Mechanisms underlying the inhibitory effects of probucol on elastase‐induced abdominal aortic aneurysm in mice

Abstract

Background and Purpose

Abdominal aortic aneurysm (AAA) is a degenerative disease with irreversible and progressive dilation of the artery. But there are few options for efficacious treatment except for traditional surgery. Probucol has been widely applied to treat hyperlipidaemia and atherosclerosis in clinic, but whether it can protect against AAA remains unknown. In this study, the protective effects of probucol against AAA and its related mechanisms were explored.

Experimental Approach

The model of AAA was induced in mice by periaortic application of elastase (40 min) to the abdominal aorta. Probucol at different doses was administered by daily gavage, starting on the same day as AAA was induced, for 14 days. In vitro, cultures of rat vascular smooth muscle cells (VSMCs) were stimulated with TNF‐α. Haem oxygenase (HO)‐1 siRNA and HO‐1 plasmid were used to regulate the expression or activity of HO‐1 in the VSMCs and to clarify the effects of HO‐1.

Key Results

Probucol dose‐dependently prevented the development of AAA, reflected by decreased incidence of AAA, diameter of aortic dilation, elastin degradation, and infiltration of inflammatory cells. Probucol also protected VSMCs from oxidative injury and enhanced elastin biosynthesis. This anti‐inflammatory effects of probucol on VSMCs were significantly decreased when HO‐1 was inhibited by siRNA.

Conclusion and Implications

Probucol protected against AAA through inhibiting the degradation of elastin induced by inflammation and oxidation and by facilitating the biosynthesis of elastin. HO‐1 played a crucial role in the anti‐inflammatory effects of probucol in VSMCs.

What is already known

• Probucol increases the expression and activity of haem oxygenase (HO)‐1

• Increased levels of HO‐1 activity protects against abdominal aortic aneurysm.

What this study adds

• Probucol inhibited development of abdominal aortic aneurysms in a mouse model ,

• This action of probucol was blocked by down‐regulation of HO‐1.

What is the clinical significance

• Probucol has been used clinically as a lipid‐lowering agent

• Probucol may be re‐purposed to prevent or treat small abdominal aortic aneurysms in patients.

Abbreviations

AAA

abdominal aortic aneurysm

ECM

extracellular matrix

FBN

fibrillin

HO‐1

haem oxygenase‐1

LOX

lysyloxidase

VSMC

vascular smooth muscle cell

1. INTRODUCTION

Abdominal aortic aneurysm (AAA) is the progressive and irreversible dilatation of a certain region of the abdominal artery (Davis, Rateri, & Daugherty, 2015; Prisant & Mondy, 2004). The prevalence of AAA in men over 65 years old is up to 8%. The most severe complication of AAA is aortic rupture, and rupture of AAA outside hospital causes a death rate of 88%, making it a very dangerous condition (Adam, Mohan, Stuart, Bain, & Bradbury, 1999). Clinically, large AAA with aortic diameters over 5.5 cm is treated either by open surgery or by endovascular aneurysm repair. However, there are few effective treatments for small AAA with an aortic diameter between 3.0 and 5.5 cm (Assar, 2009) and there is still an urgent need for finding effective anti‐AAA drugs in these cases (Brown, Thompson, Greenhalgh, Powell, & UK Small Aneurysm Trial Participants, 2008).

The formation of AAA mainly involves the infiltration of inflammatory cells, the degradation of extracellular matrix (ECM), apoptosis of vascular smooth muscle cells (VSMCs), and oxidation. Inflammation is the initiator of the formation of AAA and participates throughout the progression of the AAA (Halpern et al., 1994). The infiltration of inflammatory cells into the aortic wall occurs early in the formation of AAA, followed by secretion of proinflammatory cytokines (Wassef et al., 2001). These cytokines induce apoptosis and phenotypic switch of VSMCs (Ailawadi et al., 2009). Activated macrophages and VSMCs will produce https://www.guidetopharmacology.org/GRAC/FamilyIntroductionForward?familyId=738 (Goodall, Porter, Bell, & Thompson, 2002) to degrade extra‐cellular matrix (ECM) proteins, including elastin and interstitial collagens, in the media of the aorta and that finally leads to rupture of the aortic wall (Satta et al., 1998).

https://www.guidetopharmacology.org/GRAC/LigandDisplayForward?ligandId=7277 has a range of biological activities, including lipid‐lowering (Yamashita et al., 2008), anti‐inflammation (Yamamoto, Hara, Takaichi, Wakasugi, & Tomikawa, 1988), antioxidation (Yamamoto, 2008), anti‐MMPs (Li et al., 2014), endothelial protection (Lau et al., 2003), and inhibition of VSMC proliferation (Sekiya, Funada, Watanabe, Miyagawa, & Akutsu, 1998), which could be used to ameliorate AAA. Previous studies also pointed out that probucol probably can be useful to treat vascular diseases, including AAA, due to its antioxidative ability (Falotico & Zhao, 2008). Nevertheless, there is still a lack of direct evidence of the inhibitory effects of probucol on AAA.

