Abstract
Background:
Recent evidence indicates that single nucleotide polymorphisms (SNPs) in the Cox-2 gene may modulate the risk of colorectal adenoma development.
Patients and Methods:
We explored possible associations between Cox-2 polymorphisms and risk of adenoma development in an African American case–control study comprising 72 cases of advanced adenomas and 146 polypfree controls. An exhaustive approach of genotyping 13 haplotype-tagging SNPs (ht SNPs) distributed over the entire COX-2 gene was used.
Results:
Statistically significant inverse associations were observed between the heterozygous genotypes at the 5229 G>T polymorphism in intron 5 [odds ratio (OR)=0.42; confidence interval (CI)=0.19–0.92; p=0.03] and at the 10935 A>G polymorphism in the 3’ flanking region downstream from the poly A signals (OR=0.39; CI=0.18–0.83; p=0.01) and the risk for colorectal adenoma development.
Conclusion:
The data from our pilot study suggest that allelic variants of the COX-2 gene significantly influence the risk of adenoma development in the African American population.
Keywords: Cox-2 polymorphisms, colorectal adenoma, African Americans
Colon cancer accounts for approximately 10% of all cancer related deaths and remains the third deadliest killer among cancer types in the United States (1). Epidemiological data show that African Americans have higher age-specific incidence and mortality rates and lower 5-year survival rates compared to Caucasians (2). Although reasons for this disparity are not clear, evidence implicates genetic, environmental and lifestyle factors as contributors to this multi-factorial disease (3).
There is mounting evidence that chronic inflammation is involved in the etiology of cancer. Previous studies have reported an association between genetic variants of pro- inflammatory genes and the risk of developing colorectal adenoma and carcinoma (4–6). One such gene, encoding the enzyme cyclooxygenase-2 (Cox-2) plays a significant role in inflammation and carcinogenesis (7). Epidemiological observations as well as randomized prevention clinical trials have provided evidence for a significant role of Cox-2 in colon carcinogenesis (8–11). More recently, several studies have explored association between genetic variants of Cox-2, alone or in interaction with environmental factors, and risk of developing colorectal adenoma/carcinoma mostly in Caucasians (12–15).
Relatively few studies have addressed the influence of genetic variants of Cox-2 on cancer risk in the African American population. A polymorphism in African Americans replacing the amino acid valine with alanine at position 511 in exon 10 of Cox-2 has been described to reduce the risk of colorectal cancer (16, 17). Another study reported different patterns of association between the genetic variants in the regulatory regions of Cox-2 and prostate cancer risk in three different ethnic populations including African Americans (18). This observation is not surprising as patterns of genetic polymorphisms may vary within and between populations. The haplotype block structures of human genome containing regions of high linkage disequilibrium are of shorter size and reduced diversity in African Americans compared to Caucasians (19). To better understand the significance of genetic variations in the Cox-2 gene in influencing colorectal cancer risk in African Americans, we used a case–control study of advanced adenomas to exhaustively analyze a possible association between Cox-2 polymorphisms and colorectal cancer by genotyping 13 haplotype-tagging single nucleotide polymorphisms (htSNPs) in the Cox-2 gene.
Materials and Methods
Patient selection.
The study was approved by the Howard University Institutional Review Board. Study participants were recruited from patients referred for colonoscopy to the gastroenterology division at Howard University Hospital between September 2000 and October 2003. Indications for colonoscopy included rectal bleeding, irregular bowel habit, weight loss, family history of colon polyp/cancer, personal history of colon polyp and routine screening. Cases were eligible if colonoscopy resulted in a first diagnosis of colorectal adenomatous or hyperplastic polyp as confirmed by histology. Patients with a history of inflammatory bowel disease, malabsorption, any cancer, current or past chemotherapy or interferon treatment were excluded. Patients with distal or proximal polyps and with adenomatous or hyperplastic pathology, as determined by independent pathologists were selected as cases. Based on these criteria, 72 patients qualified as cases. Controls had to be free of all polyps and self-described with no previous history of colorectal adenomas/cancer. All patients were as African Americans. Clinical and demographic data collected on each patient included race, gender, past medical history, family history of colorectal polyp/cancer and information on smoking, alcohol consumption and medication use. DNA was extracted from samples from 72 patients and 146 controls.
Genotyping.
