Selection and Validation of Appropriate Reference Genes for Quantitative RT-PCR Analysis in Rubia yunnanensis Diels Based on Transcriptome Data

Shanyong Yi; Qianwen Lin; Xuejia Zhang; Jing Wang; Yuanyuan Miao; Ninghua Tan

doi:10.1155/2020/5824841

. 2020 Jan 8;2020:5824841. doi: 10.1155/2020/5824841

Selection and Validation of Appropriate Reference Genes for Quantitative RT-PCR Analysis in Rubia yunnanensis Diels Based on Transcriptome Data

Shanyong Yi ¹, Qianwen Lin ¹, Xuejia Zhang ¹, Jing Wang ¹, Yuanyuan Miao ^1,^✉, Ninghua Tan ^1,^✉

PMCID: PMC6973195 PMID: 31998793

Abstract

Real-time quantitative polymerase chain reaction (RT-qPCR) has been widely applied in gene expression and transcription abundance analysis because of its high sensitivity, good repeatability, and strong specificity. Selection of relatively stable reference genes is a precondition in order to obtain the reliable analysis results. However, little is known about evaluation of a set of reference genes through scientific experiments in Rubia plants. Here, 15 candidate reference genes were selected from R. yunnanensis transcriptome database and analyzed under abiotic stresses, hormone treatments, and different tissues. Among these 15 candidate reference genes, heterogeneous nuclear ribonucleoprotein (hnRNP), TATA binding protein (TBP), ribosomal protein L5 (RPL5), malate dehydrogenase (MDH), and elongation factor 1-alpha (EF-1α) were indicated as the five most stable reference genes by four statistical programs (geNorm, NormFinder, BestKeeper, and RefFinder). Ultimately, the validity of reference genes was confirmed by normalizing the expression of o-succinylbenzoate-CoA ligase (OSBL) and isochorismate synthase (ICS) involved in the anthraquinone biosynthesis pathway in different tissues and hormone treatments. Meanwhile, four other putative genes involved in the anthraquinone biosynthesis pathway were also normalized with the selected reference genes, which showed similar expression levels with those given by transcriptome data. This work is the first research that aims at a systematic validation on the stability of reference genes selected from R. yunnanensis transcriptome data and will be conducive to analyze gene expression in R. yunnanensis or other Rubia species.

1. Introduction

Real-time quantitative polymerase chain reaction (RT-qPCR) is a technique for precise quantification of nucleic acids by monitoring the entire PCR process using a real-time fluorescence quantifier. It also plays an extremely important role in gene expression analysis and is the most extensive method compared with the other three methods (northern blot, microarray, and high-throughput sequencing) due to its high sensitivity, good repeatability, strong specificity, high throughput, wide application, and low cost [1].

RT-qPCR is a powerful tool for understanding metabolic pathways, genetics, signaling pathways, and several complex regulatory networks in organisms. The accuracy of results using this method is unavoidably affected by sample amounts, RNA integrity, cDNA quality, efficiency of enzymatic reaction, and gDNA contamination [2, 3]. In order to obtain stable and reliable results in the RT-qPCR assay, a suitable and stable reference gene is a prerequisite to normalize gene expression and avoid errors caused by the factors mentioned above.

Reference genes are usually housekeeping genes, which are expressed in all kinds of cells in organisms, and their products are essential proteins to maintain the basic life activities of cells. There are hundreds of housekeeping genes, among which GAPDH (glyceraldehyde-3-phosphate dehydrogenase), ACT (actin-related protein), TUB (beta-1 tubulin), 18S rRNA (ribosomal RNA), and 28S rRNA are often used as internal reference genes for the standardization of target genes owing to their stable expression levels under different conditions and various tissues in many plant species [4, 5]. However, these reference genes have also shown some shortcomings that their expression levels vary greatly under certain factors even if they can be stably expressed in some cells or tissues under some experimental conditions in recent studies [6, 7]. Therefore, it is completely necessary to select suitable internal reference genes as the standard to study the expression levels of target genes according to the different sample types and test conditions in order to make the results more reliable. With the development in science and technology, several new statistical algorithms such as geNorm, NormFinder, BestKeeper, and RefFinder have emerged for screening stable internal reference genes in recent years, which have been developed as efficient tools to determine conveniently the most stable reference genes for RT-qPCR normalization [8–10]. Hence, many novel reference genes were validated, and their suitability was evaluated by employing these programs in different plants, such as Euscaphis konishii [11], Sapium sebiferum [12], and Neolamarckia cadamba [13].

Rubia yunnanensis Diels is a Chinese medicinal herb mainly distributed in Yunnan Province in Southwest China, and its medicinal parts are the roots and rhizomes named “Xiaohongshen,” which are used to treat many diseases in folk medicines such as cancer, vertigo, insomnia, rheumatism, tuberculosis, menstrual disorders, and contusions [14]. It can be used as a substitute in Yunnan Province for R. cordifolia listed in Chinese Pharmacopoeia. Three major types of important constituents, i.e., quinones, Rubiaceae-type cyclopeptides, and terpenoids, have been isolated from R. yunnanensis by our group [15–17]. Several of them have been reported to have important pharmacological activities, such as rubiadin [18], RA-V [19, 20], RA-XII [21, 22], and rubiarbonol G [23]. Among them, anthraquinones are the most abundant and important bioactive compounds [17], and there are still no data reported on gene expression and also about biosynthetic pathways of anthraquinones in R. yunnanensis. Based on previous research progress on anthraquinone biosynthesis in Rubiaceae [24, 25], we hope to increase the knowledge of anthraquinone biosynthesis in R. yunnanensis, particularly in the areas such as gene expression analyses and mechanisms responsible for anthraquinone biosynthesis and regulation at their enzyme and gene levels. Moreover, fewer reference genes of Rubia were identified through scientific and systematic experiments, and randomly selected reference genes or single gene quantification RT-qPCR assays have shown frequently variability and unreliability in gene expression under various experimental conditions [26].

In our study, 15 genes including 10 common reference genes (GAPDH, eIF (eukaryotic translation initiation factor), EF-1α (elongation factor 1-alpha), UBCE (ubiquitin-conjugating enzyme), RPL5 (ribosomal protein L5), TBP (TATA binding protein), TUB, ACT2, MDH (malate dehydrogenase), and PEPC (phosphoenolpyruvate carboxykinase)) and 5 novel reference genes (SAND (SAND family protein), PP2A (serine/threonine-protein phosphatase 2A), PTBP2 (polypyrimidine tract-binding protein homolog 2), hnRNP (heterogeneous nuclear ribonucleoproteins), and F-box (F-box protein)) were selected as candidate genes according to transcriptome data of the root and stem leaf (mixed stem and leaf) of R. yunnanensis from our laboratory (Yi et al., School of Traditional Chinese Pharmacy, China Pharmaceutical University) (unpublished data). Their expression stability in R. yunnanensis was evaluated by RT-qPCR across different experimental conditions including various tissues (root, stem, and leaf), abiotic stresses (osmotic stress, salt stress, oxidative stress, metal stress, and cold and heat stress), and hormone treatments referring to previous study [27]. For hormone treatments, methyl jasmonate (MeJA) and salicylic acid (SA) were used to treat plants because they could act as the important elicitors and signaling molecule and also regulate the activity of various enzymes related to secondary metabolic pathways. Optimal reference genes were confirmed for each experimental condition through four statistical algorithm programs. The results indicated that hnRNP, TBP, RPL5, MDH, and EF-1α were the five most stable reference genes, while GAPDH, F-box, SAND, TUB, and PEPC were the least stable reference genes in all sample sets. In addition, in order to confirm the suitability of selected reference genes from our results, o-succinylbenzoate-CoA ligase (OSBL) and isochorismate synthase (ICS), two critical common enzymes involving shikimate and terpenoid pathways of anthraquinone biosynthesis, were chosen for normalizing their expression levels in different tissues and different time points after MeJA treatment using the least stable genes, the two most stable genes, and their combinations as the reference genes, respectively. Finally, the relative expression levels of other four putative key genes (isopentenyl-diphosphate delta-isomerase (IPPI), 3-hydroxy-3-methylglutaryl-coenzyme A reductase (HMGR), 1-deoxy-D-xylulose 5-phosphate synthase (DXS), and acetyl-CoA acetyltransferase (AACT)) involved in the anthraquinone biosynthesis pathway normalized with hnRNP and TBP as reference genes were compared with those calculated by the FPKM (fragments per Kilobase Million) method [28] of transcriptome data to ensure again the reliability of selected internal reference genes.

2. Materials and Methods

2.1. Plant Material

Seeds of R. yunnanensis were collected legally in the wild in Kunming, Yunnan Province, China, in October 2016. After identification by Professor Heng Li from Kunming Institute of Botany, Chinese Academy of Sciences, the seeds were sown in 25 cm × 20 cm plastic pots containing a mixture of vermiculite, nutrient soil at a ratio of 2 : 1 under a set photoperiod (16 h light and 8 h dark) at 25°C, 65% relative humidity, and PAR of 30000 lux of light intensity in Kunming Institute of Botany, Chinese Academy of Sciences (25°08′N, 102°44′E). After germination, one-year-old R. yunnanensis seedlings were obtained and then transported to the greenhouse of China Pharmaceutical University in November 2017 (31°54′N, 118°54′E) under routine management of the greenhouse as described above. The seeds samples were deposited at Prof. Tan's lab.

The experiment was conducted in May 2018. For different tissue samples, fresh roots, stems, and leaves were harvested and frozen immediately in liquid nitrogen and stored at −80°C until RNA extraction. For drought treatment, plants were subjected to 200 mL of 25% PEG 6000 once a day for seven days. For salinity stress treatment, plants were irrigated with 200 mL of 600 mM NaCl once a day for a week. For cold and heat stress treatments, plants were placed at 4°C and 42°C for two days in the illumination incubator, respectively. For heavy metal and oxidative stress, 500 mM copper sulfate (CuSO₄) and 50 mM hydrogen peroxide (H₂O₂) were applied to plant leaves once for 24 h, respectively. Exogenous H₂O₂ could enhance stress tolerance of many plants by activating the antioxidative system [29]. For hormone treatments, plant leaves were sprayed once with 25 mM MeJA and 5 mM SA for 6 h, respectively. Leaf samples in all of the treatments were cut with alcohol-sterilized scissors and collected in three biological replicates for further study. The plants without treatments were collected as control, and the harvested samples after treatments were washed with MILLI-Q-filtered water and frozen immediately in liquid nitrogen and stored at −80°C until RNA extraction.

2.2. RNA Isolation, Quality Control, and cDNA Synthesis

Total RNA was isolated from collected samples using the EASYspin Plus Complex Plant RNA kit (catalog number: RN53, Aidlab Biotechnologies Co., Ltd, Beijing, China) according to the manufacturer's instructions and treated with DNase I (catalog number: RN34, Aidlab, Beijing, China) to eliminate DNA contamination. The RNA concentration and purity were determined with a NanoDrop 2000c Spectrophotometer (Thermo Scientific, US), and RNA integrity was checked on 1% agarose gel electrophoresis. The extracted RNA had a 260/280 ratio between 1.9 and 2.1, which was considered to meet the requirements of following experiments. 0.6 μg of total RNA was prepared for synthesizing first-strand of cDNA by the Goldenstar™ RT6 cDNA Synthesis kit (Tsingke, Nanjing, China) according to the manufacture's instructions.

2.3. Selection of Candidate Reference Genes and Primer Design

Fifteen candidate reference genes, including ten traditional reference genes (GAPDH, eIF, EF-1α, UBCE, RPL5, TBP, TUB, ACT2, MDH, and PEPC) and five novel reference genes (SAND, PP2A, PTBP2, hnRNP, and F-box), were selected as candidate genes to normalize RT-qPCR experiments by screening genes with relatively stable expression, which was based on their FPKM and fold change values from transcriptome sequencing data in our lab. All data on sequences and FPKM values of screened genes are shown in Additional and Additional . The selected candidate reference genes included GAPDH, eIF, EF-1α, UBCE, RPL5, TBP, TUB, ACT2, MDH, PEPC, SAND, PP2A, PTBP2, hnRNP, and F-box that have been reported to be stably expressed in many plants such as soybean [5], Euscaphis konishii [11], poplar [30], potato [31], flax [32], wheat [33], maize [34], foxtail millet [35], sorghum [36], pearl millet [37], and cabbage [38].

Specific primer pairs of all candidate reference genes were designed using Primer Premier 5.0 according to the following parameters: primer sequences of 18–24 nucleotides, product length of 101–259 bp, melting temperature (Tm) of 58°C–62°C, and GC content of 40%–60%. All primers were synthesized by Tsingke Company (Nanjing, China) and tested by regular PCR. The PCR products were checked by 2% agarose gel electrophoresis prior to RT-qPCR. In addition, amplification efficiency (E) and correlation coefficient (R²) of primer pairs were calculated by a standard curve with a 5-fold serial dilution of first-strand cDNA (0.6 μg/μL). The gene names, primer sequences, amplicon length, and primers Tm, E, and R² of the 15 candidate reference genes and six target genes selected for validation are shown in Table 1.