https://www.guidetopharmacology.org/GRAC/ObjectDisplayForward?objectId=1441 is a stress response protein located downstream of the transcription factor Nrf‐2 and catalyses the oxidation of haem to biliverdin (Ryter, Alam, & Choi, 2006). Its reactive products have potent anti‐inflammatory and antioxidative functions. Ho et al. (2016) found that HO‐1 deficiency exacerbates https://www.guidetopharmacology.org/GRAC/LigandDisplayForward?ligandId=2504‐induced aortic aneurysm in mice, which indicated that HO‐1 may be potential target in treatment of AAA. Earlier work suggested that probucol could protect against smooth muscle cell proliferation by up‐regulating HO‐1 (Deng, Wu, Witting, & Stocker, 2004, but whether HO‐1 can mediate the anti‐AAA effect of probucol remains to be established.

In this study, we aimed to find out whether probucol could inhibit AAA and its related mechanisms. We first showed that probucol prevented the formation of AAA in an elastase‐induced model in mice and further established an in vitro model by stimulating primary rat VSMCs with https://www.guidetopharmacology.org/GRAC/LigandDisplayForward?ligandId=5074 to investigate the related mechanisms. We also evaluated the role of HO‐1 in the anti‐AAA effects of probucol.

2. METHODS

2.1. Animals

All animal care and experimental procedures complied with the Animals (Scientific Procedures) Act 1986, and all procedures involving animals complied with the Regulations for the Administration of Affairs Concerning Experimental Animals published by the State Science and Technology Commission of China and were approved by the Biomedical Ethics Committee of Peking University and the Animal Experiment Advisory Committee of the Peking University Health Science Center. Animal studies are reported in compliance with the ARRIVE guidelines (Kilkenny, Browne, Cuthill, Emerson, & Altman, 2010; McGrath & Lilley, 2015) and with the recommendations made by the British Journal of Pharmacology.

Healthy 8‐ to 10‐week‐old male C57BL/6 mice (RRID:MGI:5656552) weighing about 20 to 25 g and male Sprague Dawley rats (RRID:RGD_10395233) weighing about 100 g were purchased from Department of Laboratory Animal Science, Peking University Health Science Center (Beijing, China). The animals were housed in cages at 25 ± 2°C with a relative humidity of 50% with free access to food and water. All mice were exposed to a 12‐hr light/dark cycle. Mice were housed in open top conventional cages with poplar bedding material along with appropriate environmental enrichment, under specific pathogen free conditions. A maximum of five mice were housed in a single cage.

2.2. Induction of AAA in mice

AAA was induced in C57BL/6 mice by periaortic application of pancreatic elastase (2‐U ) as described by Bi et al. (2013). Briefly, mice were anaesthetized with isoflurane and fixed on a 37°C thermostat plate, and their abdominal cavity was exposed by blunt dissection in the midline of the lower abdomen. The abdominal aorta between the renal artery and iliac artery, length of about 1 cm, was bluntly separated from other tissues. Then a piece of polyethylene sponge cloth, which had previously been immersed in 30‐μl elastase solution (2‐U of type I elastase dissolved in saline), was used to wrap around the separated abdominal aorta. After 40 min, the sponge cloth was removed, and the incision was sutured. The sham group was treated with the sponge cloth immersed in saline, and other procedures were the same as the model group.

2.3. Probucol administration

Mice were randomly assigned to five groups, and the group sizes in our study were equal by design, that is, sham group, model group, probucol 15 mg·kg⁻¹ group (PB15), probucol 60 mg·kg⁻¹ group (PB60), and probucol 130 mg·kg⁻¹ group (PB130); n = 6 in each group. AAA was induced as described above. Probucol at the different doses was administered to the mice by gavage once daily, beginning on the day of the AAA operation and continued for 14 days. Mice in the sham group and the model group were given with normal saline via gavage. Fourteen days later, the mice were killed with an overdose of sodium pentobarbital, and the aortas were removed for analysis.

2.4. Macroscopic analysis

The aortas of the mice were isolated and photographed by a digital camera (D7000, Nikon) to measure the external maximal diameter of the abdominal aortas (ImageJ software, NIH, ImageJ, RRID:SCR_003070) by two investigators, without knowledge of the treatments. The relative dilation ratio of the abdominal aorta was calculated according to the following formula: relative dilation ratio = maximal aneurysmal diameter of AAA/sham. AAA was defined when the relative dilation ratio exceeded 1.5.