The htSNPs of the Cox-2 gene for the population of African American descent, together with the respective primers and probes used in this study are displayed in Table I. The positions of the polymorphisms refer to the Genbank entry AY382629 and as detailed at http://pga.gs.washington.edu/data/ptgs2/. All assays were designed and developed using Assay-by-Design (Applied Biosystems Inc, CA, USA). All oligo primers and probes were synthesized by Applied Biosystems, Inc. Assays were validated and optimized using in-house collected human DNA samples. Positive control DNAs of known genotypes as well as a no-template control were run on each assay plate for quality control. All SNPs were tested by the Taqman assay using the MGB chemistry (Applied Biosystems, Inc.) and the ABI 7900HT Sequence Detector. SDS 2.1 (Applied Biosystems, Inc.) was used to determine the genotype calls. Specific experimental details about genotyping will be provided upon request from the authors.
Table I.
Polymorphisms, primers and probes used in this study.
| Polymorphism | Forward primers | Reverse primers | Reporter _VIC | Reporter _FAM |
|---|---|---|---|---|
| 466 (A>C) | AGAAAGGCTTCC | CACCAGGTACCTCA | TCTCATGAA | TCATGCAG |
| TAGATGAGATGGA | ATTTGTAGAAGT | GAATCAG | AATCAG | |
| 663 (GT>del) | AGGACTTAGGACATA | GGAGCATGTGAGG | CACTTTTCTGGT | CTTTTCTGGT |
| ACTGAATTTTCTATTTT | GTGAGATACT | GTGTGTATA | GTGTGTGTATA | |
| 861 (G>A) | GCACTACCCATGA | TTCAGTTGCCTGG | ACGAGAATAAA | CGAGAATAG |
| TAGATGTTAAACAA | GCTTATTG | AAATTAGCC | AAAATTAGC | |
| 2331 (C>T) | GTGACTTGGGA | GGCTCATAATGAT | CACGGAGTTCT | ACGGAGTTC |
| AAGAGCTTGGA | CAGTGCTTGTG | TTCGGACT | TTTCGAACT | |
| 5072 (A>C) | CAGGTATTGTTATTT | CGGCATAATCATG | TTAGTACTGCA | AGTACTGCAA |
| GTAATTTGACCCTTGT | GTACAATGTGTT | AAATGTTATG | ACTGTTATG | |
| 5229 (G>T) | TGGATTTCAATAG | TGTTTAACGGAATTAAT | CTTTTTTAGAATTACC | CTTTTTTATAATTACCAT |
| CATAGCTTCAAGTT | ATACTATATTGAGCTTA | ATATCATCATAGT | ATCATCATAGTGAA | |
| 5625 (G>A) | AATGAAATATCAGGT | CAGTTAAAAAGTTAAGG | ACTTAGTTATTAC | CTTAGTTATTA |
| ATGCTTCCTTTGACT | AACACATTTTTAGGGA | CACTTATAC | CCGCTTATAC | |
| 6064 (T>C) | GTTTTGAGTAAATGAC | TCAAAAGATAGCTATTT | ACTCACACACT | ACTCACACAT |
| AAGATGTGGTAAATGA | TATCAGTCATGCTTACA | CTATATAC | TCTATATAC | |
| 8344 (TTATA>del) | AAATGAGTTTTGAC | CCATCTTGTGACAGTG | TTCAACTTATAAG | TTCAACTTATATTATA |
| GTCTTTTTACTTGA | TTTAAGTATTCA | AACGAAAGTAA | AGAACGAAAGTA | |
| 8494 (C>T) | TCCATGATGCATTAGA | GCACTGATACCTGT | CTTTTGGTC | ACTTTTGGT |
| AGTAACTAATGTTTGA | TTTTGTTTGATGA | ATTTTTC | TATTTTTC | |
| 10494 (T>C) | TCTGCTGACAAA | CTTATCTTTTACATAAGTTA | CACTGAAACAT | ACTGAAACAT |
| ACCTGGGAATTT | AATACACATTTGTCTGAGG | TCGCATACA | TCACATACA | |
| 10848 (G>A) | ACTGTGTTGGAAAA | TCTTCTAGACTAGGC | CTTTACAGAAG | CTTTACAGAAGA |
| TGTCTAGTTTGTGTA | AATGAAAATAAGCT | ATGAMAAACA | TGGMAAAC | |
| 10935 (A>G) | AAGAAGAAGAAAAAAAT | GCCCAACTTTGTATA | ACTTTGTGC | CTTTGTGC |
| ACACAATAAGGCAAAGA | ATTTCCTCCTCTT | CTCCTTCA | CCCCTTCA | |
Numbers for polymorphism refer to positions in the Genbank entry AY382629 and as detailed at http://pga.gs.washington.edu/data/ptgs2/ptgs2.ColorFasta.html
Data analysis.