Table 1.

Primers used for RT-qPCR normalization.

Gene abbreviation	Gene name	Primer sequence (5′–3′)	Amplicon length (bp^∗)	Primers Tm^∗ (°C)	E ^∗ (%)	R ² ^∗
GAPDH	Glyceraldehyde-3-phosphate dehydrogenase	For: GCTGAGATTCTTGATGGGGAG	101	58.7/58.5	97.90	0.998
GAPDH	Glyceraldehyde-3-phosphate dehydrogenase	Rev: CTTGTGGTAGGATTTACTATGGCA	101	58.7/58.5	97.90	0.998
eIF	Eukaryotic translation initiation factor	For: TCAGTTTACTCGTGGGACATCG Rev: GGTTCACATACGCAGCCTCG	181	60.1/61.3	93.58	0.992
EF-1α	Elongation factor 1-alpha	For: GAGGTTTTGAGGCTGGCATT	117	59.2/59.9	102.78	0.995
EF-1α	Elongation factor 1-alpha	Rev: GGGTGGTGGCATCCATCTT	117	59.2/59.9	102.78	0.995
SAND	SAND family protein	For: GCAACTGAATCCACAGAGCG	259	58.9/59.4	94.18	0.998
SAND	SAND family protein	Rev: CCCAGCAAAGCAGAACATAATC	259	58.9/59.4	94.18	0.998
PP2A	Serine/threonine-protein phosphatase 2A	For: TTGGTTCTTCGCAGTTGATTG	208	58.8/59.0	103.91	0.995
PP2A	Serine/threonine-protein phosphatase 2A	Rev: AGCCCGCTATTGACCTTGTT	208	58.8/59.0	103.91	0.995
hnRNP	Heterogeneous nuclear ribonucleoprotein	For: GCAAAGGCAGCACTGTCAAG	187	59.2/61.1	99.36	0.996
hnRNP	Heterogeneous nuclear ribonucleoprotein	Rev: CGGTAATGTTCCCGTATTTCTCA	187	59.2/61.1	99.36	0.996
UBCE	Ubiquitin-conjugating enzyme	For: CCCAATCCGTCTGACCCTT	203	59.3/61.7	108.08	0.99
UBCE	Ubiquitin-conjugating enzyme	Rev: GCTTTTCCAGCAACTTCCTCG	203	59.3/61.7	108.08	0.99
RPL5	60S ribosomal protein L5	For: TGGTGGGCTTGACATTCCT	150	58.2/61.5	93.62	0.994
RPL5	60S ribosomal protein L5	Rev: CGCTCTGGCTCATCTTCTTCC	150	58.2/61.5	93.62	0.994
PTBP2	Polypyrimidine tract-binding protein homolog 2	For: GGAGCAAATCGTAACCAAGCA	115	60.4/59.0	93.36	0.999
PTBP2	Polypyrimidine tract-binding protein homolog 2	Rev: AGACAGTTTTCCCTCGCACC	115	60.4/59.0	93.36	0.999
TBP	TATA binding protein	For: GGGCTTGCTTACTCTCACGG	146	59.9/58.4	101.57	0.996
TBP	TATA binding protein	Rev: TCCTCCCTAACCTTTGCTCC	146	59.9/58.4	101.57	0.996
TUB	Beta-1 tubulin	For: CTCTTCAAGTAGGTCAATGTGGG	116	58.3/58.4	98.83	0.995
TUB	Beta-1 tubulin	Rev: CCCTCCCTGAGTAGCGAAGT	116	58.3/58.4	98.83	0.995
ACT2	Actin-related protein 2	For: ATTGTCGTTGGAGATGCTTGC	149	60.1/61.7	102.79	0.995
ACT2	Actin-related protein 2	Rev: CATTCCGTTGGGTCTAACTTCAG	149	60.1/61.7	102.79	0.995
MDH	Malate dehydrogenase	For: ATCCAGTCAGATGCGTCGG	119	58.7/59.5	95.76	0.998
MDH	Malate dehydrogenase	Rev: GCTTTCTCTTCATACTCGGTCAAC	119	58.7/59.5	95.76	0.998
PEPC	Phosphoenolpyruvate carboxykinase	For: TTTGGTGTCCTTCCCCCTG	106	60.2/60.8	94.66	0.999
PEPC	Phosphoenolpyruvate carboxykinase	Rev: CCTTGATTCCATCCTCGGTTC	106	60.2/60.8	94.66	0.999
F-box	F-box protein	For: AGTTCCACCGCTACCTGTCC	129	58.9/58.8	99.03	0.996
F-box	F-box protein	Rev: ATTCGCCTTCAACGCCAA	129	58.9/58.8	99.03	0.996
OSBL	o-Succinylbenzoate-CoA ligase	For: TGCTGGCTACACTGAGGATGA	143	58.9/60.3	95.27	0.999
OSBL	o-Succinylbenzoate-CoA ligase	Rev: CCTTGACCGCTGCTTGAACT	143	58.9/60.3	95.27	0.999
ICS	Isochorismate synthase	For: CATCCCTTCATCCAACTCCAG	218	59.2/58.5	98.46	0.998
ICS	Isochorismate synthase	Rev: GCTTCCTTCTACCACGCCA	218	59.2/58.5	98.46	0.998
IPPI	Isopentenyl-diphosphate delta-isomerase	For: AACCGAGACGAGTTGAGGGA	152	59.3/58.0	93.75	0.996
IPPI	Isopentenyl-diphosphate delta-isomerase	Rev: ATGTCAATAGCATCAGTCAGGGT	152	59.3/58.0	93.75	0.996
HMGR	3-Hydroxy-3-methylglutaryl-coenzyme A reductase	For: TTGAGGTCGGGACAGTAGGTG	116	59.8/58.6	93.79	0.998
HMGR	3-Hydroxy-3-methylglutaryl-coenzyme A reductase	Rev: CAGCAGCCGAGCATTTGA	116	59.8/58.6	93.79	0.998
DXS	1-Deoxy-D-xylulose-5-phosphate synthase	For: TTCTCTGCCTACGGCTACTCTT	119	58.2/58.8	94.68	0.996
DXS	1-Deoxy-D-xylulose-5-phosphate synthase	Rev: AACTTTTCGCTGCCTCGC	119	58.2/58.8	94.68	0.996
AACT	Acetyl-CoA acetyltransferase	For: TTGAGGTCGGGACAGTAGGTG	249	60.0/59.4	96.41	0.994
AACT	Acetyl-CoA acetyltransferase	Rev: CAGCAGCCGAGCATTTGA	249	60.0/59.4	96.41	0.994

Open in a new tab

^∗bp, Tm, E, and R² indicate base pair, melting temperature, PCR efficiency, and correlation coefficient, respectively. Standard curves of 15 candidate reference genes and six target genes are shown in Additional .

RT-qPCR experiment was performed in 48-well plates on a StepOne™ Real-time PCR system (Applied Biosystems, Life Technologies, USA) using AceQ qPCR SYBR Green Master Mix (Vazyme, Nanjing, China). Total 20 μL reaction volume contained 10 μL of 2x AceQ SYBR Green Master Mix (high ROX premixed), 0.4 μL of each primer (10 μM), 2 μL of cDNA template described in item 2.2, and 7.2 μL of nuclease-free water. The reaction was conducted at the following conditions: predenaturation at 95°C for 5 min, followed by 40 cycles of denaturation at 95°C for 10 s, and annealing/extension at 60°C for 30 s. The melting curve was analyzed to determine primer specificity with the conditions at 95°C for 15 s, 60°C for 60 s, and 95°C for 15 s. qRT-PCR analysis was conducted with three biological and technical replicates, and all raw data are listed in Additional .

2.4. Data Analysis

The three most common Microsoft Excel-based statistical softwares (geNorm, NormFinder, and BestKeeper) were applied for the evaluation of the expression stability of 15 selected candidate reference genes across all the experimental sets. Expression levels of the tested genes were determined by the amplification cycle threshold (Ct) values. The raw Ct values could not be used directly by geNorm and NormFinder, which should be converted into relative quantified data “2^(−ΔCt).” ΔCt was calculated by the Ct value of each sample set subtracted with their minimum Ct (ΔCt = sample Ct − minimum Ct). Gene expression stability value (M) and pairwise variation (V) were calculated by geNorm according to the criterion that the smaller M value had the more stability, and V value was used to determine the optimal numbers of reference genes with a cut-off value of 0.15 [8, 39]. NormFinder was not only used to compare the expression differences of candidate reference genes based on the calculated stability value but also used to calculate the intra- and intergroup variations. Like geNorm, the smaller the M value, the better the stability of internal reference gene. However, the NormFinder program can only select out the most suitable internal reference gene compared to geNorm. BestKeeper was applied with the raw Ct directly to obtain standard deviations (SDs) and coefficient of variation (CV) between pairs of genes, and the criterion for gene stability was smaller CV and SD values. Ultimately, considering the differences in ranking orders of candidate reference genes given by these three different algorithms, the web-based tool RefFinder (http://leonxie.esy.es/RefFinder/) was used to rerank the candidate genes, and the results indicated that the most stably expressed gene has the lowest value [40].

2.5. Validation of Reference Genes and Expression Analysis of Putative Key Genes of Anthraquinone Biosynthesis Pathway

In order to evaluate the reliability of the selected reference genes, we analyzed the relative expression levels of two key enzyme-coding genes OSBL and ICS involved in the anthraquinone biosynthesis pathway in R. yunnanensis [24]. The expression levels of OSBL and ICS were determined and normalized using the two most and one least stable reference genes and their combinations as reference genes under various tissues (root, stem, and leaf) and MeJA treatments. For MeJA treatments, plants were sprayed once with 200 μM MeJA and leaves were then taken as samples after 1 h, 6 h, 12 h, and 24 h.

To further confirm the reliability of the proposed reference genes, we selected six putative key genes all identified as differentially expressed genes (DEGs) involved in the known anthraquinone biosynthesis pathway in root and stem leaf of R. yunnanensis. Expression levels of these six target genes were normalized to those of hnRNP and TBP. Moreover, RT-qPCR results of these genes were compared with their relative expression levels exhibited by FPKM values of R. yunnanensis transcriptome data (). The RT-qPCR experimental method was the same as described above, and the 2^−ΔΔCt method was used to calculate their relative expression levels. RT-qPCR data were obtained with three biological replicates and analyzed with variance (ANOVA) followed by Student's t-test (P < 0.05).

3. Results

3.1. Verification of Amplicons, Primer Specificity, and PCR Amplification Efficiency

The specific amplification of all primer pairs of candidate reference genes was confirmed with regular PCR and RT-qPCR. A single PCR band was found with expected size by 2.0% agarose gel electrophoresis analysis (Figure 1). A single amplification peak for each candidate reference gene was observed in the melting curve (Figure 2). The PCR amplification efficiencies for these genes ranged from 93.36% for PTBP2 to 108.08% for UBCE, and the correlation coefficients varied from 0.999 to 0.990 (Table 1).

Specificity of primer pairs for RT-qPCR amplification. The 2% agarose gel electrophoresis shows the expected size of a single band for each candidate reference gene. M represents the DNA size marker. Lane 1–lane 15: *GAPDH*, *ACT2*, *EF-1α*, *eIF*, *TBP*, *TUB*, *PP2A*, *UBCE*, *SAND*, *PEPC*, *MDH*, *hnRNP*, *PTBP2*, *RPL5*, and *F-box*.

Specificity of primer pairs for RT-qPCR amplification. Melt curves with single peaks produced for all amplicons.

3.2. Expression Profile of Candidate Reference Genes

The raw Ct values of the 15 candidate reference genes for RT-qPCR were collected and are shown in Figure 3. The Ct values varied from 17.13 (EF-1α) to 30.55 (TUB), and the average Ct values ranged from 19.40 (EF-1α) to 27.49 (TUB), which indicate that obvious differences exist in the expression profiles. Low Ct values correspond to high expression levels. Therefore, EF-1α exhibited the highest expression abundance and TUB expressed the lowest level. Moreover, Ct values also have shown the differential expression variability, and RPL5 and hnRNP had a relative narrower Ct range than other genes, showing that these two genes might be expressed more stably.

RT-qPCR raw Ct values for candidate reference genes in different samples. The line across the box depicts the median. The box indicates the 25th and 75th percentiles, and whisker caps show the maximum and minimum values. The lower the boxes and whisker, the smaller the variations.

3.3. Expression Stability of Candidate Reference Genes

In order to further confirm the stability of candidate reference genes, different treatments including osmotic stress, salt stress, heavy metal stress, oxidative stress, hormone, and temperature stress and different tissues were selected for the RT-qPCR experiments of 15 candidate reference genes. Then, 1485 Ct values (three biological and technical replicates, Additional ) were obtained for further analysis by geNorm, NormFinder, BestKeeper, and RefFinder.