2.5. Histological analysis

The excised abdominal aortas were fixed with 4% paraformaldehyde for 6 hr and embedded in Tissue‐Tek O.C.T. compound in liquid nitrogen, then cut into 7‐μm serial sections for histological analysis. The frozen sections of abdominal aortas were stained with haematoxylin–eosin and aldehyde fuchsin, to assess elastin degradation. Elastin degradation in the aortas was double‐blindly scored, according to the following standards: 1, less than 25% degradation; 2, 25–50% degradation; 3, 50–75% degradation; and 4, greater than 75% degradation.

2.6. Immunohistochemistry

Immunohistochemical staining for MMP‐2, MMP‐9, CD‐68, and HO‐1 was also performed on frozen tissue sections. Briefly, the aortic sections were pretreated with 3% H₂O₂ to block endogenous peroxidase activity and blocked with 5% goat serum for 1 hr at room temperature and then incubated overnight with polyclonal primary antibodies (1:100 diluted in PBS) at 4°C. After washing with PBS, sections were incubated with 500‐fold diluted goat anti‐rabbit or mice second antibodies conjugated with peroxidase at room temperature for 60 min, and the sections were then counterstained with haematoxylin. Finally, the sections were incubated with 3, 3‐diaminobenzidine solution to visualize peroxidase activity by light microscopy. Quantification was analysed using Image‐Pro Plus software (Media Cybernetics, USA, Image‐Pro Plus, RRID:SCR_007369) and expressed as the ratio of integrated OD to the area of interest (integrated OD/area). The Immuno‐related procedures used comply with the recommendations made by the British Journal of Pharmacology.

2.7. Isolation and culture of VSMCs

Primary VSMCs were isolated and obtained by explant culture and enzymatic digestion from the aortas of Sprague Dawley rats, as described by Clowes et al., (1994. Briefly, after the rats were killed with sodium pentobarbital, their whole aortas were collected, and the adventitia and all the connective tissues surrounding around the aortas were completely removed. The aortas were longitudinally opened and cut into pieces (about 22 mm long), then placed into a tube, containing 1.5‐ml DMEM with 1.5% type II collagenase, and incubated for 2 hr at 37°C in 5% CO₂ atmosphere. After incubation and digestion by collagenase, the contents of the tube were centrifuged at 418 x g (Eppendorf 5810R, USA) for 5 min. The supernatant was then discarded, and the cell pellets were resuspended with DMEM containing 20% FBS and 1% antibiotic solution (penicillin and streptomycin), and the cell suspension was transferred into a 3.5‐cm culture dish and incubated at 37°C in 5% CO₂ atmosphere for a week. After the incubation, the cells dissociated from the tissue were washed with PBS and trypsinized at 37°C for 5 min. The collected cells were cultured continuously and used up to four to six passages.

2.8. In vitro aneurysmal micro‐environment cell model and probucol treatment

An in vitro aneurysmal micro‐environment was established in VSMCs by TNF‐α stimulation, according to a protocol published previously (Orriols et al., 2016), which displayed features typical of AAA, including inflammation, oxidative stress, and up‐regulation of MMP‐2 and MMP‐9. Briefly, VSMCs were stimulated with 100 ng·ml⁻¹ of TNF‐α for 48 hr to mimic aneurysmal micro‐environment. Probucol (100 μg·ml⁻¹) and TNF‐α (100 ng·ml⁻¹) were added together to VSMC to investigate the effects of probucol on the aneurysmal micro‐environment; n = 6 in each group. After incubating for 48 hr, the conditioned media, total RNA, and protein of the cells were collected for subsequent analysis.

2.9. siRNA and plasmid transfection

For siRNA and plasmid transfections, cells were plated in a six‐well plate at 1 × 10⁵ cells per well and transfected with either a single siRNA or plasmid to mouse HO‐1 or and a non‐targeting control. Then VSMCs were stimulated by TNF‐α or TNF‐α and probucol after 24 hr of transfection. Total RNA and proteins of the cells were collected for subsequent analysis.

2.10. Quantitative PCR

The primer sequences for detection of mRNA expressions of inflammation and oxidative stress by PCR are shown in Table 1. Total RNA was extracted from the aortic tissue or VSMCs using Trizol reagent according to the manufacturer's protocol. Then mRNA was reverse‐transcribed into cDNA with 5× All‐In‐One RT MasterMix. Quantitative PCR analysis was performed in a MiniOpticon Real‐Time PCR Detection System (BioRad Laboratories, USA) using EvaGreen qPCR MasterMix, as recommended by the manufacturer. The following parameters were used for detection of these sequences: 95°C for 2 min followed by 40 cycles of 3 s at 95°C for denaturation and 30 s at 60°C for annealing and extension. The results were analysed using Opticon Monitor Version 3.1 software (BioRad Laboratories). The expression levels of genes were standardized based on the expression level of the GAPDH gene.