Odds ratios (ORs) were estimated using logistic regression models with the PROC LOGISTIC function of the SAS software package (version 9.1; SAS Institute, Cary, NC, USA) adjusting for gender and smoking. Departure from Hardy–Weinberg equilibrium was assessed by comparing the expected to observed genotype frequencies using the asymptomatic Pearson’s χ2 test.
Results
Characteristics of the study population and the association with colorectal cancer in this group of cases and controls are displayed in Table II. The only highly significant positive association was observed between current smokers and the risk of adenoma development [odds ratio (OR)=2.73, 95% confidence interval (CI) =1.20–6.19, p=0.03). A nonsignificant association was also present between former smokers and adenoma development (OR=1.52, CI=0.81–2.84, p=0.25).
Table II.
Characteristics of cases and controls.
| Characteristic | Cases | Controls | OR | 95% CI | P-value |
|---|---|---|---|---|---|
| Gender | |||||
| Male | 48 | 85 | 1 | - | - |
| Female | 25 | 67 | 0.66 | 0.37–1.18 | 0.21 |
| Age (years) | |||||
| <60 | 35 | 88 | 1 | - | - |
| >60 | 37 | 64 | 1.45 | 0.83–2.55 | 0.25 |
| Body mass index | |||||
| <25 | 11 | 32 | 1 | ||
| 25–30 | 20 | 40 | 1.45 | 0.60–3.47 | 0.39 |
| >30 | 22 | 61 | 1.04 | 0.45–2.43 | 0.91 |
| Smoking status | |||||
| Non-smoker | 33 | 90 | 1 | - | - |
| Current | 15 | 15 | 2.73 | 1.20–6.19 | 0.03 |
| Former | 25 | 45 | 1.52 | 0.81–2.84 | 0.25 |
| Alcohol | |||||
| Never | 29 | 84 | 1 | - | - |
| Current | 33 | 69 | 0.63 | 0.28–1.41 | 0.26 |
| Former | 13 | 24 | 0.88 | 0.40–1.95 | 0.75 |
| Aspirin | |||||
| Never | 22 | 124 | 1 | - | - |
| Yes | 11 | 27 | 0.81 | 0.38–1.75 | 0.75 |
OR, odds ratio; CI, confidence interval.
The data of the association analysis for the main effect of the 13 polymorphisms distributed over the entire Cox-2 gene are displayed in Table III. Of the 13 htSNPs, an intronic polymorphism and another in the 3’ flanking region (FR), when adjusted for gender and smoking, were associated with a lower risk of adenomas. Adjusting for age and smoking also resulted in very similar associations (data not shown). Individuals with the heterozygous genotype at the intron 5–5229 had a statistically significant decrease in the risk of developing adenomas (OR=0.42, CI=0.19–0.92, p=0.03). Similarly, a highly significant protective effect for adenoma risk was observed in individuals with the heterozygous genotype at position 3’FR-10935 (0R=0.39, CI=0.18–0.83, p=0.01). The risk of adenoma in individuals with the variant homozygous genotypes at intron 5–5229 and 3’ FR-10935, however, was no different from that of the control group.
Table III.
COX-2 genotypes and the risk of advanced colorectal adenoma.