3.3.1. geNorm Analysis

In geNorm analysis, measurement (M) values of expression stability of the reference genes were generated as the level of pairwise variation for each reference gene with all other control genes until the most stable reference genes were identified [8]. A cut-off M value of 1.5 was recommended for evaluating all genes stability and a lower M value meant a higher stability. In our study, the M values of the candidate genes were all lower than 1.5 and were ranked by average expression stability values of the reference genes. As shown in Figure 4, all of the most stable reference genes in the 15 candidate genes were not identical under different treatments and tissues. The most stable genes were hnRNP for the groups of tissue, PEG, and cold treatments, RPL5 for the groups of CuSO₄, MeJA, and hot treatments, TBP for the groups of total (all the samples were mixed), H₂O₂ and SA treatments, and EF-1α for the NaCl group according to their lowest M values. Correspondingly, the least stable genes were as follows: F-box for the total, CuSO₄, MeJA, and NaCl groups, EF-1α, PP2A, PEPC, GAPDH, TUB, and SAND for the PEG, H₂O₂, hot, cold, SA, and tissue groups, respectively.

Average expression stability values M of 15 candidate reference genes calculated by geNorm. Total: the mixed samples of all given conditions; PEG: drought treatment; NaCl: salinity treatment; CuSO₄: heavy metal treatment; H₂O₂: oxidation treatment; cold and hot: temperature treatment; MeJA and SA: hormone treatment; tissue: total tissues samples. The least stable genes are on the left and the most stable genes on the right.

However, an interesting finding was that the same reference genes could have different stabilities under various groups such as EF-1α, which was the most stable reference gene in the NaCl group but was the least stable reference gene for the PEG group. Another important information also observed was that MeJA treatment had a greater impact on plants than other treatments based on its wider M value (0.23 (RPL5) to 0.94 (F-box)), while PEG had the least impact with the low span of M value (0.09 (hnRNP) to 0.29 (EF-1α)), meaning that EF-1α was the least stable reference gene in the PEG group, but it could be selected as a reference gene for other experimental conditions because of its low M value. This phenomenon might also be used to explain why EF-1α could become the most stable reference gene in the NaCl group. Finally, one of the most important findings was that hnRNP, RPL5, and TBP seemed to be the three most stable reference genes according to their number of occurrences on the first four most stable genes in each group (hnRNP appeared 10 times and 6 times for TBP and RPL5, respectively).

Moreover, multiple reference genes were taken into consideration for obtaining more reliable normalization results according to the calculated pairwise variation (Vn/n + 1) ratio. In order to find the appropriate number of reference genes for normalization, an ideal ratio below 0.15 was chosen for the determination on whether additional reference genes should be required [8]. According to the results of this work, two reference genes were sufficient to meet the requirements for normalization analysis of RT-qPCR due to that a pairwise variation value of V2/3 from each sample group was lower than 0.15 (Figure 5). The best combinations were as follows: TBP + PP2A for total samples and TBP + hnRNP for tissues, hnRNP + eIF for PEG treatment and EF-1α + UBCE for salinity stress, RPL5 + MDH for MeJA treatment and TBP + UBCE for SA treatment, TBP + RPL5 for oxidative stress and RPL5 + PEPC for heavy metal stress, RPL5 + hnRNP and hnRNP + F-box for hot and cold stress, and respectively.

Determination of the optimal number of candidate reference genes for normalization in the *R. yunnanensis* sample sets. The pairwise variation (Vn/Vn + 1) was calculated between the normalization factors using the geNorm software program to determine the optimal number of reference genes required for RT-qPCR data normalization.

3.3.2. NormFinder Analysis

In order to further ensure the accuracy of experimental analysis by geNorm, NormFinder was used for analyzing expression stability values of the reference genes. Similar to geNorm, the raw data from RT-qPCR could not be used directly and should be transformed [9]. However, the difference between NormFinder and geNorm was that the former consider intra- and intergroup variations for calculating normalization factors using ANOVA to evaluate expression stability. A variation value of each reference gene was given by NormFinder, and lower values also indicate better stability (Table 2). The most stable genes could be found directly under different experimental conditions. hnRNP was the most stable gene with the minimum variation in PEG, CuSO₄, H₂O₂, MeJA, cold treatment groups, and tissue samples, while RPL5, EF-1α, eIF, and TBP were the most stable genes for hot, NaCl, SA stresses, and total samples, respectively.

Table 2.

Gene expression stability across sample sets calculated by NormFinder.

Rank	Total	PEG	NaCl	CuSO₄	H₂O₂	MeJA	SA	Cold	Hot	Tissue
1	TBP (0.32)	hnRNP (0.03)	EF-1α (0.02)	hnRNP (0.04)	hnRNP (0.04)	hnRNP (0.07)	eIF (0.08)	hnRNP (0.02)	RPL5 (0.03)	hnRNP (0.17)
2	EF-1α (0.34)	eIF (0.06)	UBCE (0.02)	RPL5 (0.05)	TBP (0.05)	RPL5 (0.09)	hnRNP (0.09)	PTBP2 (0.03)	hnRNP (0.03)	TBP (0.21)
3	UBCE (0.42)	RPL5 (0.06)	hnRNP (0.02)	PEPC (0.08)	MDH (0.07)	TBP (0.15)	TBP (0.10)	F-box (0.03)	EF-1α (0.05)	MDH (0.41)
4	MDH (0.49)	MDH (0.06)	TUB (0.04)	EF-1α (0.11)	RPL5 (0.07)	ACT2 (0.22)	EF-1α (0.11)	RPL5 (0.04)	TBP (0.06)	EF-1α (0.41)
5	RPL5 (0.51)	UBCE (0.13)	TBP (0.06)	MDH (0.12)	eIF (0.08)	MDH (0.29)	UBCE (0.12)	PP2A (0.09)	UBCE (0.09)	RPL5 (0.44)
6	hnRNP (0.52)	SAND (0.13)	RPL5 (0.11)	TBP (0.13)	ACT2 (0.11)	PTBP2 (0.30)	ACT2 (0.15)	EF-1α (0.11)	PP2A (0.20)	UBCE (0.44)
7	PTBP2 (0.58)	ACT2 (0.13)	MDH (0.15)	eIF (0.15)	TUB (0.16)	EF-1α (0.30)	PEPC (0.17)	MDH (0.13)	PTBP2 (0.22)	F-box (0.44)
8	eIF (0.58)	PTBP2 (0.15)	SAND (0.18)	ACT2 (0.17)	UBCE (0.16)	SAND (0.33)	RPL5 (0.18)	UBCE (0.14)	TUB (0.29)	PEPC (0.47)
9	PP2A (0.60)	TBP (0.15)	PEPC (0.20)	SAND (0.19)	F-box (0.17)	TUB (0.37)	SAND (0.21)	PEPC (0.16)	eIF (0.32)	ACT2 (0.50)
10	PEPC (0.63)	PP2A (0.16)	PP2A (0.21)	PP2A (0.24)	PTBP2 (0.19)	eIF (0.44)	PP2A (0.22)	TUB (0.18)	F-box (0.33)	PP2A (0.52)
11	TUB (0.65)	F-box (0.18)	PTBP2 (0.22)	UBCE (0.24)	SAND (0.20)	UBCE (0.55)	PTBP2 (0.22)	eIF (0.20)	SAND (0.35)	TUB (0.66)
12	ACT2 (0.67)	GAPDH (0.20)	ACT2 (0.24)	GAPDH (0.24)	EF-1α (0.24)	PEPC (0.65)	GAPDH (0.30)	TBP (0.20)	ACT2 (0.39)	GAPDH (0.66)
13	SAND (1.21)	PEPC (0.22)	eIF (0.38)	PTBP2 (0.54)	GAPDH (0.24)	GAPDH (0.80)	F-box (0.31)	ACT2 (0.28)	GAPDH (0.40)	eIF (0.75)
14	GAPDH (1.23)	TUB (0.23)	GAPDH (0.45)	TUB (0.63)	PEPC (0.26)	PP2A (0.81)	MDH (0.41)	SAND (0.28)	MDH (0.64)	PTBP2 (0.84)
15	F-box (1.25)	EF-1α (0.23)	F-box (0.47)	F-box (0.64)	PP2A (0.29)	F-box (1.16)	TUB (0.42)	GAPDH (0.31)	PEPC (0.79)	SAND (2.08)

Open in a new tab

3.3.3. BestKeeper Analysis

Unlike geNorm and NormFinder, the raw Ct data were used directly without conversion by BestKeeper, which compared the expression differences in samples, rather than pairwise comparisons for analyzing the expression stability of the candidate reference genes. Standard deviations (SDs) and coefficient of variation (CV) between pairs of genes were obtained to evaluate the stability of reference genes in each experimental group by BestKeeper. The most stable reference gene was considered with the lowest CV and SD, and these values should be invalid and abandoned if the value of SD was found to be greater than 1. As shown in Table 3, CV ± SD values were calculated and ranked by BestKeeper and the stability of the reference genes was gradually decreasing from the top to the end in the table similar to NormFinder. Besides, ten reference genes in group “Total” and eight genes in group “Tissue” were above the cut-off value of 1.0 and could not be applied, while all SD values of other eight groups were under 1.0, except one gene in the PEG group (F-box), two in the CuSO₄ group (TUB and PTBP2), four in the MeJA group (TUB, F-box, PEPC, and PP2A), and four in the hot group (SAND, ACT2, GAPDH, and MDH). Because of the different analytical principles, the most stable reference gene evaluated by BestKeeper differed somewhat from the results of geNorm and NormFinder. In addition, the top five most stable reference genes in each group from BestKeeper also had some relatively consistent rankings with geNorm and Normfinder, especially hnRNP, RPL5, and TBP appeared with the most frequency. Unexpectedly, the top two most unstable genes analyzed by the three softwares might be unified and confirmed in different sample sets such as F-box and GAPDH for the total group, PEPC and GAPDH for the PEG group, GAPDH and eIF for the NaCl group, TUB and PTBP2 for the CuSO₄ group, GAPDH and EF-1α for the H₂O₂ group, F-box and PP2A for the MeJA group, MDH and GAPDH for the SA group, GAPDH and SAND for the cold group, MDH and ACT2 for the hot group, and SAND and eIF for the tissue group.

Table 3.

Expression stability values for R. yunnanensis candidate reference genes calculated by BestKeeper.