Table 1.

Primer sequences used in amplification PCR and semiquantitative RT‐PCR

Gene	Sequence
GAPDH	Forward	TGATGACATCAAGAAGGTGGTGAAG
	Reverse	TCCTTGGAGGCCATGTAGGCCAT
IL‐1β	Forward	GACTTCACCATGGAACCCGT
	Reverse	GGAGACTGCCCATTCTCGAC
IL‐6	Forward	CCTTCTTGGGACTGATGT
	Reverse	CTCTGGCTTTGTCTTTCT
CCL2	Forward	AATGAGTCGGCTGGAGAA
	Reverse	GTGCTTGAGGTGGTTGTG
FBN1	Forward	TGCTCTGAAAGGACCCAATGT
	Reverse	CGGGACAACAGTATGCGTTATAAC
LOX	Forward	TGCTCTGAAAGGACCCAATGT
	Reverse	GGGCTGGAACGCCATAGTAA

2.11. Western blot for protein expression

Total proteins of the aorta tissue in the location of AAA and in VSMCs were extracted using RIPA buffer (Solarbio, Beijing, China), and protein concentration was measured by a BCA protein assay (Thermo, USA). Proteins with equal amount (40 μl per lane) were subjected to 10% SDS‐PAGE under reducing conditions, and the proteins were transferred to 0.45‐μm nitrocellulose membranes (BioRad, USA). The membrane was immunoblotted with rabbit anti‐MMP‐2, anti‐MMP‐9, anti‐HO‐1, or anti‐elastin primary antibodies (1:1,000 diluted in 5% BSA) and mouse anti‐GAPDH primary antibody (1:5,000 diluted in 5% BSA), and the secondary goat anti‐rabbit or anti‐mouse IgG (1:5,000 diluted in 5% BSA) was conjugated with HRP. The specific MMP‐2, MMP‐9, HO‐1, and elastin bands were detected with the electrochemiluminescent system (BioRad) and quantified with a semiquantification software ImageJ. The experiment was carried out by one person, and the bands were analysed blindly by other colleagues.

2.12. Gelatin zymography for MMP‐2 and MMP‐9 activity

To evaluate MMP‐2 and MMP‐9 activity, gelatin zymography was performed using the conditioned media of the VSMC after treating with TNF‐α and probucol. Electrophoresis of 10‐μl conditioned media with equal amount of proteins was conducted (10% SDS‐PAGE with 0.1% gelatin as substrate). Gels were washed with 2.5% Triton X‐100 and incubated at 37°C for 48 hr with developing buffer and then stained with Coomassie brilliant blue. Gels were scanned using Image Analyser LAS‐4000 (Fujifilm, Tokyo, Japan), and gelatinolytic activity was quantified utilizing image‐analysing software (ImageJ, NIH).

2.13. Data and statistical analysis

The data and statistical analysis comply with the recommendations on experimental design and analysis in pharmacology (Curtis et al., 2015). Data are presented as mean ± SEM and were analysed using the GraphPad Prism for Windows (Version 4, San Diego, CA, USA, GraphPad Prism, RRID:SCR_002798), Statistical significance of differences among the groups was analysed by one‐way ANOVA for multiple comparisons with Tukey's test. Tukey's tests were conducted only when F achieved P < .05 and there was no significant variance inhomogeneity. Elastin degradation scores between multiple groups were analysed by one‐tailed Wilcoxon test. P < .05 was considered to show statistical significance.