| Genotype | Cases/controls | OR | 95% CI | P-value |
|---|---|---|---|---|
| 466 rs689462 | ||||
| AA | 45/79 | 1.00 | - | - |
| AC | 20/40 | 1.00 | 0.51–1.93 | 0.99 |
| CC | 4/14 | 0.61 | 0.18–2.03 | 0.42 |
| 663 rs689464 | ||||
| GT | 39/72 | 1.00 | - | - |
| GT/del | 26/45 | 1.09 | 0.58–2.05 | 0.80 |
| del | 2/14 | 0.29 | 0.06–1.38 | 0.12 |
| 861 rs20415 | ||||
| GG | 60/111 | 1.00 | - | - |
| AG | 9/21 | 0.80 | 0.34–1.88 | 0.61 |
| AA | 3/17 | 0.29 | 0.08–1.04 | 0.06 |
| 2331 rs2745557 | ||||
| CC | 51/93 | 1.00 | - | - |
| CT | 18/31 | 1.10 | 0.55–2.20 | 0.78 |
| TT | 0/18 | - | - | - |
| 5072 rs4648274 | ||||
| AA | 53/97 | 1.00 | - | - |
| AC | 15/29 | 0.99 | 0.48–2.05 | 0.98 |
| CC | 1/5 | 0.38 | 0.04–3.34 | 0.38 |
| 5229 rs20432 | ||||
| TT | 16/21 | 1.00 | - | - |
| TG | 32/90 | 0.42 | 0.19–0.92 | 0.03 |
| GG | 25/34 | 1.05 | 0.44–2.50 | 0.91 |
| 5625 rs2066826 | ||||
| GG | 31/56 | 1.00 | - | - |
| AG | 27/57 | 0.82 | 0.43–1.57 | 0.61 |
| AA | 12/16 | 1.38 | 0.57–3.36 | 0.49 |
| 6064 rs4648276 | ||||
| TT | 55/94 | 1.00 | - | - |
| CT | 14/32 | 0.70 | 0.34–1.45 | 0.34 |
| CC | 1/4 | 0.42 | 0.04–4.09 | 0.45 |
| 8344 rs4648291 | ||||
| TTATA | 26/54 | 1.00 | - | - |
| TTATA/del | 29/54 | 1.06 | 0.54–2.07 | 0.86 |
| del | 15/23 | 1.54 | 0.68–3.56 | 0.31 |
| 8494 rs5275 | ||||
| CC | 23/52 | 1.00 | - | - |
| CT | 31/58 | 1.20 | 0.61–2.34 | 0.60 |
| TT | 16/26 | 1.53 | 0.68–3.45 | 0.30 |
| 10494 rs689470 | ||||
| TT | 12/18 | 1.00 | - | - |
| CT | 26/61 | 0.54 | 0.22–1.32 | 0.18 |
| CC | 32/53 | 0.86 | 0.36–2.06 | 0.74 |
| 10848 rs4648306 | ||||
| GG | 55/95 | 1.00 | - | - |
| AG | 14/30 | 0.77 | 0.37–1.61 | 0.49 |
| AA | 1/5 | 0.32 | 0.04–2.94 | 0.31 |
| 10935 rs4648308 | ||||
| GG | 23/38 | 1.00 | - | - |
| AG | 22/66 | 0.39 | 0.18–0.83 | 0.01 |
| GG | 24/38 | 0.85 | 0.39–1.84 | 0.68 |
Ancestral alleles are treated as wild-type. OR, odds ratio; CI, confidence interval. Values are adjusted for gender and smoking.
Besides the polymorphisms at intron 5– 5229 and 3’FR-10935, two other polymorphisms in the promoter region showed a trend for a protective effect for adenoma development. There was a marginally significant lower risk of adenoma development in individuals with the rare homozygous genotype at the −861 position (OR=0.29, CI=0.08–1.04, p=0.06) and a statistically non-significant protective trend for the risk of adenomas (OR=0.29, CI=0.06–1.38, p=0.12) in individuals with another rare homozygous variant at the −663 polymorphism (Table III).
Discussion
To our knowledge, our pilot study represents the first exhaustive approach to determine the influence of genetic variants of Cox-2 on the risk of colorectal adenoma development in African Americans. We evaluated 13 htSNPs with a minor allele frequency ranging between 0.13–0.43 that were distributed over the entire Cox-2 gene and captured most common variations in the African American population. Two polymorphisms located in intron 5 and in the 3’ FR showed a protective effect for adenoma development.
A reduced risk of adenoma development in African Americans in carriers of the heterozygous genotype at intron 5–5229 in the Cox-2 gene is consistent with the previous finding of the protective effect of this polymorphism on development of colorectal adenoma in Caucasians (12). Interestingly, a Swedish study reported a protective effect of the same polymorphism (rs20432) (referred to as position +3100) for prostate cancer (20). It is also noteworthy that, similar to our study in African Americans, the heterozygous but not the variant homozygous genotype at intron 5–5229 had an inverse association with prostate cancer risk in a Swedish population (20). Intronic sequences are believed to harbor transcriptional regulatory elements. The intronic variants may therefore modulate disease risk by regulating gene expression, gene splicing, or transcript stability (21). A protective effect of the variant G allele at intron 5–5229 of the Cox-2 gene in colorectal and prostate cancer may indicate a transcription regulatory role of intronic sequences. Alternatively, the intron 5–5229 polymorphism may be in linkage disequilibrium with a nearby functional polymorphism.