Rank	Total	PEG	NaCl	CuSO₄	H₂O₂	MeJA	SA	Cold	Hot	Tissue
1	hnRNP	ACT2	F-box	F-box	PP2A	MDH	SAND	ACT2	F-box	UBCE
1	2.66 ± 0.65^∗	0.23 ± 0.06	0.77 ± 0.18	0.74 ± 0.17	0.49 ± 0.11	1.50 ± 0.39	0.33 ± 0.09	1.07 ± 0.29	0.99 ± 0.23	2.35 ± 0.51
2	TBP	RPL5	RPL5	SAND	PEPC	RPL5	TUB	TBP	eIF	PP2A
2	3.17 ± 0.73	0.45 ± 0.10	1.09 ± 0.24	1.50 ± 0.41	0.54 ± 0.11	1.88 ± 0.41	0.68 ± 0.18	1.52 ± 0.36	1.11 ± 0.25	2.87 ± 0.72
3	PP2A	TUB	TUB	MDH	MDH	ACT2	hnRNP	UBCE	PEPC	GAPDH
3	3.24 ± 0.80	0.53 ± 0.14	1.19 ± 0.33	1.79 ± 0.46	0.75 ± 0.16	2.10 ± 0.56	0.75 ± 0.19	1.52 ± 0.37	1.42 ± 0.34	3.36 ± 0.80
4	TUB	eIF	TBP	TBP	F-box	hnRNP	UBCE	PEPC	PTBP2	hnRNP
4	3.52 ± 0.97	0.74 ± 0.17	1.25 ± 0.29	1.98 ± 0.47	0.80 ± 0.14	2.23 ± 0.55	0.93 ± 0.21	1.76 ± 0.41	1.43 ± 0.34	3.60 ± 0.89
5	RPL5	hnRNP	hnRNP	hnRNP	PTBP2	SAND	TBP	hnRNP	PP2A	PEPC
5	4.08 ± 0.89	0.75 ± 0.19	1.37 ± 0.33	2.39 ± 0.59	0.99 ± 0.23	2.45 ± 0.64	0.96 ± 0.22	1.94 ± 0.47	1.48 ± 0.36	3.67 ± 0.82
6	SAND	F-box	MDH	ACT2	hnRNP	GAPDH	PP2A	PTBP2	TBP	TBP
6	4.55 ± 1.19	0.77 ± 1.18	1.44 ± 0.35	2.45 ± 0.63	1.06 ± 0.25	2.59 ± 0.69	1.01 ± 0.24	1.94 ± 0.51	2.14 ± 0.50	4.00 ± 0.92
7	eIF	MDH	SAND	PP2A	ACT2	PTBP2	ACT2	F-box	TUB	MDH
7	4.58 ± 1.08	1.03 ± 0.25	1.46 ± 0.37	2.63 ± 0.65	1.09 ± 0.27	2.84 ± 0.73	1.46 ± 0.40	2.00 ± 0.47	2.36 ± 0.63	4.12 ± 0.99
8	MDH	SAND	PEPC	eIF	TBP	eIF	eIF	TUB	hnRNP	ACT2
8	4.73 ± 1.16	1.05 ± 0.27	1.62 ± 0.33	2.69 ± 0.64	1.16 ± 0.26	2.94 ± 0.70	1.64 ± 0.40	2.02 ± 0.58	2.77 ± 0.67	44.94 ± 1.22
9	UBCE	PTBP2	ACT2	GAPDH	TUB	TBP	PEPC	PP2A	RPL5	PTBP2
9	4.76 ± 1.06	1.08 ± 0.26	1.68 ± 0.42	2.73 ± 0.68	1.17 ± 0.32	3.11 ± 0.74	1.97 ± 0.44	2.03 ± 0.51	2.90 ± 0.65	5.15 ± 1.25
10	PTBP2	UBCE	UBCE	PEPC	UBCE	TUB	F-box	RPL5	EF-1α	RPL5
10	5.16 ± 1.28	1.37 ± 0.29	1.73 ± 0.37	3.01 ± 0.66	1.33 ± 0.28	3.76 ± 1.06	2.05 ± 0.51	2.10 ± 0.48	2.94 ± 0.57	5.22 ± 1.17
11	ACT2	PP2A	EF-1α	RPL5	RPL5	UBCE	PTBP2	MDH	UBCE	F-box
11	5.34 ± 1.37	1.38 ± 0.34	1.96 ± 0.36	3.06 ± 0.67	1.44 ± 0.28	4.02 ± 0.94	2.07 ± 0.54	2.48 ± 0.64	3.19 ± 0.75	5.59 ± 1.33
12	PEPC	TBP	PP2A	EF-1α	eIF	EF-1α	EF-1α	EF-1α	SAND	TUB
12	5.45 ± 1.20	1.48 ± 0.33	2.05 ± 0.52	3.09 ± 0.60	1.50 ± 0.34	4.11 ± 0.83	2.08 ± 0.42	2.53 ± 0.51	3.67 ± 1.03	6.16 ± 1.69
13	EF-1α	GAPDH	PTBP2	UBCE	SAND	F-box	GAPDH	SAND	ACT2	SAND
13	5.60 ± 1.09	1.84 ± 0.40	2.68 ± 0.65	3.25 ± 0.74	1.85 ± 0.46	4.11 ± 1.09	2.18 ± 0.60	2.89 ± 0.81	3.84 ± 1.07	7.03 ± 1.78
14	F-box	EF-1α	eIF	TUB	GAPDH	PEPC	RPL5	eIF	GAPDH	EF-1α
14	6.22 ± 1.46	1.87 ± 0.35	3.61 ± 0.84	3.77 ± 1.05	1.94 ± 0.49	4.92 ± 1.10	2.37 ± 0.51	3.02 ± 0.72	4.00 ± 1.09	7.15 ± 1.41
15	GAPDH	PEPC	GAPDH	PTBP2	EF-1α	PP2A	MDH	GAPDH	MDH	eIF
15	7.09 ± 1.75	1.96 ± 0.40	4.01 ± 0.89	4.46 ± 1.20	2.19 ± 0.39	5.04 ± 1.26	3.14 ± 0.79	3.25 ± 0.83	5.49 ± 1.38	7.53 ± 1.80

Open in a new tab

^∗Fifteen candidate reference genes are evaluated by the lowest values of the coefficient of variance (CV) and standard deviation (SD), and these values are showed as CV ± SD.

3.3.4. RefFinder Analysis

Taking into account the discrepancy on stability analysis among three different analytical programs, RefFinder program was applied for reanalyzing the 15 reference genes based on the geometric mean of their attributed weight, which used geNorm, Normfinder, BestKeeper, and the comparative ΔCt method to rank and compare candidate reference genes [41] (Table 4). The ranking order of the top five most stable and unstable reference genes obtained by RefFinder was broadly in consistent with the results provided by geNorm and NormFinder and had slight differences with the results from BestKeeper. For instance, under all given experimental conditions, the top two most unstable genes generated by RefFinder appeared in the top five least stable genes yielded by geNorm, Normfinder, and BestKeeper. Ranking orders of the stability of 15 reference genes were summarized in order to better observe the rankings of the analysis results from the four softwares (Additional ).

Table 4.

Comprehensive ranking of 15 candidate reference genes integrated by RefFinder.

Rank^∗	Total	PEG	NaCl	CuSO₄	H₂O₂	MeJA	SA	Cold	Hot	Tissue
1	TBP (1.19)	hnRNP (2.34)	EF-1α (1.68)	hnRNP (1.97)	PTBP2 (2.11)	RPL5 (1.68)	TBP (1.97)	RPL5 (2.14)	RPL5 (2.06)	PTBP2 (2.34)
2	hnRNP (3.08)	MDH (3.03)	UBCE (2.45)	RPL5 (2.58)	hnRNP (2.21)	MDH (1.86)	hnRNP (2.45)	PTBP2 (3.56)	hnRNP (2.34)	hnRNP (2.94)
3	EF-1α (3.56)	eIF (3.83)	hnRNP (3.57)	PEPC (3.08)	TBP (2.82)	hnRNP (2.43)	UBCE (2.99)	hnRNP (3.83)	TBP (3.94)	TBP (3.13)
4	PP2A (3.83)	RPL5 (3.87)	TUB (4.00)	MDH (4.40)	MDH (4.47)	ACT2 (3.46)	eIF (3.13)	EF-1α (3.98)	EF-1α (4.28)	EF-1α (4.12)
5	RPL5 (4.23)	TBP (4.43)	TBP (4.40)	EF-1α (4.43)	RPL5 (4.95)	TBP (5.42)	SAND (5.05)	F-box (4.05)	UBCE (5.36)	UBCE (4.23)
6	UBCE (4.82)	EF-1α (5.19)	RPL5 (4.74)	TBP (6.00)	F-box (6.45)	PTBP2 (5.89)	EF-1α (5.48)	PP2A (4.90)	F-box (5.61)	MDH (6.19)
7	MDH (6.45)	ACT2 (6.15)	MDH (7.48)	SAND (6.34)	PEPC (6.84)	EF-1α (7.36)	ACT2 (6.24)	UBCE (6.05)	PP2A (5.73)	F-box (6.21)
8	eIF (6.96)	SAND (6.16)	F-box (7.62)	eIF (7.24)	eIF (7.14)	SAND (7.52)	PEPC (7.65)	PEPC (6.70)	eIF (5.83)	PP2A (6.67)
9	TUB (7.88)	UBCE (7.33)	PEPC (7.98)	F-box (7.62)	ACT2 (7.24)	eIF (7.84)	PP2A (8.57)	ACT2 (6.71)	PTBP2 (6.09)	PEPC (6.93)
10	PTBP2 (9.08)	PTBP2 (8.74)	PP2A (8.21)	ACT2 (8.38)	PP2A (9.06)	TUB (9.93)	TUB (9.06)	TBP (6.83)	TUB (8.71)	RPL5 (6.96)
11	PEPC (10.70)	TUB (10.00)	SAND (9.46)	PP2A (8.57)	TUB (9.19)	GAPDH (10.70)	RPL5 (9.16)	MDH (9.32)	PEPC (10.00)	GAPDH (9.00)
12	SAND (12.20)	F-box (10.60)	ACT2 (11.00)	GAPDH (10.60)	UBCE (9.74)	UBCE (11.20)	PTBP2 (11.50)	TUB (10.50)	SAND (11.00)	ACT2 (10.20)
13	ACT2 (12.20)	PP2A (10.70)	PTBP2 (12.20)	UBCE (12.00)	SAND (11.70)	PEPC (12.20)	F-box (12.50)	eIF (12.50)	GAPDH (12.70)	TUB (12.50)
14	GAPDH (14.20)	GAPDH (12.20)	eIF (13.20)	PTBP2 (13.50)	EF-1α (12.50)	PP2A (14.20)	GAPDH (12.70)	SAND (14.00)	ACT2 (12.70)	eIF (14.00)
15	F-box (14.70)	PEPC (13.50)	GAPDH (14.20)	TUB (14.00)	GAPDH (14.00)	F-box (14.50)	MDH (14.20)	GAPDH (15.00)	MDH (14.20)	SAND (14.70)

Open in a new tab

^∗RefFinder exploits computational programs (such as BestKeeper, geNorm, Normfinder, or the comparative delta-ct method) to rank and compare candidate reference genes. The values following the genes indicate the geometric mean of the attributed weights measured by this software for the overall final ranking.

3.4. Validation of Reference Genes and Expression Analysis of Putative Key Genes of Anthraquinone Biosynthesis Pathway

To confirm the stability of reference genes in this study, two key enzyme-coding genes OSBL and ICS involved in the anthraquinone biosynthesis pathway in Rubiaceae [24] were selected for analyzing the relative expression levels under different tissues and MeJA treatments with two unstable reference genes (SAND and F-box), three stable reference genes (hnRNP, TBP, and RPL5), and their combinations as reference genes according to the comprehensive rankings of reference genes by four software programs mentioned above. As depicted in Figures 6(a) and 6(b), slight differences were produced in the relative expression levels of both OSBL and ICS when hnRNP, TBP, and hnRNP + TBP were used for the normalization in the group of different tissues. However, when using SAND as the normalization factor, OSBL and ICS exhibited significant differences in their relative expression levels of root and leaf samples compared with those normalized by the other three genes. The expression levels of OSBL and ICS were the highest in root, followed by leaf, and lowest in stem. For MeJA treatments (1 h, 6 h, 12 h, and 24 h), differences also emerged in the relative expression levels of both OSBL and ICS at each corresponding time point when normalized with hnRNP, RPL5, and hnRNP + RPL5. Nevertheless, extremely significant differences were observed when using the most unstable gene F-box as a reference gene for normalizing the relative expression levels of OSBL and ICS in 1 h, 6 h, 12 h, and 24 h samples, respectively (Figures 6(c)–6(d)). Therefore, incorrect results would be obtained when using the improper reference gene for the normalization of target genes.

Relative expression levels of *OSBL* and *ICS* using selected reference genes (the most or the least stable reference genes) for normalization under different tissues (root, stem, and leaf) and MeJA stress treatment sets: (a) *OSBL* expression levels on different tissues; (b) *ICS* expression levels on different tissues; (c) *OSBL* expression levels on leaves under MeJA treatment after 1 h, 6 h, 12 h, and 24 h; (d) *ICS* expression levels on leaves under MeJA treatment after 1 h, 6 h, 12 h, and 24 h. The error bars represent the mean of three biological replicates ± SD.

In our study, six putative key genes involved in the anthraquinone biosynthesis pathway were analyzed. The KEGG enrichment analysis (ko00130) showed that anthraquinones could be biosynthesized by two pathways consistent with the previous reports [24]. To better determine the accuracy and applicability of the selected reference genes and understand the expression patterns of key genes in the anthraquinone biosynthesis pathway, hnRNP and TBP were selected as reference genes for RT-qPCR data normalization of relative expression levels of six putative key genes involved in the anthraquinone biosynthesis pathway in the root and stem leaf of R. yunnanensis (Table 5; Additional and ). The RT-qPCR and FPKM results were compared and presented in Figure 7, revealing that the relative expression levels of six target genes were consistent with differential expression patters in the root and stem leaf of R. yunnanensis and their expression levels in root were higher than those in stem leaf.

Table 5.

Six putative key genes involved in the biosynthetic pathways of anthraquinones in R. yunnanensis.

Enzyme name	Abbreviation	EC number	Query ID
Shikimate pathway key genes forming rings A and B
Isochorismate synthase	ICS	5.4.99.6	TRINITY_DN125672_c2_g2
o-Succinylbenzoate-CoA ligase	OSBL	6.2.1.26	TRINITY_DN125216_c2_g1
Isopentenyl-diphosphate isomerase	IPPI	5.3.3.2	TRINITY_DN131965_c2_g1

Terpenoid pathway key genes forming ring C
Acetyl-CoA acetyltransferase	AACT	2.3.1.9	TRINITY_DN130086_c0_g2
3-Hydroxy-3-methylglutaryl-coenzyme A reductase	HMGR	1.1.1.34	TRINITY_DN129754_c4_g1
1-Deoxy-D-xylulose 5-phosphate synthase	DXS	2.2.1.7	TRINITY_DN124410_c3_g1

Open in a new tab

RT-qPCR validation of relative expression levels of six putative key genes involved in anthraquinone biosynthesis pathways using *hnRNP* and *TBP* as reference genes in the root and stem leaf (SL) of *R. yunnanensis*. Columns indicate relative expression levels of six genes calculated by the FPKM method (left y-axis) (Additional ); lines indicating the relative expression levels were obtained by RT-qPCR (right y-axis) (2^−ΔΔCt method). Error bars indicate the standard deviation of mean values of three repeats.