2.14Materials

Type II collagenase was purchased from Invitrogen (USA). Probucol was purchased from Otsuka Pharmaceutical Co., Ltd. (Tokyo, Japan). TNF‐α was purchased from Peprotech (Rocky Hill, USA). FBS, DMEM (4.5 g·L⁻¹ of d‐glucose), trypsin, and EDTA were purchased from GIBCO (Grand Island, USA). Tissue‐Tek O.C.T. compound was purchased from Sakura Finetek Japan Co., Ltd. (Tokyo, Japan). Elastase, chloral hydrate, penicillin, streptomycin, and MTT were purchased from Sigma‐Aldrich (Beijing, China). Anti‐CD68 rabbit polyclonal antibody (catalogue #BA3638, lot number BA3638, RRID:AB_10790084, the epitope against polypeptide) was purchased from Boster (Wuhan, China). Anti‐https://www.guidetopharmacology.org/GRAC/ObjectDisplayForward?objectId=1629 rabbit polyclonal antibody (IgG, lot number ab97779, RRID:AB_10790084), anti‐https://www.guidetopharmacology.org/GRAC/ObjectDisplayForward?objectId=1633 rabbit polyclonal antibody (IgG, lot number, ab38898, RRID:AB_613658), and anti‐elastin rabbit polyclonal antibody (IgG, lot number ab217356, RRID:AB_10803312) were purchased from Abcam (Massachusetts, USA). Anti‐HO‐1 rabbit polyclonal antibody (lot number ADI‐OSA‐150‐D, RRID:AB_2331710) was purchased from Enzo Biochem Inc. (New York, USA). Anti‐GAPDH mouse monoclonal antibody (lot number KC‐5G4, RRID:AB_2617426) was purchased from DiNing technology company (Beijing, China). HRP‐goat‐anti‐mouse IgG (lot number ZB‐2305) and HRP‐goat‐anti‐rabbit IgG (lot number ZB‐2301) secondary antibodies were purchased from ZSGB‐BIO technology company (Beijing, China). Trizol reagent was purchased from Invitrogen (CA, USA). TransScript First‐Strand cDNA Synthesis SuperMix was purchased from TransGen Biotech Co., Ltd. (Beijing, China). EvaGreen qPCR MasterMix was purchased from Applied Biological Materials (abm) Inc. (Vancouver, Canada). All other reagents were purchased from Sigma‐Aldrich (USA).

2.15. Nomenclature of targets and ligands

Key protein targets and ligands in this article are hyperlinked to corresponding entries in http://www.guidetopharmacology.org, the common portal for data from the IUPHAR/BPS Guide to PHARMACOLOGY (Harding et al., 2018), and are permanently archived in the Concise Guide to PHARMACOLOGY 2017/18 (Alexander et al., 2017).

3. RESULTS

3.1. Probucol reduced the occurrence of AAA and protected the structural integrity of the aortic wall

By 14 days after the induction of AAA, the abdominal aorta of all the mice in the model group had developed severe aneurysm (Figure 1a), providing a 100% incidence of AAA (Figure 1c) and severe dilatation of the aorta (twofold compared to the sham group, Figure 1b) in the model group. However, probucol treatment reduced the incidence and dilatation of AAA in a dose‐dependent manner. The aortic dilatation was accompanied by major changes in vascular integrity and elastin content. Haematoxylin–eosin staining and aldehyde fuchsin staining (Figure 2a,b) showed that aortas in the model group exhibited characteristic dilatation of the aortic lumen, fragmentation and degeneration of the elastic laminae in the medial layer, as well as thickening and remodelling in the aortic adventitia. However, probucol treatment preserved the structural integrity of aortic wall and reduced elastin degradation (Figure 2c).

Figure 1.

Inhibitory effects of probucol (PB) on AAA in mice. (a) Morphology of aorta, (b) relative maximal external abdominal aortic diameter, and (c) incidence of elastase‐induced AAA in mice. The formation of AAA was defined as ≥50% dilation of normal abdominal aorta diameter. Data shown are individual values with means ± SEM; n = 6 in each group. *P<.05, significantly different as shown

Figure 2.

Protective effects of probucol (PB) on the structural integrity of aortic wall of the AAA mice. (a) Representative images of haematoxylin–eosin (H&E) staining, scale bar: 100 or 200 μm, (b) representative images of aldehyde fuchsin staining, scale bar: 100 or 200 μm, and (c) semiquantitation of elastin degradation scores. Data shown are individual values with means ± SEM; n = 6 in each group. *P<.05, significantly different as shown

3.2. Probucol attenuated inflammation in the aortic wall

As shown in Figure 3a, 14 days after induction of AAA there was significant infiltration of CD‐68 positive macrophages in the aortic wall. Moreover, expression of https://www.guidetopharmacology.org/GRAC/LigandDisplayForward?ligandId=4998, https://www.guidetopharmacology.org/GRAC/LigandDisplayForward?ligandId=771, and https://www.guidetopharmacology.org/GRAC/LigandDisplayForward?ligandId=4974 was also significantly higher in the model group compared to that in the sham group (Figure 3b–d). All these changes were reversed, to levels in sham animals, by treating the AAA mice with 130 mg·kg⁻¹ of probucol.

Figure 3.

Inhibitory effects of probucol (PB) on inflammation in the aortic wall of AAA mice. (a) Representative images of immunohistochemical staining of CD‐68 of aortic sections after a 14‐day induction of AAA and its semiquantification, scale bar: 100 or 200 μm, and relative mRNA expression of IL‐6 (b), CCL2 (c), and IL‐1β (d), respectively. Data shown are individual values with means ± SEM; n = 6 in each group. *P<.05, significantly different as shown

3.3. Probucol decreased expression of MMPs and preserved elastin protein in the aorta

The results of immunohistochemical staining (Figure 4a,b) , together with those of the western blots (Figure 4c), showed that induction of AAA by elastase increased, 14 days later, the expression of both MMP‐2 and MMP‐9 in the aortic wall. As a result, elastin content, which is the substrate of MMP‐2 and MMP‐9, was decreased significantly in the model group. Results from the PB 130 mice showed clear reversal of these changes, as expression of MMP‐2 and MMP‐9 decreased significantly, and elastin content was significantly increased, compared to that in the model group.

