:3<316::aid-ijc14>3.0.co;2-9. [DOI] [PubMed] [Google Scholar]
- 21.Yamaguchi Y, Ishigaki T, Sano K, Miyamoto K, Nomura S, Horiuchi T. Three-dimensional invasion of epithelial-mesenchymal transitionpositive human peritoneal mesothelial cells into collagen gel is promoted by the concentration gradient of fibronectin. Perit Dial Int. 2011;31:477–485. doi: 10.3747/pdi.2010.00166. [DOI] [PubMed] [Google Scholar]
- 22.Zhou Y, Yu C, Miao X, Wang Y, Tan W, Sun T, Zhang X, Xiong P, Lin D. Functional haplotypes in the promoter of matrix metalloproteinase-2 and lung cancer susceptibility. Carcinogenesis. 2005;26:1117–1121. doi: 10.1093/carcin/bgi057. [DOI] [PubMed] [Google Scholar]
- 23.Bergers G, Brekken R, McMahon G, Vu TH, Itoh T, Tamaki K, Tanzawa K, Thorpe P, Itohara S, Werb Z, Hanahan D. Matrix metalloproteinase-9 triggers the angiogenic switch during carcinogenesis. Nat Cell Biol. 2000;2:737–744. doi: 10.1038/35036374. [DOI] [PMC free article] [PubMed] [Google Scholar]