4. Discussion

Our current research on R. yunnanensis has been focused in the fields of the extraction and separation of chemical compositions and pharmacological activities [15–17, 19–23] but still not focused on its molecular function and gene expression. Therefore, de novo transcriptome sequencing of R. yunnanensis had been completed in our group for further studies concerning about the biosynthesis of secondary metabolites and related gene function mining (unpublished). To obtain accurate and reliable results for the realization of these goals, a stable and suitable reference gene would be selected and evaluated for the normalization of gene expression analysis by RT-qPCR in our research.

An ideal reference gene should be stably expressed in all samples under a range of given experimental conditions to ensure the accuracy and reproducibility of measurement of target genes expression abundance. However, no universally applicable reference genes with an invariant expression are available, which made it particularly important to screen stable reference genes. Indeed, the 15 candidate reference genes showed a relatively wide range of expression profiles in our study, confirming again that no single gene could be used for normalization in all the samples of different tissues and various experimental conditions, similar to the results in Euscaphis konishii [11], Pennisetum glaucum [37], Bixa orellana [42], and Klebsiella pneumoniae [43]. Owning to no reports on reference genes of R. yunnanensis, 15 candidate reference genes including 10 general housekeeping genes (GAPDH, eIF, EF-1α, UBCE, RPL5, TBP, TUB, ACT2, MDH, and PEPC) and 5 novel genes (SAND, PP2A, PTBP2, hnRNP, and F-box) were selected from the R. yunnanensis transcriptome database for evaluation according to some literatures [44–46]. RT-qPCR is considered the most common method for gene expression analyses based on its high sensitivity and specificity. The primer pairs of 15 candidate reference genes were validated and presented high specificity by regular PCR gel electrophoresis and RT-qPCR melting curve. The correlation coefficient (R² > 0.99) (Additional ) and PCR efficiency (93.36% to 108.08%) (Table 1) indicated that the curves had a good linear relationship and the amplification conditions were acceptable. Therefore, the standard curve and amplification efficiency of each prime pair meet the requirements of the following experiments, which proved that the designed primers for 15 candidate reference genes were suitable for screening and evaluating the reference genes in R. yunnanensis.

The raw Ct data were obtained by RT-qPCR under the different treatments and tissues and analyzed using four most popular computational programs of gene expression analysis (geNorm, NormFinder, BestKeeper, and RefFinder) for ranking the reference genes. Different rankings of the 15 candidate reference genes were shown according to the four algorithms, indicating the necessity of utilizing more than one program to obtain the best results. Firstly, the expression levels of the candidate genes could be observed directly by the mean Ct values (Figure 3), and the lower values indicated higher expression levels. A prerequisite for accurate normalization of genes was the expression level with a suitable range of Ct values [13], and Ct values ranged from 17.13 (EF-1α) to 30.55 (TUB) in this study were sufficient for experimental needs (Additional ). The stability of genes could be reflected in the ranges of different transcriptional abundances from candidate reference genes. For instance, the expression of RPL5 and hnRNP might be more stable than others according to the relative narrower Ct range. Importantly, these results were somehow consistent with the outcomes calculated by geNorm, NormFinder, BestKeeper, and RefFinder (Figure 4 and Tables 2–4), indicating that the expression level and the stability analysis of reference genes need to be combined with each other. Moreover, these results also revealed that none of 15 reference genes could be expressed constantly in all different conditions and tissues from R. yunnanensis.

For different analysis softwares, geNorm evaluated the stability of reference genes with the average pairwise variation [8], and NormFinder exhibited the expression stability of reference genes by analyzing their intra- and intergroup variation. However, the CV and SD values were the key factors in determining the stability rankings of reference genes obtained by BestKeeper [10]. Thus, the results were also reasonable for some differences in the ranking order shown by the three programs in our research. In geNorm analysis, hnRNP, RPL5, TBP, and EF-1α were the most stable genes and F-box, EF-1α, PP2A, PEPC, GAPDH, TUB, and SAND were the least stable genes under different conditions, which was relatively consistent with the results given by NormFinder, and thus further ensured the accuracy and reliability of the analysis results.

However, F-box, the most unstable reference gene in NaCl and CuSO₄ groups from geNorm and NormFinder analyses, was ranked at a top position in BestKeeper analysis. Similar research findings were reported in some literatures on the selection and validation of reference genes in other plant species such as sorghum [36] and pearl millet [37]. Fortunately, BestKeeper still showed some conformance in the top five most stable reference genes with geNorm and Normfinder (Figure 4; Tables 2 and 3). Finally, a widely used web-based tool RefFinder was used to obtain a consensus stability ranking of each candidate gene under the given conditions according to the geometric mean of the attributed weights of each gene [45, 47]. For RefFinder analysis, hnRNP, RPL5, TBP, and EF-1α were ranked as the top four most stable reference genes similar with the results from geNorm, Normfinder, and BestKeeper. Synthetically, hnRNP, TBP, RPL5, MDH, and EF-1α were the five most frequent and stable genes ranked by the four programs with hnRNP occurring for 37 times, TBP for 26 times, RPL5 for 25 times, MDH for 18 times, and EF-1α for 17 times. Among them, the top three stable genes given by BestKeeper were hnRNP for 8 times, TBP for 5 times, and RPL5 for 4 times. Correspondingly, the top five least stable genes in all groups were also obtained for GAPDH with 36 times, F-box with 20 times, SAND with 19 times, TUB with 17 times, and PEPC with 16 times. Noticeably, the most unstable gene seemed to be determined from the top five least stable genes in each group (Additional ).

Based on the stability value sequence, hnRNP, RPL5, and TBP ranked firstly and were considered the most stable reference genes for analyzing all sample sets. Traditional housekeeping genes have been used as internal reference genes for normalization for a long time because proteins encoded by housekeeping genes were either used to maintain the cell structure or to participate in basic cellular metabolic processes. Theoretically, they could be stably expressed in different types of cells or in different physiological states. However, previous reports have demonstrated that some housekeeping genes have shown poor expression stability in some experimental conditions, which could not be used as internal reference genes for RT-qPCR analysis [48, 49]. In this study, the traditional housekeeping genes RPL5, TBP, MDH, and EF-1α exhibited quite good stability under the given conditions. Unexpectedly, a novel reference gene, hnRNP, vital for the translation of mRNA in the cytoplasm [50] also showed particularly excellent stability in all sample sets. Furthermore, increasing studies in various species [51–53] tended to apply multiple references rather than a single one considering the reliability and accuracy for the normalization of RT-qPCR data. In our study, the combination of two reference candidate genes has already satisfied the normalization under all the experimental conditions and various tissues (Figure 5).

To confirm the suitability of the reference genes selected from our study, a validation experiment is prerequisite for the evaluation of the reference genes. Three stable reference genes (hnRNP, TBP, and RPL5) and their combinations and two of least stable genes (SAND and F-box) were used for the normalization of OSBL and ICS. The relative expression levels of OSBL and ICS involved in anthraquinone biosynthesis were assessed under different tissues and MeJA treatments. Apparently, only the slight differences were noticed in the relative expression levels of OSBL and ICS between both the groups of different tissues and MeJA treatments when using the pairs of selected stable reference genes alone or their combinations for normalization. However, the opposite results were exhibited when the least stable reference genes were used for the normalization of relative expression levels of OSBL and ICS between different tissues and MeJA treatments, suggesting that the selection and confirmation of suitable and stable reference genes were particularly critical for the proper normalization for the RT-qPCR data in R. yunnanensis. Besides, significant differences were found in which the relative expression levels of OSBL and ICS in root were much higher than those on stem and leaf (Figures 6(a) and 6(b)).

These results might be regarded as a reference to reflect the contents of anthraquinones in R. yunnanensis and used to explain why the root of R. yunnanensis is used as the major medicinal parts. For the MeJA stress, the relative expression levels of OSBL and ICS were markedly upregulated after R. yunnanensis was treated for 1 h and then significantly downregulated in 6 h and 12 h until they tend to rise slowly again between 12 and 24 hours, indicating that some strong responses were produced and enhanced in the relative expression levels of OSBL and ICS of R. yunnanensis at the beginning of the MeJA stimulation for 1 h (Figures 6(c) and 6(d)). This phenomenon might be elucidated by previous literature reports indicating that MeJA plays critical roles in the increase of anthraquinone contents in Rubiaceae plants by upregulating the expression levels of genes related to anthraquinone biosynthetic pathways [24, 54]. It is also known that MeJA could upregulate the expression of defense-related genes [55], so the upregulation of OSBL and ICS in response to MeJA treatment on R. yunnanensis might indicate that anthraquinone biosynthesis is possibly related to its defense response.

Anthraquinones are the most abundant and important bioactive compounds, and their biosynthesis pathway is still unclear in R. yunnanensis. However, major routes of biosynthesis of anthraquinones in Rubiaceae have been reported that its rings A and B are formed via the shikimate pathway and ring C for the terpenoid pathway [24]. In anthraquinone biosynthesis, we selected the six putative key DEGs encoding anthraquinone biosynthetic enzymes based on KEGG enrichment pathway analysis from the transcriptome database of R. yunnanensis and previous literature report [24]. A further comparison was conducted with the RT-qPCR and FPKM results on relative expression levels of six target genes in the root and stem leaf of R. yunnanensis. These two-part results both showed the similar differential expression patterns of six target genes in the root and stem leaf of R. yunnanensis, indicating that hnRNP and TBP could be indeed stable reference genes in the tissue group (Figure 7). The higher expression levels of these target genes in the root than stem leaf might indicate that root was the main organ for anthraquinone synthesis. Consequently, the results of our analysis not only highlighted the importance and necessity of selecting suitable and stable reference genes for the quantitative experiments by RT-qPCR but also established a foundation to explore the biosynthetic pathway of anthraquinones.

5. Conclusions

Our study presented the evaluation of the expression stability of 15 candidate reference genes, including 10 common housekeeping genes and 5 novel genes obtained from the transcriptome data in R. yunnanensis under a wide range of experimental conditions. According to our results, comprehensive rankings order was showed by four widely used programs (geNorm, NormFinder, BestKeeper, and RefFinder), indicating that hnRNP, RPL5, and TBP displayed better stability in all groups. Meanwhile, unstable genes were relatively consistent combining the two most unstable genes by RefFinder with the top four least stable genes by three other softwares under the corresponding conditions. In addition, the expression analysis of OSBL and ICS emphasized the importance of selecting suitable and stable genes for the normalization of gene expression analysis by RT-qPCR. Meanwhile, the expression patterns of putative key genes in anthraquinone biosynthesis pathway of R. yunnanensis were investigated by RT-qPCR for the first time. This study is the first report on the selection and validation of reference genes and will supply an important foundation for the future research on gene expression analyses by RT-qPCR in R. yunnanensis and related species of Rubia.

Acknowledgments

This work was financially supported to collect samples and conduct experiments by the National New Drug Innovation Major Project of Ministry of Science and Technology of China (2017ZX09309027), the National Natural Science Foundation of China (31470428), the Fund of Chinese Academy of Sciences (XDA09030301-4), the Program for Innovative Research Team of Jiangsu Province, Postgraduate Research and Practice Innovation Program of Jiangsu Province (KYCX18_0827), Postdoctoral Science Foundation of China (2017M611959), the Natural Science Foundation of Jiangsu Province (BK20180571), and the Fund for Double First-Class University Project from China Pharmaceutical University (CPU2018GF05). The authors would like to thank Kunming Institute of Botany, Chinese Academy of Sciences, for providing greenhouses to grow experimental plants.

Contributor Information

Yuanyuan Miao, Email: miaoyuanyuan1989@163.com.

Ninghua Tan, Email: nhtan@cpu.edu.cn.

Data Availability

The data used to support the findings of this study are included within the article.

Disclosure

The funding bodies were not involved in the design of the study and collection, analysis, and interpretation of data and in writing the manuscript.

Conflicts of Interest

The authors declare that there are no conflicts of interest.

Authors' Contributions

Shanyong Yi and Qianwen Lin contributed equally to this work. Shanyong Yi, Ninghua Tan, and Yuanyuan Miao designed the experiments. YuanYuan Miao, Xuejia Zhang, and Qianwen Lin selected the material. Shanyong Yi, Qianwen Li, and Jing Wang performed the experiments and analyzed the data. Shanyong Yi, Yuanyuan Miao, and Ninghua Tan wrote the paper. All authors read and approved the final manuscript.