Figure 4.

Probucol (PB) inhibited elastase‐induced vascular remodelling and extracellular matrix degradation. (a) Representative images of immunohistochemical staining of MMP‐9 and (b) MMP‐2 in aorta, scale bar: 100 or 200 μm. (c) Western blot of MMP‐2, MMP‐9, and elastin and its quantification in aortas. Data shown are individual values with means ± SEM; n = 6 in each group. *P<.05, significantly different as shown

3.4. Probucol increased expression of HO‐1 in the aortic wall

As shown in Figure 5, HO‐1 was expressed at a low level in the aortic wall in the sham group, in accordance with earlier work (Ryter et al., 2006) and this was lowered further in the AAA mice (model group). However, expression of HO‐1 in the medial layer of the PB130 group increased significantly compared to the model group.

Figure 5.

Probucol (PB) increased HO‐1 expression in the aortic wall. (a) Representative images of immunohistochemical staining of HO‐1, scale bar: 100 or 200 μm, and (b) protein expression of HO‐1 in aorta and its quantification. Data shown are individual values with means ± SEM; n = 6 in each group. *P<.05, significantly different as shown

3.5. Probucol decreased expression and activity of MMPs and facilitated resynthesis of elastin in vitro

After stimulating the VSMCs with TNF‐α for 48 hr, results of western blot and gelatin zymography demonstrate significantly elevated protein expression (Figure 6a,b) and enzymic activity of MMP‐2 and MMP‐9 in VSMCs (Figure 6c,d). Probucol treatment of the TNF‐stimulated VSMCs significantly decreased protein expression of MMP‐2 and MMP‐9 (Figure 6a,b) as well as their enzymic activity (Figure 6c,d), compared to the VSMCs with TNF‐α stimulation alone. Also, probucol treatment significantly increased expression of elastin, compared to that in TNF‐α group (Figure 6a,b). These results were compatible with the in vivo results in abdominal aortas of AAA mice. Moreover, we found that TNF‐α stimulation led to decreased mRNA expression of proteins related to synthesis of elastic fibres, including fibrillin (FBN) 1, lysyloxidase (LOX), and tropoelastin. These effects were reversed after probucol incubation, as shown by the significantly increased mRNA expression of these three genes (Figure 6e).

Figure 6.

Probucol (PB) treatment inhibited the activity and expression of MMPs and prevented elastin from degradation in VSMCs. (a) Protein expression of MMP‐2, MMP‐9, and elastin, (b) quantifications of (a), (c) enzymic activity of MMP‐2 and MMP‐9 in the TNF‐α‐stimulated VSMCs, (d) quantifications of (c), and (e) mRNA expression of genes related to biosynthesis of elastic fibres. Data shown are individual values with means ± SEM; n = 6 in each group. *P<.05, significantly different as shown

3.6. Probucol decreased oxidative injury and inflammation of VSMCs

TNF‐α stimulation of the VSMCs resulted in a decreased expression of HO‐1, which was significantly increased after probucol treatment (Figure 7a,b). We next incubated VSMCs with https://www.guidetopharmacology.org/GRAC/LigandDisplayForward?ligandId=2448 ₂O₂ ( 0.75 or 1 mmol·L⁻¹) and found that while 0.75 mmol·L⁻¹ of H₂O₂ did not affect cell viability, 1 mmol·L⁻¹ of H₂O₂ reduced cell viability (Figure 7c). Incubation with probucol, however, significantly increased cell viability of VSMCs stimulated with H₂O₂, even at the H₂O₂ concentration of 1 mmol·L⁻¹ (Figure 7c). We also detected the expression of inflammatory cytokines in TNF‐α‐stimulated VSMCs. The mRNA expression of genes related to inflammation, including IL‐6, CCL2, and IL‐1β, was markedly increased after TNF‐α stimulation but was significantly decreased after treatment with probucol (Figure 7d).

Figure 7.