Another polymorphism with a protective effect for adenoma development was detected at position 10935 in the 3’ flanking region of the Cox-2 gene. This is located downstream of the polyadenylation signal and AU-rich elements. Previously, disease-associated variants have been described in the 3’ flanking region of genes that affect transcription factor-binding sites (22). Polymorphisms in the Cox-2 gene located upstream of the 3’FR-10935 position have been reported to have cancer-modulating effect. Especially, both positive and negative association of the 3’ UTR-8494 polymorphism with various types of cancer has been widely reported (12). In particular, the heterozygous, but not the variant homozygous genotype at 3’ UTR-10494 was found to be protective for prostate cancer in a Swedish population (20). Although, there was no evidence of a risk-modulating effect of the previously reported 8494 or 10494 variants of the Cox-2 gene in our small study, the protective effect of the nearby 3’ FR-10935 polymorphism underscores the significance of allelic variants in the 3’ regulatory region of the Cox-2 gene in affecting the risk of cancer development.
In summary, our study underscores the relevance of genetic variants in the regulatory regions of Cox-2 in modulating cancer risk. In the absence of any information on the functional significance of the intron 5–5229 and 3’FR-10935 polymorphisms in development of colorectal adenoma in African Americans, future studies with larger numbers of cases and controls will be necessary to rule out the possibility that the protective effect of Cox-2 variants in the regulatory regions on adenoma development is a chance finding.
Acknowledgements
This work was supported by Grant #CA102681, funded by the National Cancer Institute and GCRC.
References
- 1.Jemal A, Siegel R, Ward E, Murray T, Xu J and Thun MJ: Cancer statistics, 2007. CA Cancer J Clin 57: 43–66, 2007. [DOI] [PubMed] [Google Scholar]
- 2.Kauh J, Brawley OW and Berger M: Racial disparities in colorectal cancer. Curr Probl Cancer 31: 123–133, 2007. [DOI] [PubMed] [Google Scholar]
- 3.Satia JA, Galanko JA and Rimer BK: Methods and strategies to recruit African Americans into cancer prevention surveillance studies. Cancer Epidemiol Biomarkers Prev 14: 718–721, 2005. [DOI] [PubMed] [Google Scholar]
- 4.Macarthur M, Sharp L, Hold GL, Little J and El-Omar EM: The role of cytokine gene polymorphisms in colorectal cancer and their interaction with aspirin use in the northeast of Scotland. Cancer Epidemiol Biomarkers Prev 14: 1613–1618, 2005. [DOI] [PubMed] [Google Scholar]
- 5.Sansbury LB, Bergen AW, Wanke KL, Yu B, Caporaso NE, Chatterjee N, Ratnasinghe L, Schatzkin A, Lehman TA, Kalidindi A, Modali R and Lanza E: Inflammatory cytokine gene polymorphisms, nonsteroidal anti-inflammatory drug use, and risk of adenoma polyp recurrence in the polyp prevention trial. Cancer Epidemiol Biomarkers Prev 15: 494–501, 2006. [DOI] [PubMed] [Google Scholar]
- 6.Gunter MJ, Canzian F, Landi S, Chanock SJ, Sinha R and Rothman N: Inflammation-related gene polymorphisms and colorectal adenoma. Cancer Epidemiol Biomarkers Prev 15: 1126–1131, 2006. [DOI] [PubMed] [Google Scholar]
- 7.Cao Y and Prescott SM: Many actions of cyclooxygenase-2 in cellular dynamics and in cancer. J Cell Physiol 190: 279–286, 2002. [DOI] [PubMed] [Google Scholar]
- 8.Baron JA: Epidemiology of non-steroidal anti-inflammatory drugs and cancer. Prog Exp Tumor Res 37: 1–24, 2003. [DOI] [PubMed] [Google Scholar]
- 9.Steinbach G, Lynch PM, Phillips RK, Wallace MH, Hawk E, Gordon GB, Wakabayashi N, Saunders B, Shen Y, Fujimura T, Su LK and Levin B: The effect of celecoxib, a cyclooxygenase-2 inhibitor, in familial adenomatous polyposis. N Engl J Med 342: 1946–1952, 2000. [DOI] [PubMed] [Google Scholar]
- 10.Bertagnolli MM, Eagle CJ, Zauber AG, Redston M, Solomon SD, Kim K, Tang J, Rosenstein RB, Wittes J, Corle D, Hess TM, Woloj GM, Boisserie F, Anderson WF, Viner JL, Bagheri D, Burn J, Chung DC, Dewar T, Foley TR, Hoffman N, Macrae F, Pruitt RE, Saltzman JR, Salzberg B, Sylwestrowicz T, Gordon GB and Hawk ET: Celecoxib for the prevention of sporadic colorectal adenomas. N Engl J Med 355: 873–884, 2006. [DOI] [PubMed] [Google Scholar]
- 11.Arber N, Eagle CJ, Spicak J, Racz I, Dite P, Hajer J, Zavoral M, Lechuga MJ, Gerletti P, Tang J, Rosenstein RB, Macdonald K, Bhadra P, Fowler R, Wittes J, Zauber AG, Solomon SD and Levin B: Celecoxib for the prevention of colorectal adenomatous polyps. N Engl J Med 355: 885–895, 2006. [DOI] [PubMed] [Google Scholar]
- 12.Ali IU, Luke BT, Dean M and Greenwald P: Allellic variants in regulatory regions of cyclooxygenase-2: association with advanced colorectal adenoma. Br J Cancer 93: 953–959, 2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Koh WP, Yuan JM, van den Berg D, Lee HP and Yu MC: Interaction between cyclooxygenase-2 gene polymorphism and dietary n-6 polyunsaturated fatty acids on colon cancer risk: the Singapore Chinese Health Study. Br J Cancer 90: 1760–1764, 2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Ulrich CM, Whitton J, Yu JH, Sibert J, Sparks R, Potter JD and Bigler J: PTGS2 (COX-2) −765G > C promoter variant reduces risk of colorectal adenoma among nonusers of nonsteroidal anti-inflammatory drugs. Cancer Epidemiol Biomarkers Prev 14: 616–619, 2005. [DOI] [PubMed] [Google Scholar]
- 15.Tan W, Wu J, Zhang X, Guo Y, Liu J, Sun T, Zhang B, Zhao D, Yang M, Yu D and Lin D: Associations of functional polymorphisms in cyclooxygenase-2 and platelet 12- lipoxygenase with risk of occurrence and advanced disease status of colorectal cancer. Carcinogenesis 28: 1197–1201, 2007. [DOI] [PubMed] [Google Scholar]
- 16.Lin HJ, Lakkides KM, Keku TO, Reddy ST, Louie AD, Kau IH, Zhou H, Gim JS, Ma HL, Matthies CF, Dai A, Huang HF, Materi AM, Lin JH, Frankl HD, Lee ER, Hardy SI, Herschman HR, Henderson BE, Kolonel LN, Le Marchand L, Garavito RM, Sandler RS, Haile RW and Smith WL: Prostaglandin H synthase 2 variant (Val511Ala) in African Americans may reduce the risk for colorectal neoplasia. Cancer Epidemiol Biomarkers Prev 11: 1305–1315, 2002. [PubMed] [Google Scholar]
- 17.Sansbury LB, Millikan RC, Schroeder JC, North KE, Moorman PG, Keku TO, de Cotret AR, Player J and Sandler RS: COX-2 polymorphism, use of nonsteroidal anti-inflammatory drugs, and risk of colon cancer in African Americans (United States) . Cancer Causes Control 17: 257–266, 2006. [DOI] [PubMed] [Google Scholar]
- 18.Panguluri RC, Long LO, Chen W, Wang S, Coulibaly A, Ukoli F, Jackson A, Weinrich S, Ahaghotu C, Isaacs W and Kittles RA: COX-2 gene promoter haplotypes and prostate cancer risk. Carcinogenesis 25: 961–966, 2004. [DOI] [PubMed] [Google Scholar]
- 19.Costas J, Salas A, Phillips C and Carracedo A: Human genome- wide screen of haplotype-like blocks of reduced diversity. Gene 349: 219–225, 2005. [DOI] [PubMed] [Google Scholar]
- 20.Shahedi K, Lindstrom S, Zheng SL, Wiklund F, Adolfsson J, Sun J, Augustsson-Balter K, Chang BL, Adami HO, Liu W, Gronberg H and Xu J: Genetic variation in the COX-2 gene and the association with prostate cancer risk. Int J Cancer 119: 668–672, 2006. [DOI] [PubMed] [Google Scholar]
- 21.Fedorova L and Fedorov A: Introns in gene evolution. Genetica 118: 123–131, 2003. [PubMed] [Google Scholar]
- 22.Chen JM, Ferec C and Cooper DN: A systematic analysis of disease-associated variants in the 3’ regulatory regions of human protein-coding genes II: the importance of mRNA secondary structure in assessing the functionality of 3’ UTR variants. Hum Genet 120: 301–333, 2006. [DOI] [PubMed] [Google Scholar]