Supplementary Materials

Additional Figure S1: standard curves of 15 candidate reference genes and six target genes were directly generated by StepOne™ Real-time PCR system. Additional File 1: sequence information of 15 candidate reference genes and six target genes selected from R. yunnanensis transcriptome database. Table S1: information of 15 candidate reference genes and six target genes selected for evaluation and validation based on R. yunnanensis transcriptome database. Table S2: raw Ct values in R. yunnanensis. Table S3: expression stability ranking of the 15 candidate reference genes estimated by geNorm, NormFinder, BestKeeper, and RefFinder.

Click here for additional data file.^{(551.4KB, zip)}

References

1.Caldana C., Scheible W.-R., Mueller-Roeber B., Ruzicic S. A quantitative RT-PCR platform for high-throughput expression profiling of 2500 rice transcription factors. Plant Methods. 2007;3(1):p. 7. doi: 10.1186/1746-4811-3-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
2.Remans T., Keunen E., Bex G. J., Smeets K., Vangronsveld J., Cuypers A. Reliable gene expression analysis by reverse transcription-quantitative PCR: reporting and minimizing the uncertainty in data accuracy. The Plant Cell. 2014;26(10):3829–3837. doi: 10.1105/tpc.114.130641. [DOI] [PMC free article] [PubMed] [Google Scholar]
3.Phillips M. A., D’Auria J. C., Luck K., Gershenzon J. Evaluation of candidate reference genes for real-time quantitative PCR of plant samples using purified cDNA as template. Plant Molecular Biology Reporter. 2009;27(3):407–416. doi: 10.1007/s11105-008-0072-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
4.Delporte M., Legrand G., Hilbert J. L., Gagneul D. Selection and validation of reference genes for quantitative real-time PCR analysis of gene expression in Cichorium intybus. Frontiers in Plant Science. 2015;6:p. 651. doi: 10.3389/fpls.2015.00651. [DOI] [PMC free article] [PubMed] [Google Scholar]
5.Saraiva K. D. C., Fernandes de Melo D., Morais V. D., Vasconcelos I. M., Costa J. H. Selection of suitable soybean EF1α genes as internal controls for real-time PCR analyses of tissues during plant development and under stress conditions. Plant Cell Reports. 2014;33(9):1453–1465. doi: 10.1007/s00299-014-1628-1. [DOI] [PubMed] [Google Scholar]
6.Bas A., Forsberg G., Hammarstrom S., Hammarstrom M.-L. Utility of the housekeeping genes 18S rRNA, beta-actin and glyceraldehyde-3-phosphate-dehydrogenase for normalization in real-time quantitative reverse transcriptase-polymerase chain reaction analysis of gene expression in human T lymphocytes. Scandinavian Journal of Immunology. 2004;59(6):566–573. doi: 10.1111/j.0300-9475.2004.01440.x. [DOI] [PubMed] [Google Scholar]
7.Tricarico C., Pinzani P., Bianchi S., et al. Quantitative real-time reverse transcription polymerase chain reaction: normalization to rRNA or single housekeeping genes is inappropriate for human tissue biopsies. Analytical Biochemistry. 2002;309(2):293–300. doi: 10.1016/s0003-2697(02)00311-1. [DOI] [PubMed] [Google Scholar]
8.Vandesompele J., De Preter K., Pattyn F., et al. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biology. 2002;3(7):1–11. doi: 10.1186/gb-2002-3-7-research0034. [DOI] [PMC free article] [PubMed] [Google Scholar]
9.Andersen C. L., Jensen J. L., Ørntoft T. F. Normalization of real-time quantitative reverse transcription-PCR data: a model-based variance estimation approach to identify genes suited for normalization, applied to bladder and colon cancer data sets. Cancer Research. 2004;64(15):5245–5250. doi: 10.1158/0008-5472.can-04-0496. [DOI] [PubMed] [Google Scholar]
10.Pfaffl M. W., Tichopad A., Prgomet C., Neuvians T. P. Determination of stable housekeeping genes, differentially regulated target genes and sample integrity: BestKeeper—excel-based tool using pair-wise correlations. Biotechnology Letters. 2004;26(6):509–515. doi: 10.1023/b:bile.0000019559.84305.47. [DOI] [PubMed] [Google Scholar]
11.Liang W.-X. , Zou X.-X., Carballar-Lejarazú R., et al. Selection and evaluation of reference genes for qRT-PCR analysis in Euscaphis konishii Hayata based on transcriptome data. Plant Methods. 2018;14:p. 42. doi: 10.1186/s13007-018-0311-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
12.Chen X., Mao Y., Huang S.-W., et al. Selection of suitable reference genes for quantitative real-time PCR in Sapium sebiferum. Frontiers in Plant Science. 2017;8:p. 637. doi: 10.3389/fpls.2017.00637. [DOI] [PMC free article] [PubMed] [Google Scholar]
13.Huang T., Long J.-M., Liu S.-W., et al. Selection and validation of reference genes for mRNA expression by quantitative real-time PCR analysis in Neolamarckia cadamba. Scientific Reports. 2018;8(1):p. 9311. doi: 10.1038/s41598-018-27633-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
14.Lan M. Dian Nan Ben Cao. Kunming, China: Yunnan People’s Publishing House; 1978. [Google Scholar]
15.Fan J.-T., Su J., Peng Y.-M., et al. Rubiyunnanins C-H, cytotoxic cyclic hexapeptides from Rubia yunnanensis inhibiting nitric oxide production and NF-κB activation. Bioorganic & Medicinal Chemistry. 2010;18(23):8226–8234. doi: 10.1016/j.bmc.2010.10.019. [DOI] [PubMed] [Google Scholar]
16.Fan J.-T., Chen Y.-S., Xu W.-Y., et al. Rubiyunnanins A and B, two novel cyclic hexapeptides from Rubia yunnanensis. Tetrahedron Letters. 2010;51(52):6810–6813. doi: 10.1016/j.tetlet.2010.07.066. [DOI] [Google Scholar]
17.Fan J.-T., Kuang B., Zeng G.-Z., et al. Biologically active arborinane-type triterpenoids and anthraquinones from Rubia yunnanensis. Journal of Natural Products. 2011;74(10):2069–2080. doi: 10.1021/np2002918. [DOI] [PubMed] [Google Scholar]
18.Tripathi Y. B., Sharma M., Manickam M. Rubiadin, a new antioxidant from Rubia cordifolia. Indian Journal of Biochemistry & Biophysics. 1997;34:302–306. [PubMed] [Google Scholar]
19.Fang X.-Y., Chen W., Fan J.-T., et al. Plant cyclopeptide RA-V kills human breast cancer cells by inducing mitochondria-mediated apoptosis through blocking PDK1-AKT interaction. Toxicology and Applied Pharmacology. 2013;267(1):95–103. doi: 10.1016/j.taap.2012.12.010. [DOI] [PubMed] [Google Scholar]
20.Wang Z., Zhao S.-M, Song L.-H., et al. Natural cyclopeptide RA-V inhibits the NF-κB signaling pathway by targeting TAK1. Cell Death & Disease. 2018;9(7):p. 715. doi: 10.1038/s41419-018-0743-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
21.Leung H.-W., Zhao S.-M., Yue G.-G., et al. RA-XII inhibits tumour growth and metastasis in breast tumour-bearing mice via reducing cell adhesion and invasion and promoting matrix degradation. Scientific Reports. 2015;5(1):p. 16985. doi: 10.1038/srep16985. [DOI] [PMC free article] [PubMed] [Google Scholar]
22.Song L.-H, Wang Z., Wang Y.-R., et al. Natural cyclopeptide RA-XII, a new autophagy inhibitor, suppresses protective autophagy for enhancing apoptosis through AMPK/mTOR/P70S6K pathways in HepG2 Cells. Molecules. 2017;22(11):p. 1934. doi: 10.3390/molecules22111934. [DOI] [PMC free article] [PubMed] [Google Scholar]
23.Zeng G.-Z., Wang Z., Zhao L.-M., Fan J.-T., Tan N.-H. NF-κB and JNK mediated apoptosis and G0/G1 arrest of HeLa cells induced by rubiarbonol G, an arborinane-type triterpenoid from Rubia yunnanensis. Journal of Ethnopharmacology. 2018;220:220–227. doi: 10.1016/j.jep.2017.10.026. [DOI] [PubMed] [Google Scholar]
24.Han Y.-S., Van der Heijden R., Verpoorte R. Biosynthesis of anthraquinones in cell cultures of the Rubiaceae. Plant Cell, Tissue and Organ Culture. 2001;67(3):201–220. doi: 10.1023/a:1012758922713. [DOI] [Google Scholar]
25.Mantrova O. V., Dunaeva M. V., Kuzovkina I. N., Schneider B., Müller-Uri F. Effect of methyl jasmonate on anthraquinone biosynthesis in transformed madder roots. Russian Journal of Plant Physiology. 1999;46:248–251. [Google Scholar]
26.Dheda K., Huggett J. F., Chang J. S., et al. The implications of using an inappropriate reference gene for real-time reverse transcription PCR data normalization. Analytical Biochemistry. 2005;344(1):141–143. doi: 10.1016/j.ab.2005.05.022. [DOI] [PubMed] [Google Scholar]
27.Zhao Y.-C., Luo J., Xu S., et al. Selection of reference genes for gene expression normalization in Peucedanum praeruptorum Dunn under abiotic stresses, hormone treatments and different tissues. PLoS One. 2016;11(3) doi: 10.1371/journal.pone.0152356.e0152356 [DOI] [PMC free article] [PubMed] [Google Scholar]
28.Mortazavi A., Williams B. A., McCue K., Schaeffer L., Wold B. Mapping and quantifying mammalian transcriptomes by RNA-Seq. Nature Methods. 2008;5(7):621–628. doi: 10.1038/nmeth.1226. [DOI] [PubMed] [Google Scholar]
29.Wang Y., Li J.-N., Wang J.-Z., Li Z.-K. Exogenous H2O2 improves the chilling tolerance of manilagrass and mascarenegrass by activating the antioxidative system. Plant Growth Regulation. 2010;61(2):195–204. doi: 10.1007/s10725-010-9470-0. [DOI] [Google Scholar]
30.Brunner A. M., Yakovlev I. A., Strauss S. H. Validating internal controls for quantitative plant gene expression studies. BMC Plant Biology. 2004;4(1):p. 14. doi: 10.1186/1471-2229-4-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
31.Nicot N., Hausman J.-F., Hoffmann L., Evers D. Housekeeping gene selection for real-time RT-PCR normalization in potato during biotic and abiotic stress. Journal of Experimental Botany. 2005;56(421):2907–2914. doi: 10.1093/jxb/eri285. [DOI] [PubMed] [Google Scholar]
32.Huis R., Hawkins S., Neutelings G. Selection of reference genes for quantitative gene expression normalization in flax (Linum usitatissimum L.) BMC Plant Biology. 2010;10(1):p. 71. doi: 10.1186/1471-2229-10-71. [DOI] [PMC free article] [PubMed] [Google Scholar]
33.Paolacci A. R., Tanzarella O. A., Porceddu E., Ciaffi M. Identification and validation of reference genes for quantitative RT-PCR normalization in wheat. BMC Molecular Biology. 2009;10(1):p. 11. doi: 10.1186/1471-2199-10-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
34.Manoli A., Sturaro A., Trevisan S., Quaggiotti S., Nonis A. Evaluation of candidate reference genes for qPCR in maize. Journal of Plant Physiology. 2012;169(8):807–815. doi: 10.1016/j.jplph.2012.01.019. [DOI] [PubMed] [Google Scholar]
35.Kumar K., Muthamilarasan M., Prasad M. Reference genes for quantitative real-time PCR analysis in the model plant foxtail millet (Setaria italica L.) subjected to abiotic stress conditions. Plant Cell, Tissue and Organ Culture (PCTOC) 2013;115(1):13–22. doi: 10.1007/s11240-013-0335-x. [DOI] [Google Scholar]
36.Sudhakar Reddy P., Srinivas Reddy D., Sivasakthi K., Bhatnagar-Mathur P., Vadez V., Sharma K. K. Evaluation of sorghum [Sorghum bicolor (L.)] reference genes in various tissues and under abiotic stress conditions for quantitative real-time PCR data normalization. Frontiers in Plant Science. 2016;7:p. 529. doi: 10.3389/fpls.2016.00529. [DOI] [PMC free article] [PubMed] [Google Scholar]
37.Reddy P. S., Reddy D. S., Sharma K. K., Bhatnagar-Mathur P., Vadez V. Cloning and validation of reference genes for normalization of gene expression studies in pearl millet [Pennisetum glaucum (L.) R. Br.] by quantitative real-time PCR. Plant Gene. 2015;1:35–42. doi: 10.1016/j.plgene.2015.02.001. [DOI] [Google Scholar]
38.Wang C., Cui H.-M., Huang T.-H., Liu T.-K., Hou X.-L., Li Y. Identification and validation of reference genes for RT-qPCR analysis in non-heading Chinese cabbage flowers. Frontiers in Plant Science. 2016;7:p. 811. doi: 10.3389/fpls.2016.00811. [DOI] [PMC free article] [PubMed] [Google Scholar]
39.Li J.-T., Han X.-P., Wang C., et al. Validation of suitable reference genes for RT-qPCR data in Achyranthes bidentata Blume under different experimental conditions. Frontiers in Plant Science. 2017;8:p. 776. doi: 10.3389/fpls.2017.00776. [DOI] [PMC free article] [PubMed] [Google Scholar]
40.Zsóri K., Muszbek L., Csiki Z., Shemirani A. Validation of reference genes for the determination of platelet transcript level in healthy individuals and in patients with the history of myocardial infarction. International Journal of Molecular Sciences. 2013;14(2):3456–3466. doi: 10.3390/ijms14023456. [DOI] [PMC free article] [PubMed] [Google Scholar]
41.Zhuang H.-H., Fu Y.-P., He W., Wang L., Wei Y.-H. Selection of appropriate reference genes for quantitative real-time PCR in Oxytropis ochrocephala Bunge using transcriptome datasets under abiotic stress treatments. Frontiers in Plant Science. 2015;6:p. 475. doi: 10.3389/fpls.2015.00475. [DOI] [PMC free article] [PubMed] [Google Scholar]
42.Moreira V. S., Soares V. L. F., Silva R. J. S., Sousa A. O., Otoni W. C., Costa M. G. C. Selection and validation of reference genes for quantitative gene expression analyses in various tissues and seeds at different developmental stages in Bixa orellana L. Physiology and Molecular Biology of Plants. 2018;24(3):369–378. doi: 10.1007/s12298-018-0528-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
43.Gomes A. É. I., Stuchi L. P., Siqueira N. M. G., et al. Selection and validation of reference genes for gene expression studies in Klebsiella pneumoniae using reverse transcription quantitative real-time PCR. Scientific Reports. 2018;8:p. 9001. doi: 10.1038/s41598-018-27420-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
44.Ma R., Xu S., Zhao Y.-C., Xia B., Wang R. Selection and validation of appropriate reference genes for quantitative real-time PCR analysis of gene expression in Lycoris aurea. Frontiers in Plant Science. 2016;7:p. 536. doi: 10.3389/fpls.2016.00536. [DOI] [PMC free article] [PubMed] [Google Scholar]
45.Aggarwal A., Jamwal M., Viswanathan G. K., et al. Optimal reference gene selection for expression studies in human reticulocytes. The Journal of Molecular Diagnostics. 2018;20(3):326–333. doi: 10.1016/j.jmoldx.2018.01.009. [DOI] [PubMed] [Google Scholar]
46.Freitag D., Koch A., Lawson McLean A., Kalff R., Walter J. Validation of reference genes for expression studies in human meningiomas under different experimental settings. Molecular Neurobiology. 2018;55(7):5787–5797. doi: 10.1007/s12035-017-0800-3. [DOI] [PubMed] [Google Scholar]
47.Duan M.-M., Wang J.-L., Zhang X.-H., et al. Identification of optimal reference genes for expression analysis in Radish (Raphanus sativus L.) and its relatives based on expression stability. Frontiers in Plant Science. 2017;8:p. 1605. doi: 10.3389/fpls.2017.01605. [DOI] [PMC free article] [PubMed] [Google Scholar]
48.Sun H.-P., Li F., Ruan Q.-M., Zhong X.-H. Identification and validation of reference genes for quantitative real-time PCR studies in Hedera helix L. Plant Physiology and Biochemistry. 2016;108:286–294. doi: 10.1016/j.plaphy.2016.07.022. [DOI] [PubMed] [Google Scholar]
49.Die J. V., Román B., Nadal S., González-Verdejo C. I. Evaluation of candidate reference genes for expression studies in Pisum sativum under different experimental conditions. Planta. 2010;232(1):145–153. doi: 10.1007/s00425-010-1158-1. [DOI] [PubMed] [Google Scholar]
50.Beyer A. L., Christensen M. E., Walker B. W., LeStourgeon W. M. Identification and characterization of the packaging proteins of core 40S hnRNP particles. Cell. 1977;11(1):127–138. doi: 10.1016/0092-8674(77)90323-3. [DOI] [PubMed] [Google Scholar]
51.Chao J.-Q., Yang S.-G., Chen Y.-Y., Tian W.-M. Evaluation of reference genes for quantitative real-time PCR analysis of the gene expression in laticifers on the basis of latex flow in rubber tree (Hevea brasiliensis Muell. Arg.) Frontiers in Plant Science. 2016;7:p. 1149. doi: 10.3389/fpls.2016.01149. [DOI] [PMC free article] [PubMed] [Google Scholar]
52.Li W.-G., Zhang L.-H., Zhang Y.-D., Wang G.-D., Song D.-Y., Zhang Y.-W. Selection and validation of appropriate reference genes for quantitative realtime PCR normalization in staminate and perfect flowers of andromonoecious Taihangia rupestris. Frontiers in Plant Science. 2017;8:p. 729. doi: 10.3389/fpls.2017.00729. [DOI] [PMC free article] [PubMed] [Google Scholar]
53.Song Y., Wang Y., Guo D.-D., Jing L. Selection of reference genes for quantitative real-time PCR normalization in the plant pathogen Puccinia helianthi Schw. BMC Plant Biology. 2019;19(1):p. 20. doi: 10.1186/s12870-019-1629-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
54.Gundlach H., Muller M. J., Kutchan T. M., Zenk M. H. Jasmonic acid is a signal transducer in elicitor-induced plant cell cultures. Proceedings of the National Academy of Sciences. 1992;89(6):2389–2393. doi: 10.1073/pnas.89.6.2389. [DOI] [PMC free article] [PubMed] [Google Scholar]
55.Thomma B. P. H. J., Eggermont K., Penninckx I. A. M. A., et al. Separate jasmonate-dependent and salicylate-dependent defense-response pathways in Arabidopsis are essential for resistance to distinct microbial pathogens. Proceedings of the National Academy of Sciences. 1998;95(25):15107–15111. doi: 10.1073/pnas.95.25.15107. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Click here for additional data file.^{(551.4KB, zip)}