Effect of probucol (PB) on expression of HO‐1, cell viability of VSMCs induced by oxidative injury, and inflammation of VSMCs. (a) mRNA and (b) protein expression of HO‐1 after TNF‐α stimulation. (c) Cell viability after H₂O₂ incubation. (d) mRNA expression of genes related to inflammation after TNF‐α stimulation. Data shown are individual values with means ± SEM; n = 6 in each group. *P<.05, significantly different as shown

3.7. HO‐1 influenced the anti‐inflammatory effect of probucol on VSMCs

As shown in Figure 8a,b, siRNA transfection down‐regulated the gene and protein expressions of HO‐1. Moreover, the effect of probucol on the gene expression of the inflammatory cytokine IL‐6 was abolished, following transfection with HO‐1 siRNA (Figure 8c). HO‐1 plasmid transfection up‐regulated the expression of HO‐1 (Figure 8d,e) and enhanced the inhibitory effect of probucol on anti‐inflammatory effects of probucol in VSMCs (Figure 8f).

Figure 8.

Modification of the expression of HO‐1 influenced the effect of probucol (PB) on VSMCs. (a) mRNA and (b) protein expression of HO‐1 and (c) mRNA expression of IL‐6 after HO‐1 siRNA transfection. In (d), mRNA and (e) protein expression of HO‐1 and (f) mRNA expression of IL‐6 after HO‐1 plasmid transfection. Data shown are individual values with means ± SEM; n = 6 in each group. *P<.05, significantly different as shown; ns , not significant

4. DISCUSSION

AAA is a degenerative disease of the aortic wall which severely affects health. There are no safe and effective medications for AAA therapy except for traditional surgery. Probucol is an antioxidant drug and has been used clinically to treat hyperlipidaemia and atherosclerosis, but whether it can protect against AAA remains unknown. In our experiments, we found that probucol protected against a model of AAA induced by elastase in mice, in a dose‐dependent manner. This protection was demonstrated by reduced incidence rate of AAA, decreased dilatation of aortic diameter and area. Moreover, structural integrity of the aortic wall was well preserved after probucol treatment, as shown by the reduced degree of derangement and fragmentation of the elastic laminae in the medial layer, as well as decreased thickening of the aortic adventitia.

The pathogenesis of AAA is very complex. Current description of the histopathology of AAA mainly includes chronic inflammation induced by macrophage infiltration (Saraff, Babamusta, Cassis, & Daugherty, 2003), oxidative stress (McCormick, Gavrila, & Weintraub, 2007), apoptosis of VSMCs (Yamanouchi et al., 2010), and degradation of ECM (Hellenthal, Buurman, Wodzig, & Schurink, 2009). Inflammatory infiltration is a major finding throughout AAA development. Our study indicated that probucol administration decreased macrophage infiltration in the aortic adventitia, as well as gene expression of inflammatory cytokines. In the process of AAA, infiltrated macrophages will secrete proinflammatory cytokines, such as IL‐6 and CCL2, and will lead to increased level of ROS. IL‐6 and CCL2. These effects will further aggravate the cytotoxicity of the macrophages, which injure VSMCs by increasing expression of MMPs in VSMCs (Wang et al., 2014). We also found that probucol down‐regulated mRNA expression of IL‐1β, IL‐6, and CCL2 in VSMCs stimulated by TNF‐α. Therefore, both the in vivo and in vitro results showed inhibition of inflammation by probucol in AAA.

MMP‐2 and MMP‐9, which are secreted by macrophages and VSMCs, are the two major proteolytic enzymes that degrade elastin (Rizas, Ippagunta, & Tilson, 2009). Under pathological conditions, proinflammatory cytokines and oxidative injury could induce apoptosis and a phenotype switch of VSMCs and which then secrete proinflammatory cytokines and MMPs (Ailawadi et al., 2009). When AAA has progressed to the last stage, apoptosis of VSMCs results in the decrease of elastin due to the reduced biosynthesis of elastin (Ailawadi et al., 2009; Doyle et al., 2015). Probucol administration could reduce the expression and activation of MMPs. Our in vitro studies confirmed that probucol significantly suppressed the elevation of expression and activity of MMPs, thus preserving the integrity of elastin.

Facilitating the resynthesis of elastic lamina and preventing its degradation are of equal importance to rehabilitation of the aorta in AAA. In the aortic wall, elastic fibres are mainly synthesized by VSMCs and are composed of an amorphous core of elastin with surrounding microfibrillar glycoproteins (Lannoy, Slove, & Jacob, 2014). The formation of elastic fibres includes a series of complex processes (Aya et al., 2015). First, VSMCs synthesize tropoelastin, which is a soluble precursor of elastin before its coalescence. Next, stabilized and transported by fibulins, such as fibulin‐4 and fibulin‐5, tropoelastin is exported out of VSMCs, aggregates to form globular structures, and is deposited on adjacent FBN1 (Choudhury et al., 2009). The tropoelastin molecules then coalesce in the extracellular space and link with each other during the cross‐linking process, which is catalysed by LOX (Noda et al., 2013). Finally, the insoluble mature elastin is formed. In our study, when VSMCs were stimulated by TNF‐α, mRNA expression of tropoelastin, FBN1, and LOX all decreased, indicating disturbance of elastin resynthesis. However, probucol treatment significantly reversed such effects of TNF‐α stimulation, suggesting the promotion of elastin resynthesis by probucol.

