Abstract
Premise
Microsatellite markers were developed for the western Mediterranean tree Tamarix gallica (Tamaricaceae) as part of a study of its genetic diversity and structure.
Methods and Results
Seventeen microsatellite markers were developed for T. gallica, 14 of which were polymorphic. These microsatellites have di‐, tri‐, and tetranucleotide repeats with 1–13 alleles per locus and population. Levels of observed and expected heterozygosity ranged from 0.000 to 0.900 and from 0.000 to 0.863, respectively. Six microsatellites showed significant deviations from Hardy–Weinberg equilibrium in at least one population. Cross‐amplification in 19 Tamarix species showed a wide transferability to other species of the genus.
Conclusions
The 14 new polymorphic microsatellite markers will be used to assess the genetic diversity and population genetic structure of T. gallica. Additionally, the successful cross‐species amplification suggests their potential usefulness for investigating species delimitation and population genetics in the genus Tamarix.
Keywords: genetic diversity, saltcedar, simple sequence repeat (SSR) markers, species delimitation, Tamaricaceae, Tamarix gallica
Tamarix gallica L. is a widespread tree that forms woodlands in the western Mediterranean Basin in saline habitats such as salt marshes, ravines, and rivers with brackish waters (Baum, 1978). This species is closely related to and commonly confused with T. canariensis Willd. because of their similar morphology, anatomy, and phenology (Villar et al., 2019). Hybridization is common in the genus Tamarix L., making the species delimitation of T. gallica not well resolved (Villar et al., 2019). In addition, this and various other species of Tamarix have been reported as widespread invasives in North America (Villar et al., 2019).
Simple sequence repeat (SSR) markers (also referred to as microsatellites) are useful tools to help resolve species delimitation. Some microsatellite markers have already been described in the genus Tamarix (Gaskin et al., 2006; Terzoli et al., 2010, 2013; Zhang et al., 2019), but no study has focused on describing genomic SSR markers for T. gallica. Consequently, as part of a study of the genetic diversity and structure of T. gallica in the western Mediterranean Basin, the aim of this work is to characterize new polymorphic microsatellite markers for T. gallica. Cross‐species amplification was also tested in 19 species of Tamarix to aid with future taxon delimitation studies and population genetic studies of the genus both in native and invaded areas, particularly with respect to hybridization.
METHODS AND RESULTS
DNA extraction was carried out from silica gel–dried leaves by a modified cetyltrimethylammonium bromide (CTAB) method (Csiba and Powell, 2006). For the microsatellite library, 12 individuals of T. gallica and T. boveana Bunge were selected from two different populations. A microsatellite library enriched with TG, TC, AAC, AAG, AGG, ACG, ACAT, and ACTC motifs was prepared from the pooled DNA by Genoscreen (Lille, France) using a 454 GS‐FLX (Roche Diagnostics, Meylan, France) high‐throughput DNA sequencer (Malausa et al., 2011). Sequencing provided 22,418 reads with an average length of 220 bp. Raw sequences were searched for microsatellites with QDD version 3.1.2 (Meglécz et al., 2014) with default settings, which produced primers for 248 loci. To identify and eliminate known transposable elements and contaminants, these sequences were queried with RepeatMasker version open‐4.0.3 (Smit et al., 2015) in the database Repbase version 20140131 (Bao et al., 2015), and with BLAST+ version 2.2.28+ (https://blast.ncbi.nlm.nih.gov/Blast.cgi) in the National Center for Biotechnology Information (NCBI) nucleotide database. A total of 219 loci were developed for downstream testing.
The number of primer pairs was reduced according to the following criteria (based on Guichoux et al., 2011 and Meglécz et al., 2014): (1) high number of repeats, (2) pure repeats over compound repeats, (3) tri‐ and tetranucleotide repeats over dinucleotide repeats, (4) varying PCR product sizes and repeat motifs, (5) MIN_PRIMER_TARGET_DIST > 20, and (6) DESIGN A or B. Based on these criteria, primers for 52 loci were synthesized (Eurofins Genomics, Ebersberg, Germany). An M13 tail was attached to the 5′ end of the forward primers (Schuelke, 2000). Each locus was amplified for 12 individuals of T. gallica from four different populations (Appendix 1). PCRs were conducted in a final volume of 25 μL with DreamTaq PCR Master Mix (2×) (Thermo Scientific, Vilnius, Lithuania) with 40 ng of template DNA, and a final concentration of 0.2 μM of each primer and 20 ng/μL of bovine serum albumin (BSA) (Thermo Scientific). PCRs were conducted on a GeneAmp PCR System 9700 (Applied Biosystems, Foster City, California, USA) with the following conditions: an initial denaturation of 95°C for 5 min; followed by 35 cycles of 95°C for 30 s, 56°C for 45 s, and 72°C for 45 s; and a final extension at 72°C for 10 min. PCR products were run on a 2.5% agarose gel stained with ethidium bromide. Loci with multiple bands or with non‐successful amplification across all samples were discarded.