Data Availability Statement

The data used to support the findings of this study are included within the article.

[B1] 1.Caldana C., Scheible W.-R., Mueller-Roeber B., Ruzicic S. A quantitative RT-PCR platform for high-throughput expression profiling of 2500 rice transcription factors. Plant Methods. 2007;3(1):p. 7. doi: 10.1186/1746-4811-3-7. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B2] 2.Remans T., Keunen E., Bex G. J., Smeets K., Vangronsveld J., Cuypers A. Reliable gene expression analysis by reverse transcription-quantitative PCR: reporting and minimizing the uncertainty in data accuracy. The Plant Cell. 2014;26(10):3829–3837. doi: 10.1105/tpc.114.130641. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B3] 3.Phillips M. A., D’Auria J. C., Luck K., Gershenzon J. Evaluation of candidate reference genes for real-time quantitative PCR of plant samples using purified cDNA as template. Plant Molecular Biology Reporter. 2009;27(3):407–416. doi: 10.1007/s11105-008-0072-1. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B4] 4.Delporte M., Legrand G., Hilbert J. L., Gagneul D. Selection and validation of reference genes for quantitative real-time PCR analysis of gene expression in Cichorium intybus. Frontiers in Plant Science. 2015;6:p. 651. doi: 10.3389/fpls.2015.00651. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B5] 5.Saraiva K. D. C., Fernandes de Melo D., Morais V. D., Vasconcelos I. M., Costa J. H. Selection of suitable soybean EF1α genes as internal controls for real-time PCR analyses of tissues during plant development and under stress conditions. Plant Cell Reports. 2014;33(9):1453–1465. doi: 10.1007/s00299-014-1628-1. [DOI] [PubMed] [Google Scholar]

[B6] 6.Bas A., Forsberg G., Hammarstrom S., Hammarstrom M.-L. Utility of the housekeeping genes 18S rRNA, beta-actin and glyceraldehyde-3-phosphate-dehydrogenase for normalization in real-time quantitative reverse transcriptase-polymerase chain reaction analysis of gene expression in human T lymphocytes. Scandinavian Journal of Immunology. 2004;59(6):566–573. doi: 10.1111/j.0300-9475.2004.01440.x. [DOI] [PubMed] [Google Scholar]

[B7] 7.Tricarico C., Pinzani P., Bianchi S., et al. Quantitative real-time reverse transcription polymerase chain reaction: normalization to rRNA or single housekeeping genes is inappropriate for human tissue biopsies. Analytical Biochemistry. 2002;309(2):293–300. doi: 10.1016/s0003-2697(02)00311-1. [DOI] [PubMed] [Google Scholar]

[B8] 8.Vandesompele J., De Preter K., Pattyn F., et al. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biology. 2002;3(7):1–11. doi: 10.1186/gb-2002-3-7-research0034. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B9] 9.Andersen C. L., Jensen J. L., Ørntoft T. F. Normalization of real-time quantitative reverse transcription-PCR data: a model-based variance estimation approach to identify genes suited for normalization, applied to bladder and colon cancer data sets. Cancer Research. 2004;64(15):5245–5250. doi: 10.1158/0008-5472.can-04-0496. [DOI] [PubMed] [Google Scholar]

[B10] 10.Pfaffl M. W., Tichopad A., Prgomet C., Neuvians T. P. Determination of stable housekeeping genes, differentially regulated target genes and sample integrity: BestKeeper—excel-based tool using pair-wise correlations. Biotechnology Letters. 2004;26(6):509–515. doi: 10.1023/b:bile.0000019559.84305.47. [DOI] [PubMed] [Google Scholar]

[B11] 11.Liang W.-X. , Zou X.-X., Carballar-Lejarazú R., et al. Selection and evaluation of reference genes for qRT-PCR analysis in Euscaphis konishii Hayata based on transcriptome data. Plant Methods. 2018;14:p. 42. doi: 10.1186/s13007-018-0311-x. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B12] 12.Chen X., Mao Y., Huang S.-W., et al. Selection of suitable reference genes for quantitative real-time PCR in Sapium sebiferum. Frontiers in Plant Science. 2017;8:p. 637. doi: 10.3389/fpls.2017.00637. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B13] 13.Huang T., Long J.-M., Liu S.-W., et al. Selection and validation of reference genes for mRNA expression by quantitative real-time PCR analysis in Neolamarckia cadamba. Scientific Reports. 2018;8(1):p. 9311. doi: 10.1038/s41598-018-27633-5. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B14] 14.Lan M. Dian Nan Ben Cao. Kunming, China: Yunnan People’s Publishing House; 1978. [Google Scholar]

[B15] 15.Fan J.-T., Su J., Peng Y.-M., et al. Rubiyunnanins C-H, cytotoxic cyclic hexapeptides from Rubia yunnanensis inhibiting nitric oxide production and NF-κB activation. Bioorganic & Medicinal Chemistry. 2010;18(23):8226–8234. doi: 10.1016/j.bmc.2010.10.019. [DOI] [PubMed] [Google Scholar]

[B16] 16.Fan J.-T., Chen Y.-S., Xu W.-Y., et al. Rubiyunnanins A and B, two novel cyclic hexapeptides from Rubia yunnanensis. Tetrahedron Letters. 2010;51(52):6810–6813. doi: 10.1016/j.tetlet.2010.07.066. [DOI] [Google Scholar]

[B17] 17.Fan J.-T., Kuang B., Zeng G.-Z., et al. Biologically active arborinane-type triterpenoids and anthraquinones from Rubia yunnanensis. Journal of Natural Products. 2011;74(10):2069–2080. doi: 10.1021/np2002918. [DOI] [PubMed] [Google Scholar]

[B18] 18.Tripathi Y. B., Sharma M., Manickam M. Rubiadin, a new antioxidant from Rubia cordifolia. Indian Journal of Biochemistry & Biophysics. 1997;34:302–306. [PubMed] [Google Scholar]

[B19] 19.Fang X.-Y., Chen W., Fan J.-T., et al. Plant cyclopeptide RA-V kills human breast cancer cells by inducing mitochondria-mediated apoptosis through blocking PDK1-AKT interaction. Toxicology and Applied Pharmacology. 2013;267(1):95–103. doi: 10.1016/j.taap.2012.12.010. [DOI] [PubMed] [Google Scholar]