HO‐1 is a ubiquitously expressed protein that exerts antioxidative effects (Ryter et al., 2006). Although the content of HO‐1 is quite low under normal physiological status, its expression can be induced to a high level when the cells are injured by inflammation or oxidative stress, in order to protect the cells against such pathological stimulations (Ryter et al., 2006). The inhibitory effects of HO‐1 on AAA have been studied by several groups. Ho et al. (2016) found that complete loss of HO‐1 in mice increased the incidence and rupture rate of AAA, as well as area and severity of the aneurysm, together with severe elastin degradation and medial degeneration. In addition, another study suggested that modulation of HO‐1 expression by its gene promoter repeat polymorphism might be associated with development of AAA in humans (Schillinger et al., 2002).

Our results show that 14 days after induction of AAA, HO‐1 expression was decreased in aorta. Following treatment with probucol, HO‐1 expression was increased significantly. The in vitro results showed that mRNA expression of HO‐1 in VSMCs was reduced due to acute oxidative damage after TNF‐α stimulation. However, probucol treatment increased the expression of HO‐1. We also found that the effect of probucol on gene expression of the inflammatory cytokine IL‐6, was abolished when HO‐1 was inhibited, whereas the protective effect of probucol on VSMCs inflammation was enhanced with HO‐1 up‐regulation. In addition, when VSMCs were incubated with H₂O₂ to mimic oxidative stress, probucol treatment significantly increased the cell viability of VSMCs reduced by H₂O₂. These results indicate that probucol protected the aortas from inflammation and oxidative injury and therefore preserved the basic structure of the aorta.

Nevertheless, due to the fact that the rate of synthesis of elastic fibres is very low and that regeneration of elastic fibres after injury is restrained, we believe that probucol inhibited AAA mainly through reducing the degradation of elastin, while its promotion of elastin resynthesis only played a complementary role.

In conclusion, our results have shown that probucol had inhibitory effects on elastase‐induced AAA in mice through several mechanisms (Figure 9). Probucol probably reduced the degradation of elastin by suppressing inflammation and oxidative injury, as well as expression and activity of MMPs and promoted the resynthesis of elastin to inhibit AAA. Our study suggests that probucol may have beneficial effects for the prevention of small AAA in patients.

Figure 9.

Pathways used by probucol (PB) in preventing AAA in vivo and in vitro. Probucol suppressed the development of AAA, by stimulating HO‐1. Probucol decreased the degradation of elastin by suppressing inflammation, oxidative injury and the expression and activity of MMPs. Probucol also promoted the re‐synthesis of elastin by stimulating fibrillin‐1 (FBN‐1) and lysyloxidase (LOX)

AUTHOR CONTRIBUTIONS

All authors contributed extensively to the work presented in this paper. C.C., Y.W., and R.Q. designed the experiments and prepared figures. Y.W., Y.C., and R.Q. wrote up the manuscript. Y.W. and Q.W. helped out in in vivo and in vitro experiments and data analysis. Y.C., G.A., and Q.Z. helped for the laboratory technique and experiments. The manuscript has been reviewed and approved by all authors.

CONFLICT OF INTEREST

The authors declare no conflicts of interest.

DECLARATION OF TRANSPARENCY AND SCIENTIFIC RIGOUR

This Declaration acknowledges that this paper adheres to the principles for transparent reporting and scientific rigour of preclinical research as stated in the BJP guidelines for https://bpspubs.onlinelibrary.wiley.com/doi/full/10.1111/bph.14207, https://bpspubs.onlinelibrary.wiley.com/doi/full/10.1111/bph.14208, and https://bpspubs.onlinelibrary.wiley.com/doi/full/10.1111/bph.14206, and as recommended by funding agencies, publishers, and other organizations engaged with supporting research.

Supporting information

Figure S1. Protein expression of α‐SMA and its quantification. After starvation for 12 hours before TNF‐α stimulation, the α‐SMA expression, a marker of contractile VSMCs, was increased, indicating that starvation induced phenotype transformation of the VSMCs from secretory to contractile phenotype. Stimulating the starved VSMCs with TNF‐α decreased the expression of α‐SMA, but probucol treatment upregulated its expression

Chen C, Wang Y, Cao Y, et al. Mechanisms underlying the inhibitory effects of probucol on elastase‐induced abdominal aortic aneurysm in mice. Br J Pharmacol. 2020;177:204–216. 10.1111/bph.14857