Fluorescent labeling of the 29 loci that amplified successfully was performed in simplex for the 12 samples with a three‐primer protocol including a universal M13 primer fluorescently labeled with FAM, HEX, or TAMRA dyes (Schuelke, 2000). Fluorescent‐labeled PCRs were conducted in a final volume of 10 μL with DreamTaq PCR Master Mix (2×) with 20 ng of template DNA, and a final concentration of 0.04 μM of the M13‐tailed forward primer, 0.16 μM of the reverse primer, 0.16 μM of the fluorescent‐labeled M13 primer, and 50 ng/μL of BSA. PCR conditions were as follows: an initial denaturation of 95°C for 5 min; followed by 30 cycles of 95°C for 30 s, 56°C for 45 s, and 72°C for 45 s; followed by 10 cycles of 95°C for 30 s, 53°C for 45 s, and 72°C for 45 s; and a final extension at 72°C for 10 min. PCR products were pooled in equimolar concentrations and run on an ABI Prism 310 Genetic Analyzer (Applied Biosystems) with GeneScan 500 Size Standard (Applied Biosystems) in the Research Technical Services of the University of Alicante (Alicante, Spain). Electropherograms were scored with Peak Scanner Software 2 (Thermo Fisher Scientific, Waltham, Massachusetts, USA). Markers with excessive stuttering, with more than two alleles, or that were difficult to score were discarded, resulting in 17 microsatellite loci, 14 of which were polymorphic (Table 1). These 14 loci were analyzed across 122 individuals from four populations of T. gallica in subsequent analyses (Appendix 1). To reduce the number of PCR reactions, some loci were multiplexed. Markers were combined to avoid size overlap, resulting in nine reactions, four in simplex and five in 2‐plex, that were pooled and run in three different mixes (Table 1). For the simplex reactions, the PCR conditions were the same as described above. In the 2‐plex reactions, PCR conditions were the same as described for fluorescent‐labeled simplex reactions except for the final primer concentrations (Table 1) and the double concentration of the fluorescent‐labeled M13 primer (0.32 μM). Allele calling was done with Peak Scanner Software 2, and allelic binning was done manually with the use of cumulative frequency plots of size distribution (Guichoux et al., 2011).
Table 1.
Characteristics of the 17 microsatellite loci developed in Tamarix gallica that successfully amplified.
| Locusa | Primer sequences (5′–3′) | Repeat motif | Allele size range (bp) | A | Mix | Fluorescent dye | Concentration (F/R) (μM)b | GenBank accession no. |
|---|---|---|---|---|---|---|---|---|
| T125‐4 | F: TGGAAGGTAAGAAGAGGATAAGAGA | (TGTA)7 | 121–145 | 7 | 1 | FAM | 0.04/0.16 | MN497849 |
| R: AAAGCCTCACCCAAACCTCT | ||||||||
| T133‐2 | F: AGCAGAATGGTTGATCCTTG | (TC)10 | 129–151 | 7 | 1 | HEX | 0.04/0.16 | MN497850 |
| R: TGGGTGCTAATTTCTGGAGTG | ||||||||
| T129‐2 | F: CACTATAGAAATAGGTGACACATGC | (CA)7 | 115–151 | 16 | 1 | TAMRA | 0.06/0.24 | MN497851 |
| R: CCATTTCTAGGGTGATTAGGTTG | ||||||||
| T163‐3 | F: CGAAGGTAAGACCCAGTTGC | (CTC)7 | 186–198 | 5 | 1 | TAMRA | 0.04/0.16 | MN497852 |
| R: TGGAGAGTGCTTGAACTTGA | ||||||||
| T140‐31 | F: TGGTTTGAAGCTTACTGGTTG | (TTC)8 | 137–152 | 7 | 2 | FAM | 0.04/0.16 | MN497853 |
| R: GGATTACTTCAGAATATACAAGCTCA | ||||||||
| T113‐3 | F: TGAGAAGCATTCCAAACCAA | (GAT)7 | 93–99 | 3 | 2 | HEX | 0.04/0.16 | MN497854 |
| R: GAGGACATTAATGCCACTGGA | ||||||||
| T190‐32 | F: CTCCAATCCATCGCTCTCA | (CGA)8 | 128–135 | 4 | 2 | HEX | 0.04/0.16 | MN497855 |
| R: GGCGGACGACTTTGCTTAT | ||||||||
| T190‐3 | F: GAAATAATCTTAACTTGATGGCCAAG | (GAG)7 | 168–189 | 6 | 2 | TAMRA | 0.04/0.16 | MN497856 |
| R: GGAGCTAAAGTTGAAAAAGAGTTGA | ||||||||
| T214‐3 | F: TTGACATGCCTCTTGAGGTG | (ATT)5 | 104–107 | 2 | 2 | TAMRA | 0.04/0.16 | MN497857 |
| R: TCCATTCCTAGTTGCTACAATCA | ||||||||
| T145‐3 | F: ACTTGCTTTCTTCACCGCAT | (TCT)13 | 90–117 | 10 | 3 | FAM | 0.04/0.16 | MN497858 |
| R: GGAGGATTTGAAGAATGTTGGA | ||||||||
| T134‐31 | F: CCCTTAGCCTCCCTTGTTTC | (TCT)12 | 141–168 | 7 | 3 | HEX | 0.04/0.16 | MN497859 |
| R: TCATGCTTGCAGAGAAGACG | ||||||||
| T190‐33 | F: TTGTTGCTGATGGGTGATTC | (CTT)6 | 107–113 | 3 | 3 | HEX | 0.04/0.16 | MN497860 |
| R: CCTTGTACTTGAAGTGTATGGCA | ||||||||
| T140‐32 | F: CCTTCACTCCTTCTGTTGCC | (CTT)7 | 123–132 | 4 | 3 | TAMRA | 0.04/0.16 | MN497861 |
| R: TTGGTGGATGTGGTATGGTG | ||||||||
| T230‐2 | F: AACAAAGCAAATTTGGCAGC | (TC)12 | 232–265 | 14 | 3 | TAMRA | 0.06/0.24 | MN497862 |
| R: CGTGTTAAATTCTGGGACGG | ||||||||
| T168‐2 | F: TGGACCGTCTTCTCGTCTTC | (GA)7 | 169 | M | — | — | — | MN560186 |
| R: TAAGTGATGGCACAGAACGC | ||||||||
| T193‐3 | F: TGGGAGTTTAGTTGTCTGTAGCC | (TTC)14 | 188 | M | — | — | — | MN560187 |
| R: AAGAGAAGCATCATTAGCAAGG | ||||||||
| T300‐2 | F: AAACTAATCCCCAACCCTTTC | (AC)6 | 299 | M | — | — | — | MN560185 |
| R: TCAGGAACAATGGCAAGTGA |
A = number of alleles; M = monomorphic.
The annealing temperature was 56°C for all loci.
PCR primer concentration.
GenAlEx version 6.503 (Peakall and Smouse, 2006) was used to calculate the number of alleles, effective number of alleles, and levels of observed and expected heterozygosities for each population, and to test for Hardy–Weinberg equilibrium (P < 0.05) (Table 2). Evidence of linkage disequilibrium was assessed by GENEPOP version 4.7.2 (Rousset, 2008) based on 10,000 permutations (P < 0.05). MICRO‐CHECKER version 2.2.3 (van Oosterhout et al., 2004) was used to estimate null allele frequencies.
Table 2.
Genetic properties of the 14 polymorphic microsatellites developed in Tamarix gallica.
| Locus | Antas (n = 30) | Cagliari (n = 30) | Elche (n = 30) | Tablas de Daimiel (n = 32) | ||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| A | A e | H o | H e | Null alleles | A | A e | H o | H e | Null alleles | A | A e | H o | H e | Null alleles | A | A e | H o | H e | Null alleles | |
| T125‐4 | 6 | 2.663 | 0.833 | 0.624 | — | 5 | 2.875 | 0.567 | 0.652 | — | 6 | 4.327 | 0.767 | 0.769 | — | 5 | 1.928 | 0.500 | 0.481 | — |
| T133‐2 | 4 | 1.515 | 0.133* | 0.340 | 0.227 | 6 | 2.459 | 0.433* | 0.593 | 0.117 | 5 | 2.217 | 0.233* | 0.549 | 0.254 | 4 | 2.557 | 0.281* | 0.609 | 0.244 |
| T129‐2 | 13 | 5.941 | 0.900 | 0.832 | — | 9 | 7.317 | 0.833 | 0.863 | — | 8 | 2.965 | 0.733 | 0.663 | — | 5 | 3.131 | 0.813 | 0.681 | — |
| T163‐3 | 3 | 1.268 | 0.233 | 0.212 | — | 4 | 2.002 | 0.433 | 0.501 | — | 3 | 1.412 | 0.267 | 0.292 | — | 2 | 1.064 | 0.063 | 0.061 | — |
| T140‐31 | 6 | 3.114 | 0.633 | 0.679 | — | 3 | 2.456 | 0.533 | 0.593 | — | 4 | 2.308 | 0.500 | 0.567 | — | 4 | 2.114 | 0.500 | 0.527 | — |
| T113‐3 | 3 | 2.335 | 0.300* | 0.572 | 0.221 | 3 | 1.802 | 0.500 | 0.445 | — | 3 | 2.299 | 0.500* | 0.565 | — | 3 | 1.575 | 0.375 | 0.365 | — |
| T190‐32 | 4 | 2.002 | 0.533* | 0.501 | — | 2 | 1.342 | 0.300 | 0.255 | — | 2 | 1.763 | 0.500 | 0.433 | — | 2 | 1.882 | 0.313 | 0.469 | 0.152 |
| T190‐3 | 2 | 1.220 | 0.200 | 0.180 | — | 5 | 1.950 | 0.500 | 0.487 | — | 4 | 1.367 | 0.300 | 0.268 | — | 2 | 1.398 | 0.281 | 0.285 | — |
| T214‐3 | 1 | 1.000 | 0.000 | 0.000 | — | 2 | 1.763 | 0.500 | 0.433 | — | 1 | 1.000 | 0.000 | 0.000 | — | 1 | 1.000 | 0.000 | 0.000 | — |
| T145‐3a | 8 | 4.094 | 0.357* | 0.756 | 0.256 | 8 | 6.081 | 0.400* | 0.836 | 0.252 | 5 | 3.147 | 0.333* | 0.682 | 0.246 | 7 | 4.830 | 0.469* | 0.793 | 0.202 |
| T134‐31 | 4 | 1.410 | 0.267 | 0.291 | — | 4 | 2.462 | 0.633 | 0.594 | — | 4 | 1.468 | 0.333 | 0.319 | — | 4 | 2.190 | 0.531 | 0.543 | — |
| T190‐33 | 1 | 1.000 | 0.000 | 0.000 | — | 3 | 1.350 | 0.300 | 0.259 | — | 1 | 1.000 | 0.000 | 0.000 | — | 1 | 1.000 | 0.000 | 0.000 | — |
| T140‐32 | 4 | 2.799 | 0.400* | 0.643 | 0.183 | 2 | 1.471 | 0.200* | 0.320 | 0.153 | 4 | 1.978 | 0.533 | 0.494 | — | 3 | 2.118 | 0.344 | 0.528 | 0.165 |
| T230‐2 | 8 | 3.711 | 0.467* | 0.731 | 0.177 | 6 | 3.396 | 0.700 | 0.706 | — | 10 | 3.273 | 0.533 | 0.694 | 0.116 | 4 | 1.653 | 0.313 | 0.395 | — |
A = number of alleles; A e = effective number of alleles; H e = expected heterozygosity; H o = observed heterozygosity; n = number of individuals sampled.
For locus T145‐3 in Antas population, n = 28.
Significant deviation from Hardy–Weinberg equilibrium (P < 0.05).
The number of alleles per population ranged from one to 13 (Table 2). Levels of observed and expected heterozygosity ranged from 0.000 to 0.900 and from 0.000 to 0.863, respectively. Almost all markers were polymorphic in the four populations, except for T214‐3 and T190‐33, which were only polymorphic in the Cagliari population. Six microsatellites showed null alleles and significant deviations from Hardy–Weinberg equilibrium in at least one population (Table 2), so these markers should be treated with caution in posterior analyses. Seven comparisons between pairs of markers showed significant linkage disequilibrium: T125‐4 with T129‐2, T125‐4 with T163‐3, T125‐4 with T190‐33, T133‐2 with T134‐31, T129‐2 with T190‐33, T163‐3 with T134‐31, and T190‐32 with T190‐3. In addition, we performed cross‐species amplification in 88 individuals from 19 species of the genus Tamarix with the same simplex and 2‐plex PCR reactions used in T. gallica (Appendix 1), demonstrating wide transferability to other species of the genus such as T. boveana, T. africana Poir., and T. canariensis (Table 3).
Table 3.
Size ranges (in base pairs) of the 14 polymorphic microsatellite loci developed in Tamarix gallica cross‐amplified in 19 Tamarix species.
| Species | T125‐4 | T133‐2 | T129‐2 | T163‐3 | T140‐31 | T113‐3 | T190‐32 | T190‐3 | T214‐3 | T145‐3 | T134‐31 | T190‐33 | T140‐32 | T230‐2 |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| T. africana (n = 16) | — | 131–159 | 116–137 | 184–187 | 134–163 | 87–99 | 129 | 165–171 | 104 | 93–111 | 150–165 | 208–209 | — | 229–247 |
| T. amplexicaulis (n = 4) | — | 129–133 | 118 | 186 | 160–172 | 96 | 129 | — | 122–137 | 96–102 | 144 | 208 | 129 | 236–240 |
| T. aphylla (n = 3) | — | 128 | — | 192 | 131–134 | 93 (1) | — | — | 104 | — | 156 | 209–210 | 132 | — |
| T. arceuthoides (n = 2) | — | 131 | 115 | 183–189 | 128–161 | 93 | 129–135 | 171–183 | 104 | 96–105 | 156–165 | 110 | 126 | 234–239 |
| T. boveana (n = 18) | 113–129 | 131–133 | 119–129 | 184–195 | 137–157 | 96–99 | 129–132 | 171–195 | 104 | 96–114 | 150–162 | 110 | 114–129 | 232–247 |
| T. canariensis (n = 12) | 117–141 | 131–159 | 115–133 | 187–189 | 128–157 | 93–96 | 129 | 165–177 | 104–107 | 93–117 | 150–162 | 110–209 | 126–132 (5) | 229–261 |
| T. chinensis (n = 1) | — | 131–135 | 101 | 180 | 128 | 96 | 126 | 168 | 104 | 99 | 156 | 183 | 123 | 238 |
| T. dalmatica (n = 4) | — | 131–139 | 123 (1) | 181–186 | 137–157 | 96 (1) | 129 (1) | 165 (1) | 104 | 96 (2) | 150–159 (2) | 198–208 | 126–189 | 229–243 (3) |
| T. hampeana (n = 3) | — | 131–139 | 104–125 | 180–195 | 128–135 | 93–96 | 129–135 | 174–192 (2) | 104 | 93–99 | — | 110–209 | 123 | — |
| T. hispida (n = 1) | — | 131–135 | 109 | 189 | 143–146 | 96 | 129–132 | 167 | 104 | 96 | 150 | 107 | 123 | 239 |
| T. hohenackeri (n = 2) | 117–129 (1) | 131 | 117–134 | 183–195 | 126–129 | — | 129–132 | 171–180 | 104 | 99–126 | 150 (1) | 110–113 | 123 | 232–241 |
| T. leptostachya (n = 1) | — | 131 | 123–127 | 186 | 135–142 | — | 129 | 168–174 | 104 | 90–99 | 150 | — | 123 | 234–245 |
| T. minoa (n = 3) | — | 131–139 | 119–127 | 186–189 | 137–157 | 93–96 | 129–132 | 192–195 | 104 | — | 150–153 | 110–208 | 123–126 | 235–260 |
| T. nilotica (n = 6) | — | 131 | 115 | 189 | 128 | 93 | 129 | 171 | 104 | 109 | 153–159 | 110 | 126–129 | 240–267 |
| T. parviflora (n = 3) | 160 (2) | 131–149 | 123–133 | 189 | 128–144 | 93 | 129 | 177 | 104 | 96 | 153–165 | 110–208 | 123 | 232–236 |
| T. ramosissima (n = 1) | — | 131 | 124 | 180 | 128 | — | 126 | 168 | 104 | 90 | — | 208 | 123 | 238 |
| T. smyrnensis (n = 2) | — | 131–149 | 113–123 | 180–189 | 129 | — | 129–132 | 171–183 | 104 | 99 (1) | 150 (1) | 208 | 123 (1) | 234–236 |
| T. tetragyna (n = 3) | — | 129–133 | 113–127 | 183–195 | 137 | 96 | 129–132 | 174–177 (2) | 104 | 91–99 (2) | 150–162 | 110 | 126 | 235–243 |
| T. usneoides (n = 3) | — | 135–137 | — | 183–189 | 137–140 | 93 | — | 153–165 (2) | 104 | — | 162–168 | 208 | 141 | — |
Numbers in parentheses indicate the number of samples that successfully amplified. No number in parentheses indicates that all samples were successfully amplified. A dash indicates no successful amplification for any sample.
CONCLUSIONS
The 14 polymorphic microsatellite markers described here showed high variability and will be used to assess the genetic diversity and population genetic structure of T. gallica. Additionally, the successful rates of cross‐species amplification suggest their potential usefulness to assess population genetic parameters and provide data on the role of interspecific hybridization in the genus.
AUTHOR CONTRIBUTIONS
A.T. helped design the experiment, conducted the lab work, analyzed the results, and helped write the article. A.J. helped design the experiment and write the article.
ACKNOWLEDGMENTS
The authors thank the director and guards of Tablas de Daimiel National Park for permitting collection of material. This research was funded by the Ministerio de Agricultura, Alimentación y Medio Ambiente (Project OAPN 354/2011). A.T. was supported by a research grant from the Ministerio de Educación (FPU grant AP‐2012‐1954), and A.J. was supported by the grant BEST/2019/155 (Generalitat Valenciana). This study is part of the Ph.D. thesis of A.T.
Appendix 1. Voucher information for Tamarix species used in this study.
| Species | Voucher specimen accession no.a | Collection locality | Geographic coordinates (WGS84) | N |
|---|---|---|---|---|
| T. africana Poir. | ABH 73511 | Portugal, Baixo Alentejo, Melides, Lagoa de Melides | 38.129, −8.789 | 2 |
| ABH 70789 | Spain, Castellón, Burriana, Clot de la Mare de Déu | 39.879, −0.055 | 12 | |
| ABH 70742 | Spain, Murcia, Águilas, Rambla de Minglano de Cañarete | 37.433, −1.629 | 2 | |
| T. amplexicaulis Ehrenb. | ABH 70685 | Algeria, Biskra, N3 crossing with Oumache, Km 336 | 34.719, 5.739 | 4 |
| T. aphylla (L.) H. Karst | ABH 70064 | Italy, Sardinia, Oristano, Cabras, Is Aruttas | 39.954, 8.403 | 1 |
| ABH 71909 | Morocco, Nador, Berkane, Oued Moulouya | 35.103, −2.360 | 1 | |
| ABH 54208 | Morocco, Nador, Driouch | 34.972, −3.360 | 1 | |
| T. arceuthoides Bunge | MO 5568719 | Iran, Esfahan, Road from Tehran to Nain, south of junction to Esfahan | 33.0152, 52.5238 | 1 |
| MO 5568891 | Iran, Qom, old rd. from Tehran to Qom | 35.1705, 50.9777 | 1 | |
| T. boveana Bunge | ABH 70782 | Spain, Alicante, Santa Pola, Salinas de Santa Pola | 38.184, −0.602 | 6 |
| ABH 68315 | Spain, Almería, Cabo de Gata | 36.773, −2.238 | 12 | |
| T. canariensis Willd. | ABH 69606 | Spain, Canary Islands, Gran Canaria, beach of La Aldea de San Nicolás | 27.996, −15.824 | 12 |
| T. chinensis Lour. | Gaskin 202 | South Korea | — | 1 |
| T. dalmatica B. R. Baum | ABH 57833 | Albania, Shkoder, next to rd. at south of Shkoder | 41.968, 19.547 | 1 |
| ABH 57829 | Albania, Vlore, Sarande, Borsh | 40.047, 19.846 | 1 | |
| ABH 57830 | Albania, Vlore, Sarande, Vrion, rd. from Greece to Sarande | 39.904, 20.084 | 1 | |
| ABH 57843 | Montenegro, Bar, south of Bar | 42.093, 19.104 | 1 | |
| T. gallica L. | ABH 70037 | Italy, Sardinia, Cagliari, Stani Simbirizzi | 39.2631, 9.2086 | 30 |
| ABH 69543 | Spain, Alicante, Elche, Pantano de Elche | 38.3174, −0.718 | 30 | |
| ABH 67467 | Spain, Almería, Vera, río Antas | 37.2054, −1.8291 | 30 | |
| ABH 73456 | Spain, Ciudad Real, Daimiel, Tablas de Daimiel | 39.1521, −3.7106 | 32 | |
| T. hampeana Boiss. & Heldr. | ABH 59877 | Greece, Central Greece, Molos‐Agios Konstantinos, Neo Thronio | 38.834, 22.703 | 1 |
| ABH 59025 | Greece, Epirus, Igoumenitsa, Marshes at NW of Igoumenitsa | 39.525, 20.198 | 1 | |
| ABH 57891 | Montenegro, Ulcinj, Sveti Nikola, Bojana river | 41.870, 19.352 | 1 | |
| T. hispida Willd. | Gaskin 10164 | China | — | 1 |
| T. hohenackeri Bunge | MO 5568893 | Iran, Gilan, rd. from Rasht to Tehran, near Gangeh, south of Rasht | 36.8641, 49.4811 | 1 |
| MO 5568696 | Iran, Semnan, NE of Sharud toward Gorgon | 36.7252, 55.2975 | 1 | |
| T. leptostachya Bunge | Gaskin 10177 | China | — | 1 |
| T. minoa J. L. Villar, Turland, Juan, Gaskin, M. Á. Alonso & M. B. Crespo | ABH 54194 | Greece, Crete, Chania, Georgioupoli | 35.365, 24.248 | 1 |
| ABH 54195 | Greece, Crete, Chania, near Platanias | 35.356, 24.260 | 1 | |
| MO 6207620 | Greece, Crete, Nomos Chanion, Eparchia Apokoronou Georgioupoli beach | 35.359, 24.266 | 1 | |
| T. nilotica (Ehrenb.) Bunge | ABH 54320 | Greece, Crete, Chania, Paleochora beach | 35.223, 23.670 | 1 |
| ABH 54314 | Greece, Crete, Heraklion, Aposelemis | 35.330, 25.327 | 1 | |
| ABH 54317 | Greece, Crete, Heraklion, Kalo Nero | 35.014, 26.046 | 1 | |
| ABH 54326 | Greece, Crete, Heraklion, near Dermatos | 34.979, 25.335 | 1 | |
| ABH 54323 | Greece, Crete, Heraklion, near Dermatos | 34.979, 25.324 | 1 | |
| ABH 54316 | Greece, Crete, Lassithi, Xerokambos | 35.051, 26.232 | 1 | |
| T. parviflora DC. | ABH 54197 | Greece, Crete, Heraklion, near Aposelemis | 35.321, 25.327 | 1 |
| ABH 54321 | Greece, Crete, Heraklion, near Dermatos | 34.979, 25.324 | 1 | |
| ABH 55398 | Spain, Alicante, Biar, Santuario Mare de Déu de Gràcia | 38.629, −0.760 | 1 | |
| T. ramosissima Ledeb. | W 2009‐19143 | Argentina, San Juan, Ullum, at Termas de Talacasto | −31.03, −68.75 | 1 |
| T. smyrnensis Bunge | W 2003‐14043 | Armenia, Vayots'Dzor, Yeghegnadzor | 39.68, 45.22 | 1 |
| Gaskin 4690‐06 | Turkey | — | 1 | |
| T. tetragyna Ehrenb. | W 2007‐14048 | Egypt, New Valley, Western Desert Dakhleh Oasis | 25.667, 28.870 | 1 |
| W 2007‐25728 | Egypt, South Sinai, Dahab, Wadi Qnai, Oase, salzreicher Feuchtstandort | 28.4532, 34.4492 | 1 | |
| W 2007‐07364 | Jordan, Al Asimah, 11.5 km NE end of Dead Sea, 2 km N v. Tell Iktanu | 31.833, 35.676 | 1 | |
| T. usneoides E. Mey. | ABH 58684 | Namibia, Erongo, Swerkobmund | −22.708, 14.961 | 2 |
| ABH 58683 | South Africa, Western Cape, Prince Albert, betw. Lainsburg and Beaufort West | −33.085, 21.579 | 1 |
N = number of individuals.
Vouchers were deposited at the herbaria of Universidad de Alicante, Spain (ABH); research collection of John F. Gaskin, Sidney, Montana, USA (Gaskin); Missouri Botanical Garden, St. Louis, Missouri, USA (MO); and Naturhistorisches Museum Wien, Vienna, Austria (W).
Terrones, A. , and Juan A.. 2020. Seventeen new microsatellites for Tamarix gallica and cross‐amplification in Tamarix species. Applications in Plant Sciences 8(1): e11317.
DATA ACCESSIBILITY
Sequence information for the developed primers has been deposited to the National Center for Biotechnology Information (NCBI); GenBank accession numbers are provided in Table 1.
LITERATURE CITED
- Bao, W. , Kojima K. K., and Kohany O.. 2015. Repbase Update, a database of repetitive elements in eukaryotic genomes. Mobile DNA 6(1): 11. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Baum, B. R. 1978. The genus Tamarix. The Israel Academy of Sciences and Humanities, Jerusalem, Israel. [Google Scholar]
- Csiba, L. , and Powell M. P.. 2006. Appendix 1: Isolation of total plant cellular DNA for long‐term storage: CTAB procedure In Savolainen V., Powell M. P., Davis K., Reeves G., and Corthals A. [eds.], DNA and tissue banking for biodiversity and conservation: Theory, practice and uses, 114–117. Royal Botanic Gardens Kew, Richmond, Surrey, United Kingdom. [Google Scholar]
- Gaskin, J. F. , Pepper A. E., and Manhart J. R.. 2006. Isolation and characterization of 10 polymorphic microsatellites in saltcedars (Tamarix chinensis and Tamarix ramosissima). Molecular Ecology Notes 6(4): 1147–1149. [Google Scholar]
- Guichoux, E. , Lagache L., Wagner S., Chaumeil P., Léger P., Lepais O., Lepoittevin C., et al. 2011. Current trends in microsatellite genotyping. Molecular Ecology Resources 11(4): 591–611. [DOI] [PubMed] [Google Scholar]
- Malausa, T. , Gilles A., Meglécz E., Blanquart H., Duthoy S., Costedoat C., Dubut V., et al. 2011. High‐throughput microsatellite isolation through 454 GS‐FLX Titanium pyrosequencing of enriched DNA libraries. Molecular Ecology Resources 11(4): 638–644. [DOI] [PubMed] [Google Scholar]
- Meglécz, E. , Pech N., Gilles A., Dubut V., Hingamp P., Trilles A., Grenier R., and Martin J. F.. 2014. QDD version 3.1: A user‐friendly computer program for microsatellite selection and primer design revisited: experimental validation of variables determining genotyping success rate. Molecular Ecology Resources 14(6): 1302–1313. [DOI] [PubMed] [Google Scholar]
- van Oosterhout, C. , Hutchinson W. F., Wills D. P., and Shipley P.. 2004. MICRO‐CHECKER: Software for identifying and correcting genotyping errors in microsatellite data. Molecular Ecology Notes 4(3): 535–538. [Google Scholar]
- Peakall, R. O. D. , and Smouse P. E.. 2006. GenAlEx 6: Genetic analysis in Excel. Population genetic software for teaching and research. Molecular Ecology Notes 6(1): 288–295. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Rousset, F. 2008. GENEPOP'007: A complete re‐implementation of the GENEPOP software for Windows and Linux. Molecular Ecology Resources 8(1): 103–106. [DOI] [PubMed] [Google Scholar]
- Schuelke, M. 2000. An economic method for the fluorescent labeling of PCR fragments. Nature Biotechnology 18(2): 233–234. [DOI] [PubMed] [Google Scholar]
- Smit, A. F. A. , Hubley R., and Green P.. 2015. RepeatMasker Open‐4.0. Website http://www.repeatmasker.org [accessed 20 December 2019].
- Terzoli, S. , Beritognolo I., Sabatti M., and Kuzminsky E.. 2010. Development of a novel set of EST‐SSR markers and cross‐species amplification in Tamarix africana (Tamaricaceae). American Journal of Botany 97(6): e45–e47. [DOI] [PubMed] [Google Scholar]
- Terzoli, S. , Cattan E., Sabatti M., Valentini R., Zilberstain A., and Kuzminsky E.. 2013. Primer Note: A novel set of EST‐SSR markers in Tamarix: A resource to characterize this genus. Silvae Genetica 62(3): 104–109. [Google Scholar]
- Villar, J. L. , Alonso M. Á., Juan A., Gaskin J. F., and Crespo M. B.. 2019. Out of the Middle East: New phylogenetic insights in the genus Tamarix (Tamaricaceae). Journal of Systematics and Evolution 57(5): 488–507. [Google Scholar]
- Zhang, R. , Wen Q., and Xu L.. 2019. Development and characterization of genomic SSR markers for Tamarix chinensis (Tamaricaceae). Applications in Plant Sciences 7(2): e1219. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
Sequence information for the developed primers has been deposited to the National Center for Biotechnology Information (NCBI); GenBank accession numbers are provided in Table 1.