[B20] 20.Wang Z., Zhao S.-M, Song L.-H., et al. Natural cyclopeptide RA-V inhibits the NF-κB signaling pathway by targeting TAK1. Cell Death & Disease. 2018;9(7):p. 715. doi: 10.1038/s41419-018-0743-2. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B21] 21.Leung H.-W., Zhao S.-M., Yue G.-G., et al. RA-XII inhibits tumour growth and metastasis in breast tumour-bearing mice via reducing cell adhesion and invasion and promoting matrix degradation. Scientific Reports. 2015;5(1):p. 16985. doi: 10.1038/srep16985. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B22] 22.Song L.-H, Wang Z., Wang Y.-R., et al. Natural cyclopeptide RA-XII, a new autophagy inhibitor, suppresses protective autophagy for enhancing apoptosis through AMPK/mTOR/P70S6K pathways in HepG2 Cells. Molecules. 2017;22(11):p. 1934. doi: 10.3390/molecules22111934. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B23] 23.Zeng G.-Z., Wang Z., Zhao L.-M., Fan J.-T., Tan N.-H. NF-κB and JNK mediated apoptosis and G0/G1 arrest of HeLa cells induced by rubiarbonol G, an arborinane-type triterpenoid from Rubia yunnanensis. Journal of Ethnopharmacology. 2018;220:220–227. doi: 10.1016/j.jep.2017.10.026. [DOI] [PubMed] [Google Scholar]

[B24] 24.Han Y.-S., Van der Heijden R., Verpoorte R. Biosynthesis of anthraquinones in cell cultures of the Rubiaceae. Plant Cell, Tissue and Organ Culture. 2001;67(3):201–220. doi: 10.1023/a:1012758922713. [DOI] [Google Scholar]

[B25] 25.Mantrova O. V., Dunaeva M. V., Kuzovkina I. N., Schneider B., Müller-Uri F. Effect of methyl jasmonate on anthraquinone biosynthesis in transformed madder roots. Russian Journal of Plant Physiology. 1999;46:248–251. [Google Scholar]

[B26] 26.Dheda K., Huggett J. F., Chang J. S., et al. The implications of using an inappropriate reference gene for real-time reverse transcription PCR data normalization. Analytical Biochemistry. 2005;344(1):141–143. doi: 10.1016/j.ab.2005.05.022. [DOI] [PubMed] [Google Scholar]

[B27] 27.Zhao Y.-C., Luo J., Xu S., et al. Selection of reference genes for gene expression normalization in Peucedanum praeruptorum Dunn under abiotic stresses, hormone treatments and different tissues. PLoS One. 2016;11(3) doi: 10.1371/journal.pone.0152356.e0152356 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B28] 28.Mortazavi A., Williams B. A., McCue K., Schaeffer L., Wold B. Mapping and quantifying mammalian transcriptomes by RNA-Seq. Nature Methods. 2008;5(7):621–628. doi: 10.1038/nmeth.1226. [DOI] [PubMed] [Google Scholar]

[B29] 29.Wang Y., Li J.-N., Wang J.-Z., Li Z.-K. Exogenous H2O2 improves the chilling tolerance of manilagrass and mascarenegrass by activating the antioxidative system. Plant Growth Regulation. 2010;61(2):195–204. doi: 10.1007/s10725-010-9470-0. [DOI] [Google Scholar]

[B30] 30.Brunner A. M., Yakovlev I. A., Strauss S. H. Validating internal controls for quantitative plant gene expression studies. BMC Plant Biology. 2004;4(1):p. 14. doi: 10.1186/1471-2229-4-14. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B31] 31.Nicot N., Hausman J.-F., Hoffmann L., Evers D. Housekeeping gene selection for real-time RT-PCR normalization in potato during biotic and abiotic stress. Journal of Experimental Botany. 2005;56(421):2907–2914. doi: 10.1093/jxb/eri285. [DOI] [PubMed] [Google Scholar]

[B32] 32.Huis R., Hawkins S., Neutelings G. Selection of reference genes for quantitative gene expression normalization in flax (Linum usitatissimum L.) BMC Plant Biology. 2010;10(1):p. 71. doi: 10.1186/1471-2229-10-71. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B33] 33.Paolacci A. R., Tanzarella O. A., Porceddu E., Ciaffi M. Identification and validation of reference genes for quantitative RT-PCR normalization in wheat. BMC Molecular Biology. 2009;10(1):p. 11. doi: 10.1186/1471-2199-10-11. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B34] 34.Manoli A., Sturaro A., Trevisan S., Quaggiotti S., Nonis A. Evaluation of candidate reference genes for qPCR in maize. Journal of Plant Physiology. 2012;169(8):807–815. doi: 10.1016/j.jplph.2012.01.019. [DOI] [PubMed] [Google Scholar]

[B35] 35.Kumar K., Muthamilarasan M., Prasad M. Reference genes for quantitative real-time PCR analysis in the model plant foxtail millet (Setaria italica L.) subjected to abiotic stress conditions. Plant Cell, Tissue and Organ Culture (PCTOC) 2013;115(1):13–22. doi: 10.1007/s11240-013-0335-x. [DOI] [Google Scholar]

[B36] 36.Sudhakar Reddy P., Srinivas Reddy D., Sivasakthi K., Bhatnagar-Mathur P., Vadez V., Sharma K. K. Evaluation of sorghum [Sorghum bicolor (L.)] reference genes in various tissues and under abiotic stress conditions for quantitative real-time PCR data normalization. Frontiers in Plant Science. 2016;7:p. 529. doi: 10.3389/fpls.2016.00529. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B37] 37.Reddy P. S., Reddy D. S., Sharma K. K., Bhatnagar-Mathur P., Vadez V. Cloning and validation of reference genes for normalization of gene expression studies in pearl millet [Pennisetum glaucum (L.) R. Br.] by quantitative real-time PCR. Plant Gene. 2015;1:35–42. doi: 10.1016/j.plgene.2015.02.001. [DOI] [Google Scholar]

[B38] 38.Wang C., Cui H.-M., Huang T.-H., Liu T.-K., Hou X.-L., Li Y. Identification and validation of reference genes for RT-qPCR analysis in non-heading Chinese cabbage flowers. Frontiers in Plant Science. 2016;7:p. 811. doi: 10.3389/fpls.2016.00811. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B39] 39.Li J.-T., Han X.-P., Wang C., et al. Validation of suitable reference genes for RT-qPCR data in Achyranthes bidentata Blume under different experimental conditions. Frontiers in Plant Science. 2017;8:p. 776. doi: 10.3389/fpls.2017.00776. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B40] 40.Zsóri K., Muszbek L., Csiki Z., Shemirani A. Validation of reference genes for the determination of platelet transcript level in healthy individuals and in patients with the history of myocardial infarction. International Journal of Molecular Sciences. 2013;14(2):3456–3466. doi: 10.3390/ijms14023456. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B41] 41.Zhuang H.-H., Fu Y.-P., He W., Wang L., Wei Y.-H. Selection of appropriate reference genes for quantitative real-time PCR in Oxytropis ochrocephala Bunge using transcriptome datasets under abiotic stress treatments. Frontiers in Plant Science. 2015;6:p. 475. doi: 10.3389/fpls.2015.00475. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B42] 42.Moreira V. S., Soares V. L. F., Silva R. J. S., Sousa A. O., Otoni W. C., Costa M. G. C. Selection and validation of reference genes for quantitative gene expression analyses in various tissues and seeds at different developmental stages in Bixa orellana L. Physiology and Molecular Biology of Plants. 2018;24(3):369–378. doi: 10.1007/s12298-018-0528-1. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B43] 43.Gomes A. É. I., Stuchi L. P., Siqueira N. M. G., et al. Selection and validation of reference genes for gene expression studies in Klebsiella pneumoniae using reverse transcription quantitative real-time PCR. Scientific Reports. 2018;8:p. 9001. doi: 10.1038/s41598-018-27420-2. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B44] 44.Ma R., Xu S., Zhao Y.-C., Xia B., Wang R. Selection and validation of appropriate reference genes for quantitative real-time PCR analysis of gene expression in Lycoris aurea. Frontiers in Plant Science. 2016;7:p. 536. doi: 10.3389/fpls.2016.00536. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B45] 45.Aggarwal A., Jamwal M., Viswanathan G. K., et al. Optimal reference gene selection for expression studies in human reticulocytes. The Journal of Molecular Diagnostics. 2018;20(3):326–333. doi: 10.1016/j.jmoldx.2018.01.009. [DOI] [PubMed] [Google Scholar]

[B46] 46.Freitag D., Koch A., Lawson McLean A., Kalff R., Walter J. Validation of reference genes for expression studies in human meningiomas under different experimental settings. Molecular Neurobiology. 2018;55(7):5787–5797. doi: 10.1007/s12035-017-0800-3. [DOI] [PubMed] [Google Scholar]

[B47] 47.Duan M.-M., Wang J.-L., Zhang X.-H., et al. Identification of optimal reference genes for expression analysis in Radish (Raphanus sativus L.) and its relatives based on expression stability. Frontiers in Plant Science. 2017;8:p. 1605. doi: 10.3389/fpls.2017.01605. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B48] 48.Sun H.-P., Li F., Ruan Q.-M., Zhong X.-H. Identification and validation of reference genes for quantitative real-time PCR studies in Hedera helix L. Plant Physiology and Biochemistry. 2016;108:286–294. doi: 10.1016/j.plaphy.2016.07.022. [DOI] [PubMed] [Google Scholar]

[B49] 49.Die J. V., Román B., Nadal S., González-Verdejo C. I. Evaluation of candidate reference genes for expression studies in Pisum sativum under different experimental conditions. Planta. 2010;232(1):145–153. doi: 10.1007/s00425-010-1158-1. [DOI] [PubMed] [Google Scholar]

[B50] 50.Beyer A. L., Christensen M. E., Walker B. W., LeStourgeon W. M. Identification and characterization of the packaging proteins of core 40S hnRNP particles. Cell. 1977;11(1):127–138. doi: 10.1016/0092-8674(77)90323-3. [DOI] [PubMed] [Google Scholar]

[B51] 51.Chao J.-Q., Yang S.-G., Chen Y.-Y., Tian W.-M. Evaluation of reference genes for quantitative real-time PCR analysis of the gene expression in laticifers on the basis of latex flow in rubber tree (Hevea brasiliensis Muell. Arg.) Frontiers in Plant Science. 2016;7:p. 1149. doi: 10.3389/fpls.2016.01149. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B52] 52.Li W.-G., Zhang L.-H., Zhang Y.-D., Wang G.-D., Song D.-Y., Zhang Y.-W. Selection and validation of appropriate reference genes for quantitative realtime PCR normalization in staminate and perfect flowers of andromonoecious Taihangia rupestris. Frontiers in Plant Science. 2017;8:p. 729. doi: 10.3389/fpls.2017.00729. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B53] 53.Song Y., Wang Y., Guo D.-D., Jing L. Selection of reference genes for quantitative real-time PCR normalization in the plant pathogen Puccinia helianthi Schw. BMC Plant Biology. 2019;19(1):p. 20. doi: 10.1186/s12870-019-1629-x. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B54] 54.Gundlach H., Muller M. J., Kutchan T. M., Zenk M. H. Jasmonic acid is a signal transducer in elicitor-induced plant cell cultures. Proceedings of the National Academy of Sciences. 1992;89(6):2389–2393. doi: 10.1073/pnas.89.6.2389. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B55] 55.Thomma B. P. H. J., Eggermont K., Penninckx I. A. M. A., et al. Separate jasmonate-dependent and salicylate-dependent defense-response pathways in Arabidopsis are essential for resistance to distinct microbial pathogens. Proceedings of the National Academy of Sciences. 1998;95(25):15107–15111. doi: 10.1073/pnas.95.25.15107. [DOI] [PMC free article] [PubMed] [Google Scholar]

PERMALINK

Selection and Validation of Appropriate Reference Genes for Quantitative RT-PCR Analysis in Rubia yunnanensis Diels Based on Transcriptome Data

Shanyong Yi

Qianwen Lin

Xuejia Zhang

Jing Wang

Yuanyuan Miao

Ninghua Tan

Abstract

1. Introduction

2. Materials and Methods

2.1. Plant Material

2.2. RNA Isolation, Quality Control, and cDNA Synthesis

2.3. Selection of Candidate Reference Genes and Primer Design

Table 1.

2.4. Data Analysis

2.5. Validation of Reference Genes and Expression Analysis of Putative Key Genes of Anthraquinone Biosynthesis Pathway

3. Results

3.1. Verification of Amplicons, Primer Specificity, and PCR Amplification Efficiency

Figure 1.

Figure 2.

3.2. Expression Profile of Candidate Reference Genes

Figure 3.

3.3. Expression Stability of Candidate Reference Genes

3.3.1. geNorm Analysis

Figure 4.

Figure 5.

3.3.2. NormFinder Analysis

Table 2.

3.3.3. BestKeeper Analysis

Table 3.

3.3.4. RefFinder Analysis

Table 4.

3.4. Validation of Reference Genes and Expression Analysis of Putative Key Genes of Anthraquinone Biosynthesis Pathway

Figure 6.

Table 5.

Figure 7.

4. Discussion

5. Conclusions

Acknowledgments

Contributor Information

Data Availability

Disclosure

Conflicts of Interest

Authors' Contributions

Supplementary Materials

References

Associated Data

Supplementary Materials

Data Availability Statement